volume 44 issue 2 (april 2025) : 234-239,   Doi: 10.18805/ajdfr.DRF-476

The Impact of Interleukin-21 and 23 Serum Level and Gene Expression in Celiac Disease among Sample of Iraqi Patients

F
Farah Tareq Yaseen1,*
R
Rakad M. Kh. Al-Jumaily2
1Continuous Education Centre, Mustansiriyah University, Baghdad Iraq.
2Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq.
Cite article:- Yaseen Tareq Farah, Al-Jumaily Kh. M. Rakad (2025). The Impact of Interleukin-21 and 23 Serum Level and Gene Expression in Celiac Disease among Sample of Iraqi Patients . Asian Journal of Dairy and Food Research. 44(2): 234-239. doi: 10.18805/ajdfr.DRF-476.

Background: Celiac disease (CD) is an autoimmune disease characterized by chronic inflammation that essentially affects the small intestine and is caused by food that contain gluten. This research aimed to explore the impact of interleukin 21 (IL-21) and interleukin 23 (IL-23) on development the Celiac disease in Iraqi patients.

Methods: Forty adults have CD were enrolled in the study with age range between 15-60 years with an average age of 36.60± 2.03 years. The diagnosis of the disease was confirmed by serological examinations and intestinal endoscopy in Gastroenterology and Liver Teaching Hospital in the Medical City Hospital in Baghdad and a forty healthy subjects were included in this study as control group with age range between 16-59 years with an average age of 32.22±1.97 years. The blood serum were examined for Anti tissue transglutaminase (tTG) IgA and IgG (IgA ant-tTG and IgG ant-tTG) and Anti-DGP IgA (IgA ant-DGP) antibodies as well as IL-21 and IL-23 by using enzyme-linked immunoassay technique ((ELISA). Also, the gene expression of IL-21 and IL-23 in peripheral blood of Iraqi CD patients was determined by using quantitative real-time PCR (qRT-PCR) assay.

Result: The results showed that serum levels of anti-tTG (IgA, IgG) and anti-gliadin (IgA) antibodies were significantly higher in CD patients than in control (25.13±1.12, 19.86±1.13, and 32.01±2.36 vs. 12.62±1.04, 6.83±0.82,  and 21.59±1.44 U/ml, respectively; p < 0.01). In addition, IL-21 and IL-23 serum level was increased in CD patients with high significant differences (490.02±20.46 and 565.22±22.84 vs 106.87±4.23 and 256.03±13.52 pg/ml; p < 0.01), respectively. The results of gene expression revealed the level of IL-21 and IL-23 was increased significantly by 3.33±0.35 and 2.83±0.27 fold change in CD patients in comparison to control.

Celiac disease (CD) is an immune-mediated disorder caused by gluten in genetically susceptible individuals (Husby et al., 2012). It is characterized by the presence of chronic inflammation of the small bowel’s mucosa and submucosa, and is clinically characterized by the presence of diverse systemic manifestations, it is also called celiac sprue, gluten-sensitive enteropathy, or non-tropical sprue (James et al., 2001). The gluten which is a protein found in wheat and other grains such as barley, and rye (Julio et al., 2016). Celiac disease show gastrointestinal symptoms like diarrhea, cramping, bloating, flatulence, nausea, and electrolyte imbalance (Murray et al., 2004). There are certain non-classical symptoms of CD, such as iron deficiency anemia (Obaid et al., 2020), increased transaminases, constipation, ataxia, lethargy, osteoporosis, and dyspepsia (Oxentenko et al., 2019). The diagnosis of CD is difficult because symptoms can include diarrhea, weight loss, constipation, recurrent abdominal pain, and extra-intestinal symptoms like osteoporosis, elevated transaminases, anemia, autoimmune disorders, recurrent miscarriages, and aphasia stomatitis. Alternatively, there may be no symptoms at all (Briani et al., 2008, Krishnaja and Ukkuru 2016). Over the last 20 years, the diagnostic accuracy of serology for CD has progressively increased with the development of highly reliable tests, such as the detection of IgA tissue transglutaminase and IgG anti-deamidated gliadin peptide antibodies (Volta et al., 2011). Interleukin-21 (IL-21), regulates both innate and adaptive immune responses and it not only has key roles in anti-tumor and antiviral responses but also exerts major effects on inflammatory responses that promote the development of autoimmune diseases and inflammatory disorders (Spolski et al., 2014). The IL-21 cytokine is produced by follicular T-helper cells that help B cells in making antibodies during T cell-dependent responses (O’Shea  et al., 2010). It has been suggested that IL-21 produced by gluten-reactive T cells enhances both IL-17 and IFN-g production in the intestinal mucosa. Interleukin-21 may have a wider role in CD pathogenesis as this cytokine also targets several other cell types such as CD8+ T cells and natural killer cells. Interleukin-21 also has a role in B-cell differentiation and plasma cell function and could possibly contribute to the production of celiac disease-associated antibodies (De Nitto et al., 2009). Notably, the IL-21 locus is a genetic risk factor for CD (DA van et al., 2007). Interleukin-23 (IL-23), which belong to the IL-12 family of cytokines, have a key role in intestinal homeostasis and inflammation and are implicated in the pathogenesis of inflammatory bowel disease. Upon their secretion by antigen-presenting cells (dendritic cells and macrophages) in response to microbial pathogens it exert both pro-inflammatory and anti-inflammatory receptor-mediated effects. Interleukin-23 is composed of two subunits, p19 and p40, which are shared with another cytokine called IL-12, these subunits combine to form the IL-23 heterodimer (Oppmann et al., 2000). Interleukin-23  binds to a receptor complex primarily found on T cells, known as the IL-23 receptor (IL-23R), which consists of two subunits, IL-23R and IL-12R β1 (Parham et al., 2002). The main function of IL-23 is to promote the differentiation and expansion of a specific subset of T cells called Th17 cells Th17 cells are known to produce various pro-inflammatory cytokines, including IL-17, which plays a critical role in inflammation and autoimmune diseases, IL-23 acts as a key regulator in the differentiation and maintenance of Th17 cells (Langrish et al., 2005). Interleukin-23 has been implicated in the pathogenesis of several autoimmune diseases, including psoriasis, rheumatoid arthritis, inflammatory bowel disease (such as Crohn’s disease and ulcerative colitis) and multiple sclerosis (Duerr et al., 2006, Nandhini​ et al., 2006). The aim of this study to elucidate the role of the IL-21 and IL-23 in celiac disease patients.
Patients and control
 
Serum samples were obtained from 40 Iraqis patients with celiac disease (CD), and 40 healthy individuals as a control group , age range (15-60) year which enrolled in this study. The present study was carried out at  Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq ,This study began in July 2021 and the practical part was completed in April 2022. The theoretical part and writing of the research began and the research was finally completed in January 2024.
 
