Current IssueSpecial IssueEditorial BoardOnline First ArticlesArchive
Current IssueSpecial IssueEditorial BoardOnline First ArticlesArchive

Full Research Article

Biochemical Study of CYP1A1 Gene in Non-hodgkin Lymphoma Patients Infection with Epstein Barr Virus

B
Baan Abdulatif Mtashar1
Y
Yusur Falah Faraj2
E
Elaf Zuhair Hmeed2
F
Fatmah Abdalhamza Obed2
A
Aseel Majeed Hameed2
Y
Yusra Ghiath2
M
Mohanad Salam Hussein2
H
Haneen Mushtaq Hameed3,*
1Depatment of Microbiology, Collage of Medicine, Mustansiriyah University, Baghdad, Iraq.
2National Center of Hematology, Mustansiriyah University, Baghdad, Iraq.
3Biotechnology Research Center, Al-Nahrain University, Baghdad, Iraq.

ABSTRACT

Background: The objective of this study was to establish the correlation between genetic variations of the CYP1A1 gene and the proportion of epstein-barr virus (EBV) in individuals diagnosed with non-hodgkin’s lymphoma.

Methods: For this case-control study, 75 NHL patients were included together with 50 healthy controls selected from both general hospitals and several private clinical facilities in the Middle Euphrates region of Iraq. The study population spanned from 20 to 69 years of age. Collection of specimens was place between March 2023 and October 2023. CYP1A1 gene polymorphism by sequencing as well as conventional PCR was chosen for the detection of EBV.

Result: The results showed that CYP1A1 gene polymorphism distribution was according to GA; GG and AA were 38.7%; 34.7% and 26.6%, In those diagnosed with NHL, the percentages were 28%, 46% and 26% correspondingly. correspondingly in the AHC group. Among patients with NHL, the prevalence of EBV was 21.3% (16 out of 75 cases).

INTRODUCTION

NHL, or non-Hodgkin lymphoma, ranks as the 10th most prevalent malignancy globally, with an estimated 386,000 new cases being identified year. Indeed, it ranks as the 11th predominant cause of cancer-associated mortality worldwide, culminating in around 199,000 fatalities annually. The disease NHL is characterized by its heterogeneity and may be influenced by several risk factors including infectious agents, environmental exposure, various genetic events, chemicals, sunlight and autoimmune disorders (De Roos et al., 2006).
       
Impaired immune function, another risk factor for NHL, helps to increase the cancer-causing effects of infectious pathogens. Considering the diverse characteristics of NHL, it is not possible to solely attribute all subtypes of the disease to infection (Aguayo et al., 2021).
       
The CYP1A1 gene is located at chromosome 15q22-q24. The cytochrome P450 enzyme CYP1A1 is part of a large family of cytochromes (CYP) and is defined by placing it into CYP1 family, CYP1A sub-family and CYP1A1 member. CYP1A1 is the most effective primary metaboliser (hydroxylating) of pro-carcinogens in phase I biotransformation (Kim et al., 2009).
       
CYP1A1 is also involved in the hydroxylation of a site on an aromatic ring, which is another reaction traditionally associated with this enzyme as a classic indicator of the earliest stages of cancer formation, due to the generation of many different types of chemically reactive compounds associated with cancer’s initiation (Inoue et al., 2012). Genetic variations (Also called single nucleotide polymorphisms or SNPs) within CYP1A1 affect CYP1A1’s catalytic function, thereby limiting CYP1A1’s ability to metabolise chemical carcinogens and mutagens. One of the most prevalent SNPs is CYP1A1*2A (T3801C; rs4646903) that has a T to C base substitution beyond the 3′ end of the coding region for CYP1A1. There have been some reports linking this SNP to differences in the ability of CYP1A1 to express mRNA, changes in Cyp1A1 mRNA stability, or to produce an enzyme with marked increase in inducible enzymes (Bakkalci et al., 2020).
       
The Epstein-Barr Virus (EBV), part of the human herpesvirus group, was first identified in a sample of cultured B-cell lymphoma cells in 1964. The first proof of EBV as a carcinogen was its association with a Burkitt Lymphoma (BL) cell line, though now we also connect it to many types of malignant tumours, including B and T-cell types (Obradović, 2023). One theory explaining how EBV causes cancer suggests that EBV-infected B-lymphocytes move through the germinal centre, where they become dormant memory B-lymphocytes that allow EBV to stay latent until it reactivates to infect new B-lymphocytes (Perera et al., 2023). An association has been established between latency pattern and both Hodgkin lymphoma (HL) and T-cell non-Hodgkin lymphomas. Moreover, latency type III results in the expression of the entire EBV repertoire, including EBNAs, EBERs and LMPs. It is noted in relation to post-transplant lymphoproliferative disorders (PTLDs) and other states of diminished immune function (Patini et al., 2023). EBV-positive diffuse large B-cell lymphoma (DLBCL) demonstrates latency types II and III (Turi et al., 2023). Latency proteins of EBV are essential in interrupting important signaling pathways that facilitate the development of lymphomas. One example of an oncogene is LMP-1, which can induce constitutive signaling, activate B-cells and increase the expression of anti-apoptotic proteins (Liu et al., 2023). Effector B-cell nuclear antigens (EBNAs) can also function in the ability of Factors in transcription, facilitating the proliferation and metamorphosis of B-cells (Lehnen and Hallek, 2023).

MATERIALS AND METHODS

This study is structured as a case-control study. 
 
Study groups
 
Blood from each study group of Patients with NHL should be enrolled, that classify into:
1. Group of blood samples from patients with NHL.
2. Blood of apparently healthy persons as control group.
 
Sample collection
 
The Blood samples will be collected from patients subjected to Patients with NHL and apparently healthy persons as control group from general hospitals as well as Iraqi center for blood cancer-Iraq.
 
Detection of SNP of CYP17A1 rs743572 by sequencing
 
Total genomic DNA from blood of both patients and control groups extracted by using DNA extraction kit (G-SPIN- INTRON\ KOREA). After then was detection of determine  of  CYP17A1rs743572 SNP  by Sequencing. The primer used in these study was:
CYP17A1-F: GGTGGCCGACAATCACTGTA
CYP17A1-R: GAGGTTTGCCCTGGAGTTGA
Product: 4756 bp

Extraction of viral genome and EBV detection
 
Viral genomic DNA from blood of both patients and control groups were extracted by using a viral DNA extraction kit (PATHOGENE- INTRON\ KOREA). After then was detection of HHV-6 by PCR technique.
       
Five hundred Nano-gram of DNA from blood were used for PCR in order to detection EBV by using 5′-CCAG TGCTGTGATCGAGCATCT-3′ and EBV reverse primer, 5′-CTGCTGACAAACTGCTGCATTC-3′.
       
The PCR conditions for EBV were as follows: 37°C for 2 mins and 94°C for 2 mins followed by 40 cycles at 93°C for 15 s and 60°C for 1 min.
 
Statistical analysis
 
In order to determine the significance of the variables used in this research, the Chi-square test was undertaken. All statistical tests were done using Version-25 of SPSS, with a significant p value of <0.05.

