Banner
Current IssueEditorial BoardOnline First ArticlesArchive
Current IssueEditorial BoardOnline First ArticlesArchive

Full Research Article

The Role of Serum Interleukins and PTPN22 in the Pathogenesis and Progression of Immune Thrombocytopenia

S
Sarah Nabeel Lamam1,2,*
S
Shaima R. Ibraheem1
1Department of Biotechnology, College of Science, University of Baghdad, Baghdad, Iraq.
2National Center of Hematology, Mustansiriyah University, Baghdad, Iraq.

ABSTRACT

Background: Immune thrombocytopenia (ITP) is a common acquired hematologic autoimmune illness. Objectives: this work goals to examine the role of interleukins (ILs) and polymorphisms of PTPN22 gene in the progression and pathogenesis of ITP. 

Methods: 50 ITP patients were included. Human serum levels of antinuclear antibodies (ANA), anti-platelet antibody (PA-Ab) and IL-40 were measured using enzyme linked immunosorbent assay (ELISA). Gene expression of Protein tyrosine phosphatase non-receptor type 22 (PTPN22) were determined using Real-time polymerase chain reaction (RT-PCR), while the sequencing of this gene was determined using Sanger method and genotyping was detected using conventional PCR. 

Result: No significant variations were observed in serum level of ANA, PA-Ab and IL-40, PTPN22 gene expression and its single nucleotide polymorphism (rs2488457) in acute and chronic cases of ITP. 

INTRODUCTION

Immune thrombocytopenia (ITP) is an illness of raised peripheral platelets’ damage or/and declined or insufficient production of platelets. This illness is a rare autoimmune illness with an occurrence approximately 3/100,000 individual-years, with a peak among males older than seventy-five years (9/100,000 individual-years). Factors originating ITP are unidentified; however, seasonal variations have been indicated with a raised occurrence throughout winter, supposing a role for viral infectious illnesses. Nevertheless, both chronic (>12 months after diagnosis) and persistent ITP (>3 months after diagnosis) affect 70% of adult individuals and are less susceptible to such variations, supposing the involvement of other parameters (Audia et al., 2021; Abbas et al., 2024; Al-Naddawi et al., 2014; Al-Aqabi and Alwan, 2010).

The ITP is an illness that may be chronic or transient and it is categorized by The International Working Group in ITP as primary or secondary according to the presence of a predisposing condition or an apparent precipitating parameter. In adults, 80% of newly detected individuals have primary ITP, which is marked by isolated thrombocytopenia. Secondary ITP is activated or linked with a hematological condition (autoimmune lymphoproliferative syndrome, lymphoma, or chronic lymphocytic leukemia), an autoimmune illness (rheumatoid arthritis, or lupus erythematosus), a chronic infectious illness (hepatitis C virus-HCV, or Helicobacter pylori), or subsequent therapy with drugs like quinidine and heparin (Mititelu et al., 2024; Ahmed et al., 2024).

Main factors responsible for abnormalities of ITP are platelet-specific glycoproteins and autoantibodies targeting megakaryocytes as well as cytotoxic T cells directly acting on platelets. Despite the fact that antibodies to specific glycoproteins of platelet membranes are exist in the majority of patients, the specific mechanism by which autoantibodies toward platelets are formed remains an unknown. Besides, the precursor of platelet in the bone marrows, megakaryocytes, may suffer distribution by autoantibodies of platelet which limits their synthesis of platelet. (Bussel et al., 2021; Zakaria et al., 2023). Immunologically, T cells’ dysfunction in individuals with ITP may result in tolerance loss, which have a vital function in the pathogenesis of this disease. Besides, T lymphocytes polarize into response of helper T-1 marked principally via the presence of tumour necrosis factor (TNF)-α and interferon-γ as well as response of helper T-2 forms IL-10, IL-4 and IL-13. Several serum interleukins, IL-11 and IL-1β,  could be vital biomarkers in the ITP diagnosis. (Zhan et al., 2021; Elsaid et al., 2022; Al Shami et al.,  2024; Lubis et al., 2024).

In this context, this work goals to examine the role of interleukins (ILs), including  IL-40, in addition to polymorphisms of PTPN22 gene in the progression and pathogenesis of ITP.

MATERIALS AND METHODS

Subjects
 
A total of 50 ITP patients (27 acute cases and 23 chronic cases) were included. The blood sample collected from Central Teaching Hospital pediatric (Baghdad/ Iraq) from February to August 2024. The physician was diagnosed the patients with ITP using complete blood count (CBC) and blood film.
 
Included criteria
 
These cases comprised of 22 females and 28 males with ages ranging from 1 to 15 years.
 