Immunological parameters
 
The blood serum were examined for Anti tissue transglutaminase (tTG) IgA and IgG (IgA ant-tTG and IgG ant-tTG) and Anti-DGP IgA (IgA ant-DGP) antibodies as well as IL-21 and IL-23 by using enzyme-linked immunoassay technique (ELISA). (Generic Assays GmbH, Germany and Fine Test, China; respectively) and instructions of the manufacturer were followed. We coated the ELISA microplate with an antibody specific to human immuno-logical parameters studied. The specific antibody was introduced into the wells of the ELISA microplate containing the samples. Human biotinylated detection antibodies for immunological parameters studied were added to each microplate well, along with an Avidin-Horseradish peroxidase (HRP)-conjugated antibody. Then we left the dishes to settle for a while. The preserved components were rinsed away. In each well, a substrate solution was introduced. It is only possible to see the blue color in wells containing human immunological parameters studied, biotinylated detection antibodies and Avidin-HRP conjugate. The addition of a stop solution terminated the reaction of the enzyme with the substrate, giving the result a yellow color. Optical density (OD) is determined using spectrophotometry at a wavelength of 450 nm. Proportional to the concentration of human immunological parameters studied, the OD value is determined.
 
Fold change gene expression of IL-21 and IL-23
 
Gene expression of Interleukin-21 and IL-23 was determined by the reverse transcription quantitative polymerase chain reaction (RT-qPCR) method. Total RNA was isolated from peripheral blood using ready-to-use reagent (FavorPrep Total RNA Mini Kit, Favorgen / Korea). The isolated RNA was reverse-transcribed and the gene expression of IL-21 and IL-23 was assessed using GoTaq®1-Step RT-qPCR System kit (Promega, USA), and instructions of the manufacturer were followed. Forward and reverse primers for IL-21 (5'- GCAAAGTCAG GATTATTTCCCCA -3', and 5' - TCCTGGCCTC TTGGT TTGTC -3', respectively). Forward and reverse primers for IL-23 (5'- CCCAAGGACTCAGGGACAAC -3' and 5'- TGGAGGCTGCGAAGGATTTT -3', respectively) and the housekeeping gene GAPDH (5'- AATGGGCA GCCGTT AGGAAA- 3' and 5'- AATGGGCAGCCGTTAGGAAA -3', respectively) were according to published sequences. The primers were designed using primer design web-based service and validated using the Primer-BLAST-NCBI database.The expression of IL-21 and IL-23 was expressed as a fold change in the level of the target gene expression, which was normalized to the expression level of the housekeeping gene GAPDH (endogenous control) and relative to the target gene in control subjects (calibrator) (Livak and Schmittgen, 2001).
 
Ethical clearance
 
The Ethical Committee (CSEC/0922/0100 on September 27, 2022) of the Department of Biology, College of Science, University of Baghdad, approved the research after receiving written informed consent from all participants.
 
Statistical analysis
 
All of the statistical analysis was carried out with the help of the SPSS version 24.0 software. The data were expressed as the mean±SE. The T Student tests were additionally utilized to compare the two numerical or categorical parameters. If the P values were less than 0.05, then the differences were determined to be statistically significant (Dipper et al., 2009).
The results showed that serum levels of anti-tTG (IgA, IgG) and anti-gliadin (IgA) antibodies were significantly higher in CD patients than in control (25.13±1.12, 19.86±1.13, and 32.01±2.36 vs. 12.62±1.04, 6.83±0.82,  and 21.59±1.44 U/ml, respectively; p < 0.01) (Table 1). These results are in agreement with previous results showing that CD is associated with an increases in Anti-Tissue and Anti-Gliadin (Catassi et al., 2010).  The results of  (Dipper et al., 2009) found that an anti -tTG is the marker of choice for CD mass screening and helpful in identifying patients who can benefit from a gluten-free diet and follow-up. Although the gold standard for detecting CD is a duodenal biopsy, it has been shown that anti-tTG antibody together with an anti-gliadin antibody is a sensitive marker for CD (Hopper et al., 2008). The findings of this study and other studies indicate the diagnostic potential of both antibodies in CD when conducting screening surveys for the disease in children and adolescents (Aldaghi et al., 2016). According to (Al-Assaf  et al., 2021) Serum levels of anti-tTG and anti-gliadin IgA antibodies were significantly higher in CD children than in control children. Study of (Aldaghi et al., 2016) approved a statistically significant correlation between IgA anti-tTG level and histopathological finding which that showed a statistically significant relation was observed between the serological titer and positive pathologic results in patients with suspected CD.

Table 1: Serum levels of anti-tTG (IgA and IgG) and anti-gliadin (IgA) antibodies in CD patients and control group.



The IL-21 and IL-23 serum level was increased in CD patients with high significant differences (490.02±20.46 and 565.22±22.84 vs 106.87±4.23 and 256.03±13.52 pg/ml; p < 0.01), respectively (Table 2). In addition, the results of gene expression revealed the level of IL-21 and IL-23 was increased significantly by 3.33±0.35 and 2.83±0.27 fold change in CD patients in comparison to control (Table 3).

Table 2: Serum levels of IL-21 and IL-23 in CD patients and control group.



Table 3: Fold change gene expression of IL-21 and IL-23 in CD patients and control groups.



Like many autoimmune diseases, cytokines and signaling proteins play roles in CD pathogenesis (Agha- mohamadi  et al., 2020). The immune response in celiac disease involves the adaptive, as well as the innate, and is characterized by the presence of anti-gluten and antitrans- glutaminase 2 antibodies, lymphocytic infiltration in the epithelial membrane and the lamina propria, and expression of multiple cytokines and other signaling proteins (Briani et al., 2008). Production of the cytokine interferon-γ (IFN-γ) by gluten-specific CD4+ T cells is thought to play a role in intestinal epithelial damage (Nilsen et al., 2008, Hameed et al., 2023). However, other CD4+ T cell–derived cytokines, in particular interleukin-21 (IL-21), have recently been suggested to contribute to the pathogenesis of CD (Fina et al., 2008, Ezz et al., 2023). It was found that IL-21 produced by gluten-reactive T cells enhances both IL-17 and IFN-g production in the intestinal mucosa. The IL-21 may have a wider role in celiac disease pathogenesis as this cytokine also targets several other cell types such as CD8+ T cells and natural killer cells. The IL-21 also has a role in B-cell differentiation and plasma cell function and could possibly contribute to the production of celiac disease-associated antibodies (De Nitto  et al., 2009, Hasan et al., 2024). Notably, the IL-2/IL-21 locus is a genetic risk factor for celiac disease (DA van Heel  et al., 2007; Hasan et al., 2024).

The results of Table 4 and 5 showed the correlation coefficient-r between IL-21 and IL-23 concentrations as well as between fold changes levels of IL-21 and IL-23 and other studied parameters.

Table 4: Correlation coefficient between IL-21 and IL-23 at serum levels and parameters studied of CD patients.



​

Table 5: Correlation coefficient between fold change gene expression of IL-21 and IL-23 and parameters studied of CD patients.