RESULTS AND DISCUSSION

Age distribution of study groups
 
The age ranged of patients with NHL from 20 from 69 years with mean = 48.7+10.8 years); while the apparently healthy control group have a mean of 46.9+11.2 years. However, no significant variations were detected when comparison between studied groups (P>0.05) (Table 1).

Table 1: Distribution of studied patients with NHL according to the mean and range of their age.


 
Sex distribution of the patients with NHL and AHC
 
Males with NHL was higher (61.3%: 62) than their female counter parts (38.7%: 38.7). In the control group, males constituted a higher percentage (62%: 31) compared to females (38%: 19). The statistical analysis revealed a significant difference between sex groups (P<0.01) within the examined cohorts (Table 2).

Table 2: Distribution of the studied patients with NHL according to their sex.


 
Genotyping of CYP17A1 rs743572 polymorphism 
 
The distribution of polymorphism in DNA was shown to have a statistically significant difference between patients and controls. Table (3) shows this to make the difference even more clear. The results for GA GG and AA were: 38.7% 34.7% and 26.6% in the overall population and 28% 46% and 26% in the NHL population.

Table 3: Genotyping of CYP17A1 gene (rs743572) in patients with NHL and AHC groups.


 
Detection of EBV genome by conventional PCR
 
The percentage of EBV in patients with NHL was 21.3% (16 out of 75 cases). While, 4% positive EBV genome in AHC specimens (Table 4). The statistical analysis of the differences between these two groups were significant (p = 0.03).

Table 4: Results of EBV- DNA in NHL specimens among study groups.


 
Spearman’s Rho statistical investigation of age, gender, EBV-DNA PCR and CYP17A1 rs743572 SNPs to determine if the markers assessed correlated in the individuals assessed in this report (NHL)
 
Researchers found that there was a statistically significant association between the SNP CYP17A1 rs743572 and the presence of EBV-DNA in NHL patients; r=0.365; p=0.019.
       
Also, there was a non-significant correlation between the SNP of CYP17A1 rs743572 and the age of NHL patients; p=0.244; r=0.040.
       
However, there were no significant correlations among sex and SNP of CYP17A1rs743572 in the current study (r=0.775; p=0.8). Furthermore, non-significant correlations among EBV and age  in the current study (r=0.684; p=0.6). Lastly, significant correlations between EBV-DNA and sex  of patients with NHL of current study (r=0.244; p=0.04 as illustrated in Table (5).

Table 5: Spearman’s Rho statistical testing of age, sex, EBV-DNA-PCR and CYP17A1rs743572 SNP to evaluate the studied markers in patients with NHL.


       
We underwent an extensive study where we analyzed the possible impact of gene polymorphisms described by the following genes: NQO1, CYP1A1, GSTT1, GSTM1, GSTP1. The purpose of our study was:
1. To determine if specific genetic variations are associated with non-hodgkin lymphoma (NHL).
2. to determine if smoking has an impact on the association between the genetic polymorphisms and susceptibility to NHL.
       
The prevailing consensus is that external carcinogens undergo metabolism in human beings, resulting in the production of active metabolites that bind to and disturb nuclear and mitochondrial DNA (Zakiullah et al., 2020; Devkatte et al., 2022).
       
The oxidative metabolism of xenobiotics, which are substances found outside the usual biochemical composition of an organism such as medications and poisons, can be achieved by the phase I cytochrome P450 enzyme superfamily, including CYP1A1, CYP2D6, CYP2C9 and CYP2C19. Xenobiotics are oxidized by liver enzymes using singlet oxygen, resulting in the formation of very active intermediate metabolites (Vander, 2020; Patil and More, 2025).
       
Multiple studies have demonstrated that the CYP1A1 MspI T6235C polymorphism is linked to a higher susceptibility to lung cancer in Asian populations, particularly in connection to tobacco use (de Castro, 2019; Borah et al., 2025).
       
Current study results indicate that the DNA polymorphism distribution across GA genotypes; GG; AA based on the sample’s results were 38.7%; 34.7% and 26.6% In non-hodgkin’s lymphoma patients and 28%; 46%; and 26% in alcoholic hepatitis patients are consistent with the results reported by statistically significant differences were also demonstrated for both AA and AG genotypes, as well as the G allele, in the CYP1A1 polymorphism (Rivera, 2020; Chabukdhara et al., 2023).
       
The genetic variations we analyzed in our study corroborate the findings of Liu et al. (2018) that both CYP1A1 genotype (A/G) 4889 and CYP1A1 genotype A/G+G/G are associated with a higher risk for Non-Hodgkin Lymphoma (NHL). Studies have shown that the A4889G polymorphisms within CYP1A1 are linked to increased susceptibility to lymphoma even in non-smokers.
       
An association was not apparent between CYP1A1 6235 and CYP1A1 4889 from an investigation consisting of 182 Saudi Arabian subjects compared to a control group of 511 individuals (Quadri et al., 2005). The study also showed that CYP1A1 4889 was not detected in cases (n=1172) or compared to healthy controls (n=982) from California or eighteen cases from Australia, respectively and there were 451 cases with the disease and 526 cases without in connecticut. Three genetic variants were identified at the CYP1A1 gene using PCR-RFLP, namely T6235C (m1), A4889G (m2) and C4887A (m4). The identified mutations were used to designate three distinct alleles, namely CYP1A1*2A (only m1), CYP1A1*2B (m1) and CYP1A1*4 (only m4)()(Many ethnic studies have reported that there is a correlation between variations in different allelic forms of CYP1A1 with lympho-proliferative diseases). The CYP1A1 gene encodes an enzyme that converts hydrocarbons to 3-hydroxy derivative through hydroxylation at the first phase of the metabolism of a variety of exogenous substances xenobiotics such as polycyclic aromatic hydrocarbons (e.g. benzopyrene (Daaboul et al., 2020; Lingaiah et al., 2024). Intermediates from 3899 (from fairley’s study) activity will covalently modify proteins through the production of hydroxyl as an intermediate) through modifications of proteins during catalysis create covalent bonds and thus increased the cytotoxicity, mutagenicity, or carcinogenicity of synthetic molecules (Daaboul et al., 2020; Lingaiah et al., 2024). An underlying genetic variation in the CYP1A1 gene results in increased enzymatic activity. Therefore increasing the concentrations of detrimental metabolites, Specifically, the CYP1A1*2A mutation has been demonstrated to elevate susceptibility to leukemia, especially in adolescents exposed to both pesticides and tobacco smoke (Arendt, 2018; Bhosale et al., 2024). (Hoseini, 2017; Gaina et al., 2023). Higher frequencies of both homozygous and heterozygous CYP1A1 gene variations (e.g. 4887C>A, 4889A>G and 6235T>C) were found in individuals with B-cell chronic lymphocytic leukaemia (B-CLL) than in controls.
       
Despite the increasing recognition of the involvement of EBV in the development of non-hodgkin’s lymphoma, the therapy of this disease remains inadequate Progress in the development of antiviral medications and treatments using targeted monoclonal antibodies shows promising outcomes (Ahmadullah, 2015; Ali et al., 2021; Pesavento et al., 2019).
       
Even if numerous studies have investigated the entire spectrum of HL and NHL as far as the effect of EBV, there has only been limited research into the association between these lymphoid malignancies and EBV. There appears to be an increasing body of evidence supporting a causal role for EBV in certain types of lymphoma such as diffuse large B-cell lymphoma (DLBCL) or angioimmunoblastic T-cell lymphoma (AITL). The degree of EBV involvement in small B-cell lymphomas was considered to be low; however, there have also been limited systematic investigations into this phenomenon (Sini, 2017; Wang et al., 2015).
       
The percentage of EBV  in patients with NHL of current results  was 21.3% (16 out of 75 cases) have. While, 4% positive EBV genome in AHC specimens. our findings in line with other studies report  (Hossain, 2017).  The findings of  Go et al., (2015) indicate that 35% (95% CI 31-8-39-4) of lymphoma cases in Europe are associated with EBV, whereas comparable rates in North America accounts for 32%, while Australia constitutes 29% support the idea that one third of lymphoma cases are tied to EBV. Even while the numberal of instances with a certain cHL subtype is few, Our data collection clearly indicates, consistent with existing research, Mixed-cellularity and lymphocyte-depleted patients exhibit a greater frequency of EBV-positive tumours, whereas nodular sclerosis cases have a lower prevalence (Wang et al., 2015). Notably, Among cases of congenital haemorrhagia in Asia, Latin America and Africa, the prevalence of EBV positive is higher, with rates ranging from 50% to 74%.
       
In their 2020 study, reported a prevalence of 10.4% (7 out of 67 patients) with LMP 1 positive NHLs, which is similar to the findings of Meng et al., (2015); Yu et al., (2015). However, Amal Ismail and colleagues reported that 17% of NHL cases tested positive for LMP-1. This could be attributed to the fact that their sample largely consisted of Burkitt lymphoma. Notably, our analysis did not include any cases of burkitt lymphoma.
       
In 2010, Yang and coworkers gathered samples from 60 nasal and nasopharyngeal non-Hodgkin lymphoma (NHL) cases. Of these 60 patients, 35 tested positive for EBER, yielding an overall frequency of EBER positivity (35/60), which was 58.3%. Of the 60 cases, 29 were classified as NK/T-cell lymphomas; of these, 19 were tested to be positive for EBER and had an overall EBER positivity frequency of 65.5% (19 of 29). In comparison, 31 were classified as B-cell lymphomas. Of the 31 cases, 16 were EBER positive, yielding an overall EBER positivity frequency of 51.6% (16 of 31). There was no statistically significant difference between the frequencies of EBER positivity in NK/T-cell lymphomas and B-cell lymphomas from nasal cavity and nasopharynx (P>0.05).

CONCLUSION

A variation in the CYP1A1 gene may contribute to the development of NHL, particularly when factored in by local confounding elements such as EBV infection.

ACKNOWLEDGEMENT

The authors thank National Center of Hematology, Mustansiriyah University, Baghdad, Iraq for their support in collecting samples.
 
Funding
 
No university, institute, or foundation provided funding for the research paper , All support was provided by the authors.

CONFLICT OF INTEREST

The authors declare that there is no conflict of interest between the authors.

REFERENCES


  1. Aguayo, F., Boccardo, E., Corvalán, A., Calaf, G.M., and Blanco, R. (2021). Interplay between Epstein-Barr virus infection and environmental xenobiotic exposure in cancer. Infectious Agents and Cancer. 16(1): 50. 

  2. Ahmadullah, A. (2015). Genetic susceptibility to oral cancer due to combined effects of GSTT1, GSTM1 and CYP1A1 gene variants in tobacco addicted patients of pashtun ethnicity of Khyber Pakhtunkhwa province of Pakistan. Asian Pacific Journal of Cancer Prevention. 16(3): 1145-50. 

  3. Ali, M., Khan, M., Aslam, A., Rehman, H., Anjum, A., Waheed, S. and Masood, A. (2021). Molecular characterization and pathology of virulent newcastle disease virus isolated from broiler chickens in District Lahore, Pakistan. Indian J. Animal Res. 59(6): 1004-1011. doi: 10.18805/IJAR.BF-1420.

  4. Arendt, M. (2018). Genetische Effekte Auf Die Erhöhung von Freien Leichtketten im Serum. Universitaet Duisburg-Essen (Germany). 

  5. Bakkalci, D., Jia, Y., Winter, J.R., Lewis, J.E., Taylor, G.S. and Stagg, H.R. (2020). Risk factors for Epstein Barr virus-associated cancers: A systematic review, critical appraisal and mapping of the epidemiological evidence. Journal of Global Health. 10(1): 010405. 

  6. Bhosale, A.V., Tumlam, U.M., Pawade, M.M., Kamdi, B.P., Mhase, P.P., Barate, A. K. and Muglikar, D.M. (2024). Detection of canine viral and bacterial agents associated with gastroenteritis by PCR and RT-PCR. Indian Journal of Animal Research. 58(4): 666-670. doi: 10.18805/IJAR.B-4932. 

  7. Borah, B., Sharma, K., Borah, P., Deka, D., Deka, P., Hazarika, A.K. and Singh, A.P. (2025). Development of Indirect and sandwich ELISA for sero-surveillance and detection of swinepox virus. Indian Journal of Animal Research. 59(2): 299-304. doi: 10.18805/IJAR.B-4727.

  8. Chabukdhara, P., Dhruba, J.K., Tamuly, S., Naba, J.D., Bordoloi, G., Khargharia, S. and Gogoi, A. (2023). Alteration of liver and kidney specific biomarkers in indigenous ducks infected with duck plague virus. Indian Journal of Animal Research. 57(7): 956-959. doi: 10.18805/IJAR.B-5103. 

  9. Daaboul, H.E. (2020). The in vitro and in vivo anticancer effect of β-2-Himachalen-6-ol Isolated from the Lebanese Daucus carota spp. Carota (Doctoral Dissertation, University of Surrey).

  10. de Castro Gouveia, M.J. (2019). Novel Therapeutics Approaches Against Schistosoma Haematobium and Opisthorchis Viverrini and Associated Cancer (Bladder Cancer and Cholangiocarcinoma) (Doctoral dissertation, Universidade do Porto (Portugal). 

  11. De Roos, A.J., Gold, L.S., Wang, S., Hartge, P., Cerhan, J.R, Cozen, W., et al. (2006). Metabolic gene variants and risk of non-Hodgkin’s lymphoma. Cancer Epidemiology  Biomarkers  and Prevention. 15(9): 1647-1653. 

  12. Devkatte, A.Y., Jadhav, P.V., Kumar, R., Dongre, V.B., Sharma, P., Gaikwad, N.Z. and Khillare, B.S. (2022). Association between the Ovine MHC-DRB1 gene and its resistance to gastrointestinal parasites in deccani sheep raised in hot semi-arid ecosystem of India. Indian Journal of Animal Research. 59(4): 568-573. doi: 10.18805/IJAR.B-4781. 