Pathogenesis of CD and is critical for Th17-mediated immune response activation (Hisamatsu et al., 2016, Al-Khuzaay et al., 2024). The heterodimeric cytokine interleukin-23 (IL-23 or IL23A/IL12B) is a member of the IL-12 family produced by dendritic cells and macrophages, which has a role in the pathogenesis of several tissue-specific autoimmune diseases. According to the result of studies greater peripheral blood mononuclear cell (PBMC) production of IL-23 caused by gliadin can contribute to the IL-23 has been implicated in the pathogenesis of several tissue-specific autoimmune diseases. Currently, celiac disease (CD) is the only autoimmune disease in which both the major genetic [95% HLA-DQ2 (+)] and etiologic factors (dietary glutens) for susceptibility are known. We demonstrate that wheat gliadin induces significantly greater production of IL-23, IL-1beta and TNF-alpha in PBMC from CD patients compared with HLA-DQ2 (+) healthy controls, strongly advocating a role for IL-23 in the pathogenesis of CD (Harris et al., 2008; Sarah et al., 2021; Hasan et al., 2024). 

According to (Dickey et al., 2008., Al-Jumaily  et al., 2023). the expression of IL-15, IL-17A, IL-23A, GzmB, TBX21, and TNFAIP3 genes in peripheral blood mononuclear cells of patients with celiac disease showed a significant increase compared with the control group. Among them, TNFAIP3, IL23A and GzmB have better resolution and diagnostic value in differentiating patients with celiac disease from healthy controls. According to (Ren et al., 2021). IL-21 has a role in the autoimmune illnesses lupus and psoriasis. Furthermore, there is a correlation between mucosal damage, anti-TG2 IgA autoantibodies, and higher blood IL-21 levels in celiac patients (Iervasi et al., 2020., Mais et al., 2022). The ROC curve was able to differentiate between CD patients and healthy controls based on the levels of “IL-15, IL-17A, IL-23A, GzmB and TNFAIP3 mRNA in peripheral blood (Khalkhal et al., 2022, Yadav et al., 2022).
Based on the findings of this research, it can be inferred that the variations in concentrations of IL-21 and IL-23 at serum levels have the potential to serve as a risk factor for the development of CD. Furthermore, these findings also imply that IL-21 and IL-23 genes have a role in the advancement of CD. Also, the results of current study indicate the concentrations of IL-21 and IL-23 in patients may be helpful predictors in the early detection of CD as well as serve as a prognostic indicator for the development of CD. A deeper understanding of these interactions, on the other hand, will be necessary to make the most effective use of a new medicines in the treatment of CD.
The authors would like to thank Mustansiriyah University (www.uomustansiriyah.edu.iq ) Baghdad-Iraq for its support in the present work.
The authors declare that they have no possible conflicts of interest.

  1. Aghamohamadi, E., Kokhaei, P., Rostami-Nejad, M., Pak, F., Rostami, K., Moradi, A., Pourhoseingholi , MA., Chaleshi , V., Andrea Masotti , A. and  Zali, MR. (2020). Serum level and gene expression of interleukin-15 do not correlate with villous atrophy in celiac disease patients. Genet Test Mol Bio- markers.  24(8): 502-507. 

  2. Al-Assaf, AI., Ali, HM., Ad’hiah, AH. (2021). Gene Expression of NLRP3 Infammasome in Celiac Disease of Iraqi Children. Ibn AL- Haitham Journal For Pure and Applied Science. 1522.https: //doi.org/10.30526/2021.IHICPAS.2645.

  3. Aldaghi, MA., Dehghani, SM. and Haghighat, M. (2016). Evaluation of the Correlation Between tTG-IgA Titer and Duodenal Biopsy Findings in Children With Suspected Celiac Disease. Iran J. Pediatr. 26(1): e3615. 

  4. Al-Jumaily, RM., AL-Sheakli, II., Muhammed, HJ. and Al-Rubaii, BA. (2023). Gene expression of Interleukin-10 and Foxp3 as critical biomarkers in rheumatoid arthritis patients. Biomedicine. 43(4): 1183-1187.

  5. Al-Khuzaay, H. M., Al-Juraisy, Y. H., Hasan, A. F. and Tousson, E. (2024). Antitumor Activity of â-Glucan Isolated àrom Date Fruits ùn Cancer Cells in vivo. Opera Medica et Physio- logica. 11(3): 41-48.

  6. Briani, C., Samaroo, D. and Alaedini, A.(2008). Celiac disease: From gluten to autoimmunity. Autoimmunity Reviews. 7(8): 644-650.

  7. Catassi, C. and Fasano, A. (2010). Celiac Disease Diagnosis: Simple Rules Are Better Than Complicated Algorithms. Am. J. Med. 123(8): 691-693.

  8. DA van Heel. (2007). A genome-wide association study for celiac disease identifies risk variants in the region harboring IL2 and IL21. Nat. Genet. 39(7): 827-829.

  9. De Nitto, D., Monteleone, I., Franze, E., Pallone, F. and Monteleone, G. (2009). Involvement of interleukin-15 and interleukin- 21, two gamma-chain-related cytokines, in celiac disease.  World J. Gastroenterol. 15: 4609-4614.

  10. Dickey, W., Ward, M., Whittle, CR., Kelly, MT., Pentieva, K., Horigan, G., Patton, S., and McNulty, H. (2008). Homocysteine and related B-vitamin status in coeliac disease: Effects of gluten exclusion and histological recovery. Scand J. Gastroenterol. 43(6): 682-688. 

  11. Dipper, C., Maitra, S., Andrew, C. and Thomas, L.R. (2009). Anti- tissue transglutaminase antibodies in the follow-up of adult coeliac disease. Aliment. Pharmacol. Therap.  30: 236-244. 

  12. Duerr, R.H., Taylor, K.D., Brant, S.R., Rioux, J.D., Silverberg, M.S., Daly, M.J., et al. (2006). A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science. 314(5804): 1461-1463. 

  13. Ezz, A.M., Zaki, S. and Tabl, G.A. (2023). Anti-diabetic effects of pomegranate peel extract and L-carnitine on strepto- zotocin induced diabetes in rats. Biomedical and Phar- macology Journal. 16(3): 1827-1835.

  14. Fina, D., Sarra, M., Caruso, R., Del Vecchio Blanco, G., Pallone, F., MacDonald, TT. and Monteleone, G. (2008). Interleukin 21 contributes to the mucosal T helper cell type 1 response in coeliac disease. Gut. 57(7): 887-892. 

  15. Hameed, H.M., Hasan, A.F., Razooki, Z.H., Tousson, E. and Fatoh, S.A. (2023). Orlistat Induce Renal Toxicity, DNA Damage, and Apoptosis in Normal and Obese Female Rats. OnLine Journal of Biological Sciences. 23(1): 25-32. https:// doi.org/10.3844/ojbsci.2023.25.32.

  16. Harris, KM., Fasano, A., and Mann, DL. (2008). Cutting edge: IL-1 controls the IL-23 response induced by gliadin, the etiologic agent in celiac disease. J Immunol. 181(7): 4457-4460. 

  17. Hasan, A.F., Alankooshi, A.A., Modher, M.N., El-Naggar, S.A., El-Wahsh, H.M., El-Bagoury, A.E. and Kabil, D.I. (2024). Artemisia annua extract ameliorates hepato-renal dysfunctions in obese rats. Opera Medica et Physiologica. 11(2): 47-65.

  18. Hasan, A.F., Jasim, N.A., Abid, A.T. and Tousson, E. (2024). Role of Salvia hispanica seeds extract on Ehrlich ascites model induced liver damage in female mice. Journal of Bioscience and Applied Research. 10(2): 161-169.

  19. Hasan, A.F., Hameed, H.M., Hadid, M.A., and Tousson, E. (2024). Impact of chia (Salvia hispanica) seeds extract on ehrlich ascites model induced kidney toxicity in female mice. Asian Journal of Dairy and Food Research. 43(4): 750-756. doi: 10.18805/ajdfr.DRF-397.

  20. Hisamatsu, T., Erben, U. and Kühl, AA. (2016). The role of T-cell subsets in chronic inflammation in celiac disease and inflammatory bowel disease patients: more common mecha- nisms or more differences? Inflamm Intest Dis.1(2): 52-62. 

  21. Hopper, AD., Hadjivassiliou, M., Hurlstone, DP., Lobo, AG., McAlindon, ME., Egner, W., Wild, G. and Sanders, DS. (2008). What is the role of serologic testing in celiac disease? A pros- pective, biopsy-confirmed study with economic analysis. Clin. Gastroenterol. Hepatol. 6: 314. 

  22. Husby, S., Koletzko, S., Korponay-Szabó, I.R., Mearin, M.L., Phillips, A., Shamir, R., Troncone, R., et al. (2012). European society for pediatric gastroenterology, hepatology, and nutrition guidelines for the diagnosis of coeliac disease. J Pediatr Gastroenterol Nutr. 54(1): 136-60. 

  23. Iervasi, E., Auricchio, R., Strangio, A., Greco, L. and Saverino, D. (2020). Serum IL-21 levels from celiac disease patients correlates with anti-tTG IgA autoantibodies and mucosal damage. Autoimmunity. 53: 225-230. 

  24. James, MW. and Scott, BB. (2001). Coeliac disease: the cause of the various associated disorders? Eur. J. Gastroenterol Hepatol. 13: 1119-1121.

  25. Julio, C., Carolina, C. and Gino, Roberto, C. (2016). Celiac disease World Gastroenterology Organization Global Guidelines (WGO). Gut J. 62(1): 43-52.

  26. Khalkhal, E., Rezaei-Tavirani, M., Asri, N., Nobakht, F., Jahani- Sherafat, S., Haidari, MH., and Rostami-Nejad, M. (2022). Introducing New Potential Biomarkers for Celiac Disease among the Genes Extracted from General Databases. Middle East J. Dig. Dis. Apr: 14(2): 192-199. 

  27. Krishnaja, U. and Ukkuru, P.M. (2016). Development and quality assessment of Functional Food Supplement (FFS) for the management of lifestyle diseases. Asian Journal of Dairy and Food Research. 35(3): 227-233. doi: 10.18805/ ajdfr.v3i1.3577.

  28. Langrish, CL., Chen, Y., Blumenschein, WM., Mattson, J., Basham, B., Sedgwick, JD., McClanahan, T., Kastelein, RA. and Cua, DJ.(2005). IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J. Exp. Med. 201(2): 233-240. 

  29. Livak, KG. and Schmittgen, TD. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-Delta, Delta C (T). Methods. 25: 402-408.

  30. Mais, BM. and Jinan MA. (2022). Impact of Interleukin-21 Gene Polymorphism on IL-21 Serum Level in Iraqi Rheumatoid Arthritis Patients. Iraqi Journal of Biotechnology.  21(2): 326-330.

  31. Murray, JA., Watson, T., Clearman, B., Mitros, F. (2004). Effect of a gluten-free diet on gastrointestinal symptoms in celiac disease. Am J Clin Nutr. 79: 669-673. 

  32. Nandhini, S., Gowri, A.M., Baranidharan, G.R. and Meenambigai, T.V. (2019). Real-time Expression of Stemness and Self-Renewal Genes in Canine Hematopoietic Progenitor Cells. Agricul- tural Science Digest-A Research Journal. 39(3): 254-256. doi: 10.18805/ag.D-4929.

  33. Nilsen, EM., Jahnsen, FL., Lundin, KE., Johansen, FE., Fausa, O., Sollid, LM., Jahnsen, J., Scott, H. and Brandtzaeg, P. (2008). Gluten induces an intestinal cytokine response strongly dominated by interferon gamma in patients with celiac disease. Gastroenterology. 115(3): 551-563. 

  34. Obaid, RM., Yaseen, FT., Mukhlif, MY. (2020). Blood cells depletion after chemotherapy in Iraqi women with breast cancer. Indian Journal of Forensic Medicine and Toxicology. 14(4):  3379-3382.

  35. Oppmann, B., Lesley, R., Blom, B., Timans, J.C., Xu, Y., Hunte, B., Vega, F., et al. (2000). Novel p19 protein engages IL- 12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity. 13(5): 715-725. 

  36. O’Shea, JJ. and Paul, WE. (2010).  Mechanisms underlying lineage commitment and plasticity of helper CD4+ T cells .Science. 327: 1098-1102 10.1126/science.1178334.

  37. Oxentenko, AS. and Rubio-Tapia, A. (2019).  Celiac Disease. Mayo Clin.Proc.Rochester: Elsevier. 

  38. Parham, C., Chirica, M., Timans, J., Vaisberg, E., Travis, M., Cheung, J., et al., (2002). A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J Immunol. 168(11): 5699-5708. 

  39. Ren, HM., Lukacher, AE., Rahman, ZSM. and Olsen, NJ. (2021). New developments implicating IL-21 in autoimmune disease. J. Autoimmun. 122: 102689. 

  40. Sarah, SA., Ekhlass, NA., Nawal, MFA., Neihaya, HZ. and Ali, HA. (2021). Roles of IL-17A and IL-23 in the Pathogenesis of Ulcerative Colitis and Crohn’s Disease. Iraqi Journal of Biotechnology. 62(8):  2526-2535.  

  41. Spolski, R., Leonard, W. (2014).  Interleukin-21: a double-edged sword with therapeutic potential. Nat. Rev. Drug Discov. 13: 379-395. 

  42. Volta, U. and Villanacci, V. (2011). Diagnostic criteria in progress, Cellular and Molecular Immunology. 8: 96-102.

  43. Yadav, A. and Singh, U. (2022). Nutritional efficacy of maize based functional flour developed for minimizing the risk of lifestyle diseases in relation to normal wheat flour. Asian Journal of Dairy and Food Research. 41(4): 485-489. doi: 10.18805/ajdfr.DR-1826.