  13. Gaina, C.D., Sanam, M.U., Nalley, W.M.M., Benu, I. and Amalo, F.A. (2023). The potency of the BMP 15 gene as a marker of reproductive traits in sumba ongole (Bos indicus) cattle. Agricultural Science Digest-A Research Journal. 43(3): 402-407. doi: 10.18805/ag.DF-513.

  14. Go, R.E., Hwang, K.A. and Choi, K.C. (2015). Cytochrome P450 1 family and cancers. The Journal of Steroid Biochemistry and Molecular Biology. 147: 24-30. 

  15. Hoseini, S.M.M. (2017). Glutathione S-transferase M1-T1 null genotypes and susceptibility to hodgkin’s lymphoma. Genetika. 9(3): 911-920. doi: 10.2298/GENSR1703911M.

  16. Hossain, T. (2017). Identification of Socio-Demographic and Behavioral Risk Factors of Oral Cancer in Rural and Urban Areas of Bangladesh (Doctoral dissertation, East West University).

  17. Inoue, H., Mishima, K., Yamamoto-Yoshida, S., Ushikoshi-Nakayama, R., Nakagawa, Y., Yamamoto, K. and Saito, I. (2012). Aryl hydrocarbon receptor-mediated induction of EBV reactivation as a risk factor for sjögren’s syndrome. The Journal of Immunology. 188(9): 4654-4662.

  18. Kim, H.N., Kim, N.Y., Yu, L., Kim, Y.K., Lee, I.K., Yang, D.H. and Kim, H.J. (2009). Polymorphisms of drug metabolizing genes and risk of non hodgkinlymphoma. American Journal of Hematology. 84(12): 821-825. 

  19. Lehnen, N. and Hallek, M. (2023). Geschlechtsspezifische unterschiede spezieller tumorerkrankungen. Die Innere Medizin. 64(8): 717-726.

  20. Lingaiah, N., Raju, S., Sarla, N., Radhika, K., Venkanna, V. and Reddy, D. (2024). Understanding of gene action for nutritional traits in elite rice (Oryza sativa L.) crosses. Agricultural Science Digest. 44(1): 94-99. doi: 10.18805/ag.D-5330. 

  21. Liu, J., Hu, Z., Feng, Y., Zeng, S. and Zhong, M. (2018). Problems to affect long-term survival for breast cancer patients: An observational study of subsequent lung/bronchus malignancies. Medicine. 97(39): e12603. 

  22. Liu, J., Huang, B., Ding, F. and Li, Y. (2023). Environment factors, DNA methylation and cancer. Environmental Geochemistry and Health. 45(11): 7543-7568. 

  23. Meng, F.D., Ma, P., Sui, C.G., Tian, X. and Jiang, Y.H. (2015). Retracted Article: Association between cytochrome P450 1A1 (CYP1A1) gene polymorphisms and the risk of renal cell carcinoma: A meta-analysis. Scientific Reports. 5(1): 8108. 

  24. Obradović, B. (2023). Analysis of Expression of Genes Encoding Enzymes CYP3A4, CYP2B6 and ABCB1 Transporter in Patients with HIV and HCV Infections Treated with Antiviral Medications (Doctoral dissertation, University of Belgrade (Serbia). 

  25. Patil, R.G. and More, A. (2025). A Comparative study and optimization of deep learning models for grape leaf disease identification. Indian Journal of Agricultural Research. 59(4): 654-663. doi: 10.18805/IJARe.A-6242.

  26. Patini, R., Cordaro, M., Marchesini, D., Scilla, F., Gioco, G., Rupe, C. and Lajolo, C. (2023). Is systemic immunosuppression a risk factor for oral cancer? A systematic review and meta-analysis. Cancers. 15(12): 3077. 

  27. Perera, M., Perera, I. and Tilakaratne, W. M. (2023). Oral microbiome and oral cancer. Immunology for Dentistry. pp. 79-99.

  28. Pesavento, P.A., Agnew, D., Keel, M.K. and Woolard, K.D. (2019). Author correction: Cancer in wildlife: Patterns of emergence. Nature reviews. Cancer. 19(5): 299.

  29. Quadri, S.A., Shukla, S.N., Singh, A.P. and Sarkhel, B.C. (2005). Effect of leptin and IGF-I supplementation on in vitro maturation and expression of apoptotic genes in goat oocytes. Indian Journal of Animal Research. 59(7): 1115-1119. doi: 10.18805/IJAR.B-4829.

  30. Rivera, M.P. (2020). Lung Cancer, Part I, An Issue of Clinics in Chest Medicine. Elsevier Health Sciences. 41(1).

  31. Sini, B.C. (2017). Relação entre os polimorfismos da paraoxonase 1 e do citocromo P450 em pacientes com imunodeficiência comum variável em uso de medicamentos ou exposição a poluentes ambientais (Doctoral dissertation, Universidade de São Paulo).

  32. Turi, M., Anilkumar Sithara, A., Hofmanová, L., Žihala, D., Radhakrishnan, D., Vdovin, A. and Hrdinka, M. (2023). Transcriptome analysis of diffuse large b-cell lymphoma cells inducibly expressing MyD88 L265P mutation identifies upregulated CD44, LGALS3, NFKBIZ and BATF as downstream targets of oncogenic NF-κB signaling. International Journal of Molecular Sciences. 24(6): 5623. 

  33. Vander, P.V. (2020). Epidemiology, Risk Factors, Pathology and Natural History of Head and Neck Neoplasms. In Head and Neck Cancer Imaging. Cham: Springer International Publishing. (pp. 1-20).

  34. Wang, F., Chen, J., Wang, L., Ma, Y. and Mayinuer, N. (2015). CYP1A1 genetic polymorphisms and uterine leiomyoma risk: A meta-analysis. International Journal of Clinical and Experimental Medicine. 8(3): 3590. 

  35. Wang, X., Yue, K. and Hao, L.R. (2015). CYP1A1 MspI polymorphism and susceptibility to lung cancer in the Chinese population: An updated meta-analysis and review. International Journal of Clinical and Experimental Medicine. 8(8): 11905.

  36. Yu, B.W., Zhang, L.Q., Teng, X.L., Zhang, Y., Zou, L.B. and Ying, H.Y. (2015). Association between the CYP1A1 polymorphisms and hepatocellular carcinoma: A meta-analysis. Genet. Mol. Res. 14(1): 1076-1084. 

  37. Zakiullah, S.M., Ovais, M., Khuda, F., Javed, N., Ali, S. and Khisroon, M. (2020). Association of non-Hodgkin lymphoma risk with CYP1A1, GSTM1 and GSTT1 gene variants, in tobacco addicted patients of Pashtun ethnicity of Khyber Pakhtunkhwa, Pakistan. Pak. J. Pharm. Sci. 33: 2617- 2624.
Published In
Asian Journal of Dairy and Food Research
Article Metrics
Metrics Icon
34
Views
0
Citations
Reviewed By
Share Article
Download Article
In this Article
    Contact us
    Follow us

    Full Research Article

    Biochemical Study of CYP1A1 Gene in Non-hodgkin Lymphoma Patients Infection with Epstein Barr Virus

    B
    Baan Abdulatif Mtashar1
    Y
    Yusur Falah Faraj2
    E
    Elaf Zuhair Hmeed2
    F
    Fatmah Abdalhamza Obed2
    A
    Aseel Majeed Hameed2
    Y
    Yusra Ghiath2
    M
    Mohanad Salam Hussein2
    H
    Haneen Mushtaq Hameed3,*
    1Depatment of Microbiology, Collage of Medicine, Mustansiriyah University, Baghdad, Iraq.
    2National Center of Hematology, Mustansiriyah University, Baghdad, Iraq.
    3Biotechnology Research Center, Al-Nahrain University, Baghdad, Iraq.

    ABSTRACT

    Background: The objective of this study was to establish the correlation between genetic variations of the CYP1A1 gene and the proportion of epstein-barr virus (EBV) in individuals diagnosed with non-hodgkin’s lymphoma.

    Methods: For this case-control study, 75 NHL patients were included together with 50 healthy controls selected from both general hospitals and several private clinical facilities in the Middle Euphrates region of Iraq. The study population spanned from 20 to 69 years of age. Collection of specimens was place between March 2023 and October 2023. CYP1A1 gene polymorphism by sequencing as well as conventional PCR was chosen for the detection of EBV.

    Result: The results showed that CYP1A1 gene polymorphism distribution was according to GA; GG and AA were 38.7%; 34.7% and 26.6%, In those diagnosed with NHL, the percentages were 28%, 46% and 26% correspondingly. correspondingly in the AHC group. Among patients with NHL, the prevalence of EBV was 21.3% (16 out of 75 cases).

    INTRODUCTION

    NHL, or non-Hodgkin lymphoma, ranks as the 10th most prevalent malignancy globally, with an estimated 386,000 new cases being identified year. Indeed, it ranks as the 11th predominant cause of cancer-associated mortality worldwide, culminating in around 199,000 fatalities annually. The disease NHL is characterized by its heterogeneity and may be influenced by several risk factors including infectious agents, environmental exposure, various genetic events, chemicals, sunlight and autoimmune disorders (De Roos et al., 2006).
           
    Impaired immune function, another risk factor for NHL, helps to increase the cancer-causing effects of infectious pathogens. Considering the diverse characteristics of NHL, it is not possible to solely attribute all subtypes of the disease to infection (Aguayo et al., 2021).
           
    The CYP1A1 gene is located at chromosome 15q22-q24. The cytochrome P450 enzyme CYP1A1 is part of a large family of cytochromes (CYP) and is defined by placing it into CYP1 family, CYP1A sub-family and CYP1A1 member. CYP1A1 is the most effective primary metaboliser (hydroxylating) of pro-carcinogens in phase I biotransformation (Kim et al., 2009).
           
    CYP1A1 is also involved in the hydroxylation of a site on an aromatic ring, which is another reaction traditionally associated with this enzyme as a classic indicator of the earliest stages of cancer formation, due to the generation of many different types of chemically reactive compounds associated with cancer’s initiation (Inoue et al., 2012). Genetic variations (Also called single nucleotide polymorphisms or SNPs) within CYP1A1 affect CYP1A1’s catalytic function, thereby limiting CYP1A1’s ability to metabolise chemical carcinogens and mutagens. One of the most prevalent SNPs is CYP1A1*2A (T3801C; rs4646903) that has a T to C base substitution beyond the 3′ end of the coding region for CYP1A1. There have been some reports linking this SNP to differences in the ability of CYP1A1 to express mRNA, changes in Cyp1A1 mRNA stability, or to produce an enzyme with marked increase in inducible enzymes (Bakkalci et al., 2020).
           
    The Epstein-Barr Virus (EBV), part of the human herpesvirus group, was first identified in a sample of cultured B-cell lymphoma cells in 1964. The first proof of EBV as a carcinogen was its association with a Burkitt Lymphoma (BL) cell line, though now we also connect it to many types of malignant tumours, including B and T-cell types (Obradović, 2023). One theory explaining how EBV causes cancer suggests that EBV-infected B-lymphocytes move through the germinal centre, where they become dormant memory B-lymphocytes that allow EBV to stay latent until it reactivates to infect new B-lymphocytes (Perera et al., 2023). An association has been established between latency pattern and both Hodgkin lymphoma (HL) and T-cell non-Hodgkin lymphomas. Moreover, latency type III results in the expression of the entire EBV repertoire, including EBNAs, EBERs and LMPs. It is noted in relation to post-transplant lymphoproliferative disorders (PTLDs) and other states of diminished immune function (Patini et al., 2023). EBV-positive diffuse large B-cell lymphoma (DLBCL) demonstrates latency types II and III (Turi et al., 2023). Latency proteins of EBV are essential in interrupting important signaling pathways that facilitate the development of lymphomas. One example of an oncogene is LMP-1, which can induce constitutive signaling, activate B-cells and increase the expression of anti-apoptotic proteins (Liu et al., 2023). Effector B-cell nuclear antigens (EBNAs) can also function in the ability of Factors in transcription, facilitating the proliferation and metamorphosis of B-cells (Lehnen and Hallek, 2023).

    MATERIALS AND METHODS

    This study is structured as a case-control study. 
     
    Study groups
     
    Blood from each study group of Patients with NHL should be enrolled, that classify into:
    1. Group of blood samples from patients with NHL.
    2. Blood of apparently healthy persons as control group.
     
    Sample collection
     
    The Blood samples will be collected from patients subjected to Patients with NHL and apparently healthy persons as control group from general hospitals as well as Iraqi center for blood cancer-Iraq.
     
    Detection of SNP of CYP17A1 rs743572 by sequencing
     
    Total genomic DNA from blood of both patients and control groups extracted by using DNA extraction kit (G-SPIN- INTRON\ KOREA). After then was detection of determine  of  CYP17A1rs743572 SNP  by Sequencing. The primer used in these study was:
    CYP17A1-F: GGTGGCCGACAATCACTGTA
    CYP17A1-R: GAGGTTTGCCCTGGAGTTGA
    Product: 4756 bp

    Extraction of viral genome and EBV detection
     
    Viral genomic DNA from blood of both patients and control groups were extracted by using a viral DNA extraction kit (PATHOGENE- INTRON\ KOREA). After then was detection of HHV-6 by PCR technique.
           
    Five hundred Nano-gram of DNA from blood were used for PCR in order to detection EBV by using 5′-CCAG TGCTGTGATCGAGCATCT-3′ and EBV reverse primer, 5′-CTGCTGACAAACTGCTGCATTC-3′.
           
    The PCR conditions for EBV were as follows: 37°C for 2 mins and 94°C for 2 mins followed by 40 cycles at 93°C for 15 s and 60°C for 1 min.
     
    Statistical analysis
     
    In order to determine the significance of the variables used in this research, the Chi-square test was undertaken. All statistical tests were done using Version-25 of SPSS, with a significant p value of <0.05.