The Impact of Interleukin-21 and 23 Serum Level and Gene Expression in Celiac Disease among Sample of Iraqi Patients

F
Farah Tareq Yaseen1,*
R
Rakad M. Kh. Al-Jumaily2
1Continuous Education Centre, Mustansiriyah University, Baghdad Iraq.
2Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq.
Cite article:- Yaseen Tareq Farah, Al-Jumaily Kh. M. Rakad (2025). The Impact of Interleukin-21 and 23 Serum Level and Gene Expression in Celiac Disease among Sample of Iraqi Patients . Asian Journal of Dairy and Food Research. 44(2): 234-239. doi: 10.18805/ajdfr.DRF-476.

Background: Celiac disease (CD) is an autoimmune disease characterized by chronic inflammation that essentially affects the small intestine and is caused by food that contain gluten. This research aimed to explore the impact of interleukin 21 (IL-21) and interleukin 23 (IL-23) on development the Celiac disease in Iraqi patients.

Methods: Forty adults have CD were enrolled in the study with age range between 15-60 years with an average age of 36.60± 2.03 years. The diagnosis of the disease was confirmed by serological examinations and intestinal endoscopy in Gastroenterology and Liver Teaching Hospital in the Medical City Hospital in Baghdad and a forty healthy subjects were included in this study as control group with age range between 16-59 years with an average age of 32.22±1.97 years. The blood serum were examined for Anti tissue transglutaminase (tTG) IgA and IgG (IgA ant-tTG and IgG ant-tTG) and Anti-DGP IgA (IgA ant-DGP) antibodies as well as IL-21 and IL-23 by using enzyme-linked immunoassay technique ((ELISA). Also, the gene expression of IL-21 and IL-23 in peripheral blood of Iraqi CD patients was determined by using quantitative real-time PCR (qRT-PCR) assay.

Result: The results showed that serum levels of anti-tTG (IgA, IgG) and anti-gliadin (IgA) antibodies were significantly higher in CD patients than in control (25.13±1.12, 19.86±1.13, and 32.01±2.36 vs. 12.62±1.04, 6.83±0.82,  and 21.59±1.44 U/ml, respectively; p < 0.01). In addition, IL-21 and IL-23 serum level was increased in CD patients with high significant differences (490.02±20.46 and 565.22±22.84 vs 106.87±4.23 and 256.03±13.52 pg/ml; p < 0.01), respectively. The results of gene expression revealed the level of IL-21 and IL-23 was increased significantly by 3.33±0.35 and 2.83±0.27 fold change in CD patients in comparison to control.

Celiac disease (CD) is an immune-mediated disorder caused by gluten in genetically susceptible individuals (Husby et al., 2012). It is characterized by the presence of chronic inflammation of the small bowel’s mucosa and submucosa, and is clinically characterized by the presence of diverse systemic manifestations, it is also called celiac sprue, gluten-sensitive enteropathy, or non-tropical sprue (James et al., 2001). The gluten which is a protein found in wheat and other grains such as barley, and rye (Julio et al., 2016). Celiac disease show gastrointestinal symptoms like diarrhea, cramping, bloating, flatulence, nausea, and electrolyte imbalance (Murray et al., 2004). There are certain non-classical symptoms of CD, such as iron deficiency anemia (Obaid et al., 2020), increased transaminases, constipation, ataxia, lethargy, osteoporosis, and dyspepsia (Oxentenko et al., 2019). The diagnosis of CD is difficult because symptoms can include diarrhea, weight loss, constipation, recurrent abdominal pain, and extra-intestinal symptoms like osteoporosis, elevated transaminases, anemia, autoimmune disorders, recurrent miscarriages, and aphasia stomatitis. Alternatively, there may be no symptoms at all (Briani et al., 2008, Krishnaja and Ukkuru 2016). Over the last 20 years, the diagnostic accuracy of serology for CD has progressively increased with the development of highly reliable tests, such as the detection of IgA tissue transglutaminase and IgG anti-deamidated gliadin peptide antibodies (Volta et al., 2011). Interleukin-21 (IL-21), regulates both innate and adaptive immune responses and it not only has key roles in anti-tumor and antiviral responses but also exerts major effects on inflammatory responses that promote the development of autoimmune diseases and inflammatory disorders (Spolski et al., 2014). The IL-21 cytokine is produced by follicular T-helper cells that help B cells in making antibodies during T cell-dependent responses (O’Shea  et al., 2010). It has been suggested that IL-21 produced by gluten-reactive T cells enhances both IL-17 and IFN-g production in the intestinal mucosa. Interleukin-21 may have a wider role in CD pathogenesis as this cytokine also targets several other cell types such as CD8+ T cells and natural killer cells. Interleukin-21 also has a role in B-cell differentiation and plasma cell function and could possibly contribute to the production of celiac disease-associated antibodies (De Nitto et al., 2009). Notably, the IL-21 locus is a genetic risk factor for CD (DA van et al., 2007). Interleukin-23 (IL-23), which belong to the IL-12 family of cytokines, have a key role in intestinal homeostasis and inflammation and are implicated in the pathogenesis of inflammatory bowel disease. Upon their secretion by antigen-presenting cells (dendritic cells and macrophages) in response to microbial pathogens it exert both pro-inflammatory and anti-inflammatory receptor-mediated effects. Interleukin-23 is composed of two subunits, p19 and p40, which are shared with another cytokine called IL-12, these subunits combine to form the IL-23 heterodimer (Oppmann et al., 2000). Interleukin-23  binds to a receptor complex primarily found on T cells, known as the IL-23 receptor (IL-23R), which consists of two subunits, IL-23R and IL-12R β1 (Parham et al., 2002). The main function of IL-23 is to promote the differentiation and expansion of a specific subset of T cells called Th17 cells Th17 cells are known to produce various pro-inflammatory cytokines, including IL-17, which plays a critical role in inflammation and autoimmune diseases, IL-23 acts as a key regulator in the differentiation and maintenance of Th17 cells (Langrish et al., 2005). Interleukin-23 has been implicated in the pathogenesis of several autoimmune diseases, including psoriasis, rheumatoid arthritis, inflammatory bowel disease (such as Crohn’s disease and ulcerative colitis) and multiple sclerosis (Duerr et al., 2006, Nandhini​ et al., 2006). The aim of this study to elucidate the role of the IL-21 and IL-23 in celiac disease patients.
Patients and control
 
Serum samples were obtained from 40 Iraqis patients with celiac disease (CD), and 40 healthy individuals as a control group , age range (15-60) year which enrolled in this study. The present study was carried out at  Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq ,This study began in July 2021 and the practical part was completed in April 2022. The theoretical part and writing of the research began and the research was finally completed in January 2024.
 
Immunological parameters
 
The blood serum were examined for Anti tissue transglutaminase (tTG) IgA and IgG (IgA ant-tTG and IgG ant-tTG) and Anti-DGP IgA (IgA ant-DGP) antibodies as well as IL-21 and IL-23 by using enzyme-linked immunoassay technique (ELISA). (Generic Assays GmbH, Germany and Fine Test, China; respectively) and instructions of the manufacturer were followed. We coated the ELISA microplate with an antibody specific to human immuno-logical parameters studied. The specific antibody was introduced into the wells of the ELISA microplate containing the samples. Human biotinylated detection antibodies for immunological parameters studied were added to each microplate well, along with an Avidin-Horseradish peroxidase (HRP)-conjugated antibody. Then we left the dishes to settle for a while. The preserved components were rinsed away. In each well, a substrate solution was introduced. It is only possible to see the blue color in wells containing human immunological parameters studied, biotinylated detection antibodies and Avidin-HRP conjugate. The addition of a stop solution terminated the reaction of the enzyme with the substrate, giving the result a yellow color. Optical density (OD) is determined using spectrophotometry at a wavelength of 450 nm. Proportional to the concentration of human immunological parameters studied, the OD value is determined.
 
Fold change gene expression of IL-21 and IL-23
 
Gene expression of Interleukin-21 and IL-23 was determined by the reverse transcription quantitative polymerase chain reaction (RT-qPCR) method. Total RNA was isolated from peripheral blood using ready-to-use reagent (FavorPrep Total RNA Mini Kit, Favorgen / Korea). The isolated RNA was reverse-transcribed and the gene expression of IL-21 and IL-23 was assessed using GoTaq®1-Step RT-qPCR System kit (Promega, USA), and instructions of the manufacturer were followed. Forward and reverse primers for IL-21 (5'- GCAAAGTCAG GATTATTTCCCCA -3', and 5' - TCCTGGCCTC TTGGT TTGTC -3', respectively). Forward and reverse primers for IL-23 (5'- CCCAAGGACTCAGGGACAAC -3' and 5'- TGGAGGCTGCGAAGGATTTT -3', respectively) and the housekeeping gene GAPDH (5'- AATGGGCA GCCGTT AGGAAA- 3' and 5'- AATGGGCAGCCGTTAGGAAA -3', respectively) were according to published sequences. The primers were designed using primer design web-based service and validated using the Primer-BLAST-NCBI database.The expression of IL-21 and IL-23 was expressed as a fold change in the level of the target gene expression, which was normalized to the expression level of the housekeeping gene GAPDH (endogenous control) and relative to the target gene in control subjects (calibrator) (Livak and Schmittgen, 2001).
 
Ethical clearance
 
The Ethical Committee (CSEC/0922/0100 on September 27, 2022) of the Department of Biology, College of Science, University of Baghdad, approved the research after receiving written informed consent from all participants.
 
Statistical analysis
 
All of the statistical analysis was carried out with the help of the SPSS version 24.0 software. The data were expressed as the mean±SE. The T Student tests were additionally utilized to compare the two numerical or categorical parameters. If the P values were less than 0.05, then the differences were determined to be statistically significant (Dipper et al., 2009).
The results showed that serum levels of anti-tTG (IgA, IgG) and anti-gliadin (IgA) antibodies were significantly higher in CD patients than in control (25.13±1.12, 19.86±1.13, and 32.01±2.36 vs. 12.62±1.04, 6.83±0.82,  and 21.59±1.44 U/ml, respectively; p < 0.01) (Table 1). These results are in agreement with previous results showing that CD is associated with an increases in Anti-Tissue and Anti-Gliadin (Catassi et al., 2010).  The results of  (Dipper et al., 2009) found that an anti -tTG is the marker of choice for CD mass screening and helpful in identifying patients who can benefit from a gluten-free diet and follow-up. Although the gold standard for detecting CD is a duodenal biopsy, it has been shown that anti-tTG antibody together with an anti-gliadin antibody is a sensitive marker for CD (Hopper et al., 2008). The findings of this study and other studies indicate the diagnostic potential of both antibodies in CD when conducting screening surveys for the disease in children and adolescents (Aldaghi et al., 2016). According to (Al-Assaf  et al., 2021) Serum levels of anti-tTG and anti-gliadin IgA antibodies were significantly higher in CD children than in control children. Study of (Aldaghi et al., 2016) approved a statistically significant correlation between IgA anti-tTG level and histopathological finding which that showed a statistically significant relation was observed between the serological titer and positive pathologic results in patients with suspected CD.

Table 1: Serum levels of anti-tTG (IgA and IgG) and anti-gliadin (IgA) antibodies in CD patients and control group.



The IL-21 and IL-23 serum level was increased in CD patients with high significant differences (490.02±20.46 and 565.22±22.84 vs 106.87±4.23 and 256.03±13.52 pg/ml; p < 0.01), respectively (Table 2). In addition, the results of gene expression revealed the level of IL-21 and IL-23 was increased significantly by 3.33±0.35 and 2.83±0.27 fold change in CD patients in comparison to control (Table 3).

Table 2: Serum levels of IL-21 and IL-23 in CD patients and control group.



Table 3: Fold change gene expression of IL-21 and IL-23 in CD patients and control groups.



Like many autoimmune diseases, cytokines and signaling proteins play roles in CD pathogenesis (Agha- mohamadi  et al., 2020). The immune response in celiac disease involves the adaptive, as well as the innate, and is characterized by the presence of anti-gluten and antitrans- glutaminase 2 antibodies, lymphocytic infiltration in the epithelial membrane and the lamina propria, and expression of multiple cytokines and other signaling proteins (Briani et al., 2008). Production of the cytokine interferon-γ (IFN-γ) by gluten-specific CD4+ T cells is thought to play a role in intestinal epithelial damage (Nilsen et al., 2008, Hameed et al., 2023). However, other CD4+ T cell–derived cytokines, in particular interleukin-21 (IL-21), have recently been suggested to contribute to the pathogenesis of CD (Fina et al., 2008, Ezz et al., 2023). It was found that IL-21 produced by gluten-reactive T cells enhances both IL-17 and IFN-g production in the intestinal mucosa. The IL-21 may have a wider role in celiac disease pathogenesis as this cytokine also targets several other cell types such as CD8+ T cells and natural killer cells. The IL-21 also has a role in B-cell differentiation and plasma cell function and could possibly contribute to the production of celiac disease-associated antibodies (De Nitto  et al., 2009, Hasan et al., 2024). Notably, the IL-2/IL-21 locus is a genetic risk factor for celiac disease (DA van Heel  et al., 2007; Hasan et al., 2024).

The results of Table 4 and 5 showed the correlation coefficient-r between IL-21 and IL-23 concentrations as well as between fold changes levels of IL-21 and IL-23 and other studied parameters.

Table 4: Correlation coefficient between IL-21 and IL-23 at serum levels and parameters studied of CD patients.



​

Table 5: Correlation coefficient between fold change gene expression of IL-21 and IL-23 and parameters studied of CD patients.