    RESULTS AND DISCUSSION

    Age distribution of study groups
     
    The age ranged of patients with NHL from 20 from 69 years with mean = 48.7+10.8 years); while the apparently healthy control group have a mean of 46.9+11.2 years. However, no significant variations were detected when comparison between studied groups (P>0.05) (Table 1).

    Table 1: Distribution of studied patients with NHL according to the mean and range of their age.


     
    Sex distribution of the patients with NHL and AHC
     
    Males with NHL was higher (61.3%: 62) than their female counter parts (38.7%: 38.7). In the control group, males constituted a higher percentage (62%: 31) compared to females (38%: 19). The statistical analysis revealed a significant difference between sex groups (P<0.01) within the examined cohorts (Table 2).

    Table 2: Distribution of the studied patients with NHL according to their sex.


     
    Genotyping of CYP17A1 rs743572 polymorphism 
     
    The distribution of polymorphism in DNA was shown to have a statistically significant difference between patients and controls. Table (3) shows this to make the difference even more clear. The results for GA GG and AA were: 38.7% 34.7% and 26.6% in the overall population and 28% 46% and 26% in the NHL population.

    Table 3: Genotyping of CYP17A1 gene (rs743572) in patients with NHL and AHC groups.


     
    Detection of EBV genome by conventional PCR
     
    The percentage of EBV in patients with NHL was 21.3% (16 out of 75 cases). While, 4% positive EBV genome in AHC specimens (Table 4). The statistical analysis of the differences between these two groups were significant (p = 0.03).

    Table 4: Results of EBV- DNA in NHL specimens among study groups.


     
    Spearman’s Rho statistical investigation of age, gender, EBV-DNA PCR and CYP17A1 rs743572 SNPs to determine if the markers assessed correlated in the individuals assessed in this report (NHL)
     
    Researchers found that there was a statistically significant association between the SNP CYP17A1 rs743572 and the presence of EBV-DNA in NHL patients; r=0.365; p=0.019.
           
    Also, there was a non-significant correlation between the SNP of CYP17A1 rs743572 and the age of NHL patients; p=0.244; r=0.040.
           
    However, there were no significant correlations among sex and SNP of CYP17A1rs743572 in the current study (r=0.775; p=0.8). Furthermore, non-significant correlations among EBV and age  in the current study (r=0.684; p=0.6). Lastly, significant correlations between EBV-DNA and sex  of patients with NHL of current study (r=0.244; p=0.04 as illustrated in Table (5).

    Table 5: Spearman’s Rho statistical testing of age, sex, EBV-DNA-PCR and CYP17A1rs743572 SNP to evaluate the studied markers in patients with NHL.


           
    We underwent an extensive study where we analyzed the possible impact of gene polymorphisms described by the following genes: NQO1, CYP1A1, GSTT1, GSTM1, GSTP1. The purpose of our study was:
    1. To determine if specific genetic variations are associated with non-hodgkin lymphoma (NHL).
    2. to determine if smoking has an impact on the association between the genetic polymorphisms and susceptibility to NHL.
           
    The prevailing consensus is that external carcinogens undergo metabolism in human beings, resulting in the production of active metabolites that bind to and disturb nuclear and mitochondrial DNA (Zakiullah et al., 2020; Devkatte et al., 2022).
           
    The oxidative metabolism of xenobiotics, which are substances found outside the usual biochemical composition of an organism such as medications and poisons, can be achieved by the phase I cytochrome P450 enzyme superfamily, including CYP1A1, CYP2D6, CYP2C9 and CYP2C19. Xenobiotics are oxidized by liver enzymes using singlet oxygen, resulting in the formation of very active intermediate metabolites (Vander, 2020; Patil and More, 2025).
           
    Multiple studies have demonstrated that the CYP1A1 MspI T6235C polymorphism is linked to a higher susceptibility to lung cancer in Asian populations, particularly in connection to tobacco use (de Castro, 2019; Borah et al., 2025).
           
    Current study results indicate that the DNA polymorphism distribution across GA genotypes; GG; AA based on the sample’s results were 38.7%; 34.7% and 26.6% In non-hodgkin’s lymphoma patients and 28%; 46%; and 26% in alcoholic hepatitis patients are consistent with the results reported by statistically significant differences were also demonstrated for both AA and AG genotypes, as well as the G allele, in the CYP1A1 polymorphism (Rivera, 2020; Chabukdhara et al., 2023).
           
    The genetic variations we analyzed in our study corroborate the findings of Liu et al. (2018) that both CYP1A1 genotype (A/G) 4889 and CYP1A1 genotype A/G+G/G are associated with a higher risk for Non-Hodgkin Lymphoma (NHL). Studies have shown that the A4889G polymorphisms within CYP1A1 are linked to increased susceptibility to lymphoma even in non-smokers.
           
    An association was not apparent between CYP1A1 6235 and CYP1A1 4889 from an investigation consisting of 182 Saudi Arabian subjects compared to a control group of 511 individuals (Quadri et al., 2005). The study also showed that CYP1A1 4889 was not detected in cases (n=1172) or compared to healthy controls (n=982) from California or eighteen cases from Australia, respectively and there were 451 cases with the disease and 526 cases without in connecticut. Three genetic variants were identified at the CYP1A1 gene using PCR-RFLP, namely T6235C (m1), A4889G (m2) and C4887A (m4). The identified mutations were used to designate three distinct alleles, namely CYP1A1*2A (only m1), CYP1A1*2B (m1) and CYP1A1*4 (only m4)()(Many ethnic studies have reported that there is a correlation between variations in different allelic forms of CYP1A1 with lympho-proliferative diseases). The CYP1A1 gene encodes an enzyme that converts hydrocarbons to 3-hydroxy derivative through hydroxylation at the first phase of the metabolism of a variety of exogenous substances xenobiotics such as polycyclic aromatic hydrocarbons (e.g. benzopyrene (Daaboul et al., 2020; Lingaiah et al., 2024). Intermediates from 3899 (from fairley’s study) activity will covalently modify proteins through the production of hydroxyl as an intermediate) through modifications of proteins during catalysis create covalent bonds and thus increased the cytotoxicity, mutagenicity, or carcinogenicity of synthetic molecules (Daaboul et al., 2020; Lingaiah et al., 2024). An underlying genetic variation in the CYP1A1 gene results in increased enzymatic activity. Therefore increasing the concentrations of detrimental metabolites, Specifically, the CYP1A1*2A mutation has been demonstrated to elevate susceptibility to leukemia, especially in adolescents exposed to both pesticides and tobacco smoke (Arendt, 2018; Bhosale et al., 2024). (Hoseini, 2017; Gaina et al., 2023). Higher frequencies of both homozygous and heterozygous CYP1A1 gene variations (e.g. 4887C>A, 4889A>G and 6235T>C) were found in individuals with B-cell chronic lymphocytic leukaemia (B-CLL) than in controls.
           
    Despite the increasing recognition of the involvement of EBV in the development of non-hodgkin’s lymphoma, the therapy of this disease remains inadequate Progress in the development of antiviral medications and treatments using targeted monoclonal antibodies shows promising outcomes (Ahmadullah, 2015; Ali et al., 2021; Pesavento et al., 2019).
           
    Even if numerous studies have investigated the entire spectrum of HL and NHL as far as the effect of EBV, there has only been limited research into the association between these lymphoid malignancies and EBV. There appears to be an increasing body of evidence supporting a causal role for EBV in certain types of lymphoma such as diffuse large B-cell lymphoma (DLBCL) or angioimmunoblastic T-cell lymphoma (AITL). The degree of EBV involvement in small B-cell lymphomas was considered to be low; however, there have also been limited systematic investigations into this phenomenon (Sini, 2017; Wang et al., 2015).
           
    The percentage of EBV  in patients with NHL of current results  was 21.3% (16 out of 75 cases) have. While, 4% positive EBV genome in AHC specimens. our findings in line with other studies report  (Hossain, 2017).  The findings of  Go et al., (2015) indicate that 35% (95% CI 31-8-39-4) of lymphoma cases in Europe are associated with EBV, whereas comparable rates in North America accounts for 32%, while Australia constitutes 29% support the idea that one third of lymphoma cases are tied to EBV. Even while the numberal of instances with a certain cHL subtype is few, Our data collection clearly indicates, consistent with existing research, Mixed-cellularity and lymphocyte-depleted patients exhibit a greater frequency of EBV-positive tumours, whereas nodular sclerosis cases have a lower prevalence (Wang et al., 2015). Notably, Among cases of congenital haemorrhagia in Asia, Latin America and Africa, the prevalence of EBV positive is higher, with rates ranging from 50% to 74%.
           
    In their 2020 study, reported a prevalence of 10.4% (7 out of 67 patients) with LMP 1 positive NHLs, which is similar to the findings of Meng et al., (2015); Yu et al., (2015). However, Amal Ismail and colleagues reported that 17% of NHL cases tested positive for LMP-1. This could be attributed to the fact that their sample largely consisted of Burkitt lymphoma. Notably, our analysis did not include any cases of burkitt lymphoma.
           
    In 2010, Yang and coworkers gathered samples from 60 nasal and nasopharyngeal non-Hodgkin lymphoma (NHL) cases. Of these 60 patients, 35 tested positive for EBER, yielding an overall frequency of EBER positivity (35/60), which was 58.3%. Of the 60 cases, 29 were classified as NK/T-cell lymphomas; of these, 19 were tested to be positive for EBER and had an overall EBER positivity frequency of 65.5% (19 of 29). In comparison, 31 were classified as B-cell lymphomas. Of the 31 cases, 16 were EBER positive, yielding an overall EBER positivity frequency of 51.6% (16 of 31). There was no statistically significant difference between the frequencies of EBER positivity in NK/T-cell lymphomas and B-cell lymphomas from nasal cavity and nasopharynx (P>0.05).

    CONCLUSION

    A variation in the CYP1A1 gene may contribute to the development of NHL, particularly when factored in by local confounding elements such as EBV infection.

    ACKNOWLEDGEMENT

    The authors thank National Center of Hematology, Mustansiriyah University, Baghdad, Iraq for their support in collecting samples.
     
    Funding
     
    No university, institute, or foundation provided funding for the research paper , All support was provided by the authors.

    CONFLICT OF INTEREST

    The authors declare that there is no conflict of interest between the authors.

    REFERENCES


    1. Aguayo, F., Boccardo, E., Corvalán, A., Calaf, G.M., and Blanco, R. (2021). Interplay between Epstein-Barr virus infection and environmental xenobiotic exposure in cancer. Infectious Agents and Cancer. 16(1): 50. 

    2. Ahmadullah, A. (2015). Genetic susceptibility to oral cancer due to combined effects of GSTT1, GSTM1 and CYP1A1 gene variants in tobacco addicted patients of pashtun ethnicity of Khyber Pakhtunkhwa province of Pakistan. Asian Pacific Journal of Cancer Prevention. 16(3): 1145-50. 

    3. Ali, M., Khan, M., Aslam, A., Rehman, H., Anjum, A., Waheed, S. and Masood, A. (2021). Molecular characterization and pathology of virulent newcastle disease virus isolated from broiler chickens in District Lahore, Pakistan. Indian J. Animal Res. 59(6): 1004-1011. doi: 10.18805/IJAR.BF-1420.

    4. Arendt, M. (2018). Genetische Effekte Auf Die Erhöhung von Freien Leichtketten im Serum. Universitaet Duisburg-Essen (Germany). 

    5. Bakkalci, D., Jia, Y., Winter, J.R., Lewis, J.E., Taylor, G.S. and Stagg, H.R. (2020). Risk factors for Epstein Barr virus-associated cancers: A systematic review, critical appraisal and mapping of the epidemiological evidence. Journal of Global Health. 10(1): 010405. 

    6. Bhosale, A.V., Tumlam, U.M., Pawade, M.M., Kamdi, B.P., Mhase, P.P., Barate, A. K. and Muglikar, D.M. (2024). Detection of canine viral and bacterial agents associated with gastroenteritis by PCR and RT-PCR. Indian Journal of Animal Research. 58(4): 666-670. doi: 10.18805/IJAR.B-4932. 

    7. Borah, B., Sharma, K., Borah, P., Deka, D., Deka, P., Hazarika, A.K. and Singh, A.P. (2025). Development of Indirect and sandwich ELISA for sero-surveillance and detection of swinepox virus. Indian Journal of Animal Research. 59(2): 299-304. doi: 10.18805/IJAR.B-4727.

    8. Chabukdhara, P., Dhruba, J.K., Tamuly, S., Naba, J.D., Bordoloi, G., Khargharia, S. and Gogoi, A. (2023). Alteration of liver and kidney specific biomarkers in indigenous ducks infected with duck plague virus. Indian Journal of Animal Research. 57(7): 956-959. doi: 10.18805/IJAR.B-5103. 

    9. Daaboul, H.E. (2020). The in vitro and in vivo anticancer effect of β-2-Himachalen-6-ol Isolated from the Lebanese Daucus carota spp. Carota (Doctoral Dissertation, University of Surrey).

    10. de Castro Gouveia, M.J. (2019). Novel Therapeutics Approaches Against Schistosoma Haematobium and Opisthorchis Viverrini and Associated Cancer (Bladder Cancer and Cholangiocarcinoma) (Doctoral dissertation, Universidade do Porto (Portugal). 

    11. De Roos, A.J., Gold, L.S., Wang, S., Hartge, P., Cerhan, J.R, Cozen, W., et al. (2006). Metabolic gene variants and risk of non-Hodgkin’s lymphoma. Cancer Epidemiology  Biomarkers  and Prevention. 15(9): 1647-1653. 

    12. Devkatte, A.Y., Jadhav, P.V., Kumar, R., Dongre, V.B., Sharma, P., Gaikwad, N.Z. and Khillare, B.S. (2022). Association between the Ovine MHC-DRB1 gene and its resistance to gastrointestinal parasites in deccani sheep raised in hot semi-arid ecosystem of India. Indian Journal of Animal Research. 59(4): 568-573. doi: 10.18805/IJAR.B-4781. 