Pathogenesis of CD and is critical for Th17-mediated immune response activation (Hisamatsu et al., 2016, Al-Khuzaay et al., 2024). The heterodimeric cytokine interleukin-23 (IL-23 or IL23A/IL12B) is a member of the IL-12 family produced by dendritic cells and macrophages, which has a role in the pathogenesis of several tissue-specific autoimmune diseases. According to the result of studies greater peripheral blood mononuclear cell (PBMC) production of IL-23 caused by gliadin can contribute to the IL-23 has been implicated in the pathogenesis of several tissue-specific autoimmune diseases. Currently, celiac disease (CD) is the only autoimmune disease in which both the major genetic [95% HLA-DQ2 (+)] and etiologic factors (dietary glutens) for susceptibility are known. We demonstrate that wheat gliadin induces significantly greater production of IL-23, IL-1beta and TNF-alpha in PBMC from CD patients compared with HLA-DQ2 (+) healthy controls, strongly advocating a role for IL-23 in the pathogenesis of CD (Harris et al., 2008; Sarah et al., 2021; Hasan et al., 2024). 

According to (Dickey et al., 2008., Al-Jumaily  et al., 2023). the expression of IL-15, IL-17A, IL-23A, GzmB, TBX21, and TNFAIP3 genes in peripheral blood mononuclear cells of patients with celiac disease showed a significant increase compared with the control group. Among them, TNFAIP3, IL23A and GzmB have better resolution and diagnostic value in differentiating patients with celiac disease from healthy controls. According to (Ren et al., 2021). IL-21 has a role in the autoimmune illnesses lupus and psoriasis. Furthermore, there is a correlation between mucosal damage, anti-TG2 IgA autoantibodies, and higher blood IL-21 levels in celiac patients (Iervasi et al., 2020., Mais et al., 2022). The ROC curve was able to differentiate between CD patients and healthy controls based on the levels of “IL-15, IL-17A, IL-23A, GzmB and TNFAIP3 mRNA in peripheral blood (Khalkhal et al., 2022, Yadav et al., 2022).
Based on the findings of this research, it can be inferred that the variations in concentrations of IL-21 and IL-23 at serum levels have the potential to serve as a risk factor for the development of CD. Furthermore, these findings also imply that IL-21 and IL-23 genes have a role in the advancement of CD. Also, the results of current study indicate the concentrations of IL-21 and IL-23 in patients may be helpful predictors in the early detection of CD as well as serve as a prognostic indicator for the development of CD. A deeper understanding of these interactions, on the other hand, will be necessary to make the most effective use of a new medicines in the treatment of CD.
The authors would like to thank Mustansiriyah University (www.uomustansiriyah.edu.iq ) Baghdad-Iraq for its support in the present work.
The authors declare that they have no possible conflicts of interest.

  1. Aghamohamadi, E., Kokhaei, P., Rostami-Nejad, M., Pak, F., Rostami, K., Moradi, A., Pourhoseingholi , MA., Chaleshi , V., Andrea Masotti , A. and  Zali, MR. (2020). Serum level and gene expression of interleukin-15 do not correlate with villous atrophy in celiac disease patients. Genet Test Mol Bio- markers.  24(8): 502-507. 

  2. Al-Assaf, AI., Ali, HM., Ad’hiah, AH. (2021). Gene Expression of NLRP3 Infammasome in Celiac Disease of Iraqi Children. Ibn AL- Haitham Journal For Pure and Applied Science. 1522.https: //doi.org/10.30526/2021.IHICPAS.2645.

  3. Aldaghi, MA., Dehghani, SM. and Haghighat, M. (2016). Evaluation of the Correlation Between tTG-IgA Titer and Duodenal Biopsy Findings in Children With Suspected Celiac Disease. Iran J. Pediatr. 26(1): e3615. 

  4. Al-Jumaily, RM., AL-Sheakli, II., Muhammed, HJ. and Al-Rubaii, BA. (2023). Gene expression of Interleukin-10 and Foxp3 as critical biomarkers in rheumatoid arthritis patients. Biomedicine. 43(4): 1183-1187.

  5. Al-Khuzaay, H. M., Al-Juraisy, Y. H., Hasan, A. F. and Tousson, E. (2024). Antitumor Activity of â-Glucan Isolated àrom Date Fruits ùn Cancer Cells in vivo. Opera Medica et Physio- logica. 11(3): 41-48.

  6. Briani, C., Samaroo, D. and Alaedini, A.(2008). Celiac disease: From gluten to autoimmunity. Autoimmunity Reviews. 7(8): 644-650.

  7. Catassi, C. and Fasano, A. (2010). Celiac Disease Diagnosis: Simple Rules Are Better Than Complicated Algorithms. Am. J. Med. 123(8): 691-693.

  8. DA van Heel. (2007). A genome-wide association study for celiac disease identifies risk variants in the region harboring IL2 and IL21. Nat. Genet. 39(7): 827-829.

  9. De Nitto, D., Monteleone, I., Franze, E., Pallone, F. and Monteleone, G. (2009). Involvement of interleukin-15 and interleukin- 21, two gamma-chain-related cytokines, in celiac disease.  World J. Gastroenterol. 15: 4609-4614.

  10. Dickey, W., Ward, M., Whittle, CR., Kelly, MT., Pentieva, K., Horigan, G., Patton, S., and McNulty, H. (2008). Homocysteine and related B-vitamin status in coeliac disease: Effects of gluten exclusion and histological recovery. Scand J. Gastroenterol. 43(6): 682-688. 

  11. Dipper, C., Maitra, S., Andrew, C. and Thomas, L.R. (2009). Anti- tissue transglutaminase antibodies in the follow-up of adult coeliac disease. Aliment. Pharmacol. Therap.  30: 236-244. 

  12. Duerr, R.H., Taylor, K.D., Brant, S.R., Rioux, J.D., Silverberg, M.S., Daly, M.J., et al. (2006). A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science. 314(5804): 1461-1463. 

  13. Ezz, A.M., Zaki, S. and Tabl, G.A. (2023). Anti-diabetic effects of pomegranate peel extract and L-carnitine on strepto- zotocin induced diabetes in rats. Biomedical and Phar- macology Journal. 16(3): 1827-1835.

  14. Fina, D., Sarra, M., Caruso, R., Del Vecchio Blanco, G., Pallone, F., MacDonald, TT. and Monteleone, G. (2008). Interleukin 21 contributes to the mucosal T helper cell type 1 response in coeliac disease. Gut. 57(7): 887-892. 

  15. Hameed, H.M., Hasan, A.F., Razooki, Z.H., Tousson, E. and Fatoh, S.A. (2023). Orlistat Induce Renal Toxicity, DNA Damage, and Apoptosis in Normal and Obese Female Rats. OnLine Journal of Biological Sciences. 23(1): 25-32. https:// doi.org/10.3844/ojbsci.2023.25.32.

  16. Harris, KM., Fasano, A., and Mann, DL. (2008). Cutting edge: IL-1 controls the IL-23 response induced by gliadin, the etiologic agent in celiac disease. J Immunol. 181(7): 4457-4460. 

  17. Hasan, A.F., Alankooshi, A.A., Modher, M.N., El-Naggar, S.A., El-Wahsh, H.M., El-Bagoury, A.E. and Kabil, D.I. (2024). Artemisia annua extract ameliorates hepato-renal dysfunctions in obese rats. Opera Medica et Physiologica. 11(2): 47-65.

  18. Hasan, A.F., Jasim, N.A., Abid, A.T. and Tousson, E. (2024). Role of Salvia hispanica seeds extract on Ehrlich ascites model induced liver damage in female mice. Journal of Bioscience and Applied Research. 10(2): 161-169.

  19. Hasan, A.F., Hameed, H.M., Hadid, M.A., and Tousson, E. (2024). Impact of chia (Salvia hispanica) seeds extract on ehrlich ascites model induced kidney toxicity in female mice. Asian Journal of Dairy and Food Research. 43(4): 750-756. doi: 10.18805/ajdfr.DRF-397.

  20. Hisamatsu, T., Erben, U. and Kühl, AA. (2016). The role of T-cell subsets in chronic inflammation in celiac disease and inflammatory bowel disease patients: more common mecha- nisms or more differences? Inflamm Intest Dis.1(2): 52-62. 

  21. Hopper, AD., Hadjivassiliou, M., Hurlstone, DP., Lobo, AG., McAlindon, ME., Egner, W., Wild, G. and Sanders, DS. (2008). What is the role of serologic testing in celiac disease? A pros- pective, biopsy-confirmed study with economic analysis. Clin. Gastroenterol. Hepatol. 6: 314. 

  22. Husby, S., Koletzko, S., Korponay-Szabó, I.R., Mearin, M.L., Phillips, A., Shamir, R., Troncone, R., et al. (2012). European society for pediatric gastroenterology, hepatology, and nutrition guidelines for the diagnosis of coeliac disease. J Pediatr Gastroenterol Nutr. 54(1): 136-60. 

  23. Iervasi, E., Auricchio, R., Strangio, A., Greco, L. and Saverino, D. (2020). Serum IL-21 levels from celiac disease patients correlates with anti-tTG IgA autoantibodies and mucosal damage. Autoimmunity. 53: 225-230. 

  24. James, MW. and Scott, BB. (2001). Coeliac disease: the cause of the various associated disorders? Eur. J. Gastroenterol Hepatol. 13: 1119-1121.

  25. Julio, C., Carolina, C. and Gino, Roberto, C. (2016). Celiac disease World Gastroenterology Organization Global Guidelines (WGO). Gut J. 62(1): 43-52.

  26. Khalkhal, E., Rezaei-Tavirani, M., Asri, N., Nobakht, F., Jahani- Sherafat, S., Haidari, MH., and Rostami-Nejad, M. (2022). Introducing New Potential Biomarkers for Celiac Disease among the Genes Extracted from General Databases. Middle East J. Dig. Dis. Apr: 14(2): 192-199. 

  27. Krishnaja, U. and Ukkuru, P.M. (2016). Development and quality assessment of Functional Food Supplement (FFS) for the management of lifestyle diseases. Asian Journal of Dairy and Food Research. 35(3): 227-233. doi: 10.18805/ ajdfr.v3i1.3577.

  28. Langrish, CL., Chen, Y., Blumenschein, WM., Mattson, J., Basham, B., Sedgwick, JD., McClanahan, T., Kastelein, RA. and Cua, DJ.(2005). IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J. Exp. Med. 201(2): 233-240. 

  29. Livak, KG. and Schmittgen, TD. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-Delta, Delta C (T). Methods. 25: 402-408.

  30. Mais, BM. and Jinan MA. (2022). Impact of Interleukin-21 Gene Polymorphism on IL-21 Serum Level in Iraqi Rheumatoid Arthritis Patients. Iraqi Journal of Biotechnology.  21(2): 326-330.

  31. Murray, JA., Watson, T., Clearman, B., Mitros, F. (2004). Effect of a gluten-free diet on gastrointestinal symptoms in celiac disease. Am J Clin Nutr. 79: 669-673. 

  32. Nandhini, S., Gowri, A.M., Baranidharan, G.R. and Meenambigai, T.V. (2019). Real-time Expression of Stemness and Self-Renewal Genes in Canine Hematopoietic Progenitor Cells. Agricul- tural Science Digest-A Research Journal. 39(3): 254-256. doi: 10.18805/ag.D-4929.

  33. Nilsen, EM., Jahnsen, FL., Lundin, KE., Johansen, FE., Fausa, O., Sollid, LM., Jahnsen, J., Scott, H. and Brandtzaeg, P. (2008). Gluten induces an intestinal cytokine response strongly dominated by interferon gamma in patients with celiac disease. Gastroenterology. 115(3): 551-563. 

  34. Obaid, RM., Yaseen, FT., Mukhlif, MY. (2020). Blood cells depletion after chemotherapy in Iraqi women with breast cancer. Indian Journal of Forensic Medicine and Toxicology. 14(4):  3379-3382.

  35. Oppmann, B., Lesley, R., Blom, B., Timans, J.C., Xu, Y., Hunte, B., Vega, F., et al. (2000). Novel p19 protein engages IL- 12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity. 13(5): 715-725. 

  36. O’Shea, JJ. and Paul, WE. (2010).  Mechanisms underlying lineage commitment and plasticity of helper CD4+ T cells .Science. 327: 1098-1102 10.1126/science.1178334.

  37. Oxentenko, AS. and Rubio-Tapia, A. (2019).  Celiac Disease. Mayo Clin.Proc.Rochester: Elsevier. 

  38. Parham, C., Chirica, M., Timans, J., Vaisberg, E., Travis, M., Cheung, J., et al., (2002). A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J Immunol. 168(11): 5699-5708. 

  39. Ren, HM., Lukacher, AE., Rahman, ZSM. and Olsen, NJ. (2021). New developments implicating IL-21 in autoimmune disease. J. Autoimmun. 122: 102689. 

  40. Sarah, SA., Ekhlass, NA., Nawal, MFA., Neihaya, HZ. and Ali, HA. (2021). Roles of IL-17A and IL-23 in the Pathogenesis of Ulcerative Colitis and Crohn’s Disease. Iraqi Journal of Biotechnology. 62(8):  2526-2535.  

  41. Spolski, R., Leonard, W. (2014).  Interleukin-21: a double-edged sword with therapeutic potential. Nat. Rev. Drug Discov. 13: 379-395. 

  42. Volta, U. and Villanacci, V. (2011). Diagnostic criteria in progress, Cellular and Molecular Immunology. 8: 96-102.

  43. Yadav, A. and Singh, U. (2022). Nutritional efficacy of maize based functional flour developed for minimizing the risk of lifestyle diseases in relation to normal wheat flour. Asian Journal of Dairy and Food Research. 41(4): 485-489. doi: 10.18805/ajdfr.DR-1826.
In this Article
Published In
Asian Journal of Dairy and Food Research

Editorial Board

View all (0)