    13. Gaina, C.D., Sanam, M.U., Nalley, W.M.M., Benu, I. and Amalo, F.A. (2023). The potency of the BMP 15 gene as a marker of reproductive traits in sumba ongole (Bos indicus) cattle. Agricultural Science Digest-A Research Journal. 43(3): 402-407. doi: 10.18805/ag.DF-513.

    14. Go, R.E., Hwang, K.A. and Choi, K.C. (2015). Cytochrome P450 1 family and cancers. The Journal of Steroid Biochemistry and Molecular Biology. 147: 24-30. 

    15. Hoseini, S.M.M. (2017). Glutathione S-transferase M1-T1 null genotypes and susceptibility to hodgkin’s lymphoma. Genetika. 9(3): 911-920. doi: 10.2298/GENSR1703911M.

    16. Hossain, T. (2017). Identification of Socio-Demographic and Behavioral Risk Factors of Oral Cancer in Rural and Urban Areas of Bangladesh (Doctoral dissertation, East West University).

    17. Inoue, H., Mishima, K., Yamamoto-Yoshida, S., Ushikoshi-Nakayama, R., Nakagawa, Y., Yamamoto, K. and Saito, I. (2012). Aryl hydrocarbon receptor-mediated induction of EBV reactivation as a risk factor for sjögren’s syndrome. The Journal of Immunology. 188(9): 4654-4662.

    18. Kim, H.N., Kim, N.Y., Yu, L., Kim, Y.K., Lee, I.K., Yang, D.H. and Kim, H.J. (2009). Polymorphisms of drug metabolizing genes and risk of non hodgkinlymphoma. American Journal of Hematology. 84(12): 821-825. 

    19. Lehnen, N. and Hallek, M. (2023). Geschlechtsspezifische unterschiede spezieller tumorerkrankungen. Die Innere Medizin. 64(8): 717-726.

    20. Lingaiah, N., Raju, S., Sarla, N., Radhika, K., Venkanna, V. and Reddy, D. (2024). Understanding of gene action for nutritional traits in elite rice (Oryza sativa L.) crosses. Agricultural Science Digest. 44(1): 94-99. doi: 10.18805/ag.D-5330. 

    21. Liu, J., Hu, Z., Feng, Y., Zeng, S. and Zhong, M. (2018). Problems to affect long-term survival for breast cancer patients: An observational study of subsequent lung/bronchus malignancies. Medicine. 97(39): e12603. 

    22. Liu, J., Huang, B., Ding, F. and Li, Y. (2023). Environment factors, DNA methylation and cancer. Environmental Geochemistry and Health. 45(11): 7543-7568. 

    23. Meng, F.D., Ma, P., Sui, C.G., Tian, X. and Jiang, Y.H. (2015). Retracted Article: Association between cytochrome P450 1A1 (CYP1A1) gene polymorphisms and the risk of renal cell carcinoma: A meta-analysis. Scientific Reports. 5(1): 8108. 

    24. Obradović, B. (2023). Analysis of Expression of Genes Encoding Enzymes CYP3A4, CYP2B6 and ABCB1 Transporter in Patients with HIV and HCV Infections Treated with Antiviral Medications (Doctoral dissertation, University of Belgrade (Serbia). 

    25. Patil, R.G. and More, A. (2025). A Comparative study and optimization of deep learning models for grape leaf disease identification. Indian Journal of Agricultural Research. 59(4): 654-663. doi: 10.18805/IJARe.A-6242.

    26. Patini, R., Cordaro, M., Marchesini, D., Scilla, F., Gioco, G., Rupe, C. and Lajolo, C. (2023). Is systemic immunosuppression a risk factor for oral cancer? A systematic review and meta-analysis. Cancers. 15(12): 3077. 

    27. Perera, M., Perera, I. and Tilakaratne, W. M. (2023). Oral microbiome and oral cancer. Immunology for Dentistry. pp. 79-99.

    28. Pesavento, P.A., Agnew, D., Keel, M.K. and Woolard, K.D. (2019). Author correction: Cancer in wildlife: Patterns of emergence. Nature reviews. Cancer. 19(5): 299.

    29. Quadri, S.A., Shukla, S.N., Singh, A.P. and Sarkhel, B.C. (2005). Effect of leptin and IGF-I supplementation on in vitro maturation and expression of apoptotic genes in goat oocytes. Indian Journal of Animal Research. 59(7): 1115-1119. doi: 10.18805/IJAR.B-4829.

    30. Rivera, M.P. (2020). Lung Cancer, Part I, An Issue of Clinics in Chest Medicine. Elsevier Health Sciences. 41(1).

    31. Sini, B.C. (2017). Relação entre os polimorfismos da paraoxonase 1 e do citocromo P450 em pacientes com imunodeficiência comum variável em uso de medicamentos ou exposição a poluentes ambientais (Doctoral dissertation, Universidade de São Paulo).

    32. Turi, M., Anilkumar Sithara, A., Hofmanová, L., Žihala, D., Radhakrishnan, D., Vdovin, A. and Hrdinka, M. (2023). Transcriptome analysis of diffuse large b-cell lymphoma cells inducibly expressing MyD88 L265P mutation identifies upregulated CD44, LGALS3, NFKBIZ and BATF as downstream targets of oncogenic NF-κB signaling. International Journal of Molecular Sciences. 24(6): 5623. 

    33. Vander, P.V. (2020). Epidemiology, Risk Factors, Pathology and Natural History of Head and Neck Neoplasms. In Head and Neck Cancer Imaging. Cham: Springer International Publishing. (pp. 1-20).

    34. Wang, F., Chen, J., Wang, L., Ma, Y. and Mayinuer, N. (2015). CYP1A1 genetic polymorphisms and uterine leiomyoma risk: A meta-analysis. International Journal of Clinical and Experimental Medicine. 8(3): 3590. 

    35. Wang, X., Yue, K. and Hao, L.R. (2015). CYP1A1 MspI polymorphism and susceptibility to lung cancer in the Chinese population: An updated meta-analysis and review. International Journal of Clinical and Experimental Medicine. 8(8): 11905.

    36. Yu, B.W., Zhang, L.Q., Teng, X.L., Zhang, Y., Zou, L.B. and Ying, H.Y. (2015). Association between the CYP1A1 polymorphisms and hepatocellular carcinoma: A meta-analysis. Genet. Mol. Res. 14(1): 1076-1084. 

    37. Zakiullah, S.M., Ovais, M., Khuda, F., Javed, N., Ali, S. and Khisroon, M. (2020). Association of non-Hodgkin lymphoma risk with CYP1A1, GSTM1 and GSTT1 gene variants, in tobacco addicted patients of Pashtun ethnicity of Khyber Pakhtunkhwa, Pakistan. Pak. J. Pharm. Sci. 33: 2617- 2624.
    In this Article
      Contact us
      Follow us
      Published In
      Asian Journal of Dairy and Food Research

      Editorial Board

      View all (0)