Excluded criteria
 
Each individual with age out of 1 and 15 years, not have ITP, having disease rather than ITP.
 
Collection of blood samples
 
From each ITP patient, a 5ml of samples of blood were obtained and separated into 3 parts: 2 ml of blood samples were kept in EDTA at -20°C till usage for genotyping. A 2.5 ml of blood was obtained in a gel plane tube and serum separated directly via centrifugation and transported into another plane tube and kept at -20°C for immunologic tests. A 0.5 ml blood was added to the Eppendorf tube containing 0.5 ml of TRIzol™ Reagent and kept at -20°C for molecular analysis.
 
Immunological assay
 
Serum levels of ANA and IL-40 were measured using ELISA kit (Sunlong/ China), while serum level of PA-Ab was measured using ELISA kit (Shanghai YL Biont/China).
 
Molecular study
 
Gene expression determination
 
RNA extraction
 
The TRIzolTM Reagent technique was utilised to isolate RNA. The concentration of extracted RNA was measured using a Quantus Fluorometer to assess the quality of samples for future usage. The findings showed that the RNA concentrations varied from 6 to 651 ng/L.
 
Primer design and preparation
 
The β-Globin gene was obtained from the National Center for Biotechnology Information Gene Bank (NCBI). The Premier 3 software was utilized to design PTPN22 gene primers (Macrogen Company, Korea), as follows: β-Globin-reverse (5'-CAACTTCATCCACGTTCACC-3') and β-Globin-forward (5'-ACACAACTGTGTTCACTAG C-3'), with lengths of 20 bp and annealing temperature of 65°C while PTPN22-reverse (5'-GTAGCTGGAATCCTCATCAGAGG-3') and PTPN22-forward (5'-ACA ACTGT GGCTGA GAAGCC CA-3') with length of 22 and 23 bp, respectively and annealing temperature of 60°C.
 
RT-qPCR
 
GoTaq® qPCR Master Mix Real time (Promega/USA) was utilized to accomplish the whole reaction, from synthesis of cDNA to amplification of PCR.  A total volume of 1 μl of RNA had to be reverse-transcribed and the reaction volume was 10 μl. The reaction mixture was modified to a total volume of 10 μl, following the manufacturer’s recommendation. It consisted of 5 μl qPCR Master Mix (1X), 0.3 μl of each primer (10 μM), 3.4 μl nuclease-free water and 1 μl cDNA (5-15 ng/μl). The mix was transferred to an RT-qPCR program (BioMolecular System, Australia) that was programmed for each step (temperature; time m:s; cycle), as follows: RT-Enzyme Activation step (37; 15:00; 1), Initial Denaturation step (95; 05:00; 1), Denaturation step (95; 00:20; 40), Annealing step (60 or 65; 00:20; 40), Extension step (72; 00:20; 40).
 
Gene expression
 
The ΔΔCt method (Livak et al., 2001).was utilized to normalize the expression data for PTPN22 versus β-Globin and the results were presented as changes of folding (2-ΔΔCt) in expression of genes.
 
Genotyping determination
 
DNA extraction
 
Genomic DNA was isolated from blood sample according to the protocol ReliaPrep™ Blood gDNA Miniprep System as manufacturer’s recommendations (Promega/USA). As a means of gauging the sample’s quality for further uses, the Quantus Fluorometer measured the concentration of extracted DNA. gDNA concentrations were ranged between 10-22 ng/µl.
 
SNP genotyping
 
To amplify the (782 bp) region of PTPN22 gene SNPs (rs2488457), conventional PCR was utilized. Reverse primer (5' - CAGGAAACAGCTATGACGACCAGACAGTT AGCTCAATAC -3') and forward primer (5' - TGTAAAA CGAC GGCCAGTCGTTACTTAGA GCAGCAAGAA - 3') of PTPN22 gene SNP (rs2488457) with length of 39 bp and annealing temperature of 50°C. The whole volume for the PCR reaction was 25 μl, including 12.5 μl of GoTaq green Master mix, 7.5 μl of nuclease-free distilled water, 1 μl of each primer, Forward and Reverse (10 μM) and 3 μl of DNA sample (20-29 ng). To confirm the presence of amplification after amplification of PCR, gel electrophoresis of agarose (1.5%) was utilized. The mix was transferred to a conventional PCR program (BioMolecular System, Australia) that was programmed for each step (temperature; time m:s; cycle), as follows: initial denaturation step (95; 05:00; 1), denaturation step (95; 00:30; 30), annealing step (55; 00:30; 30), extension step (72; 00:45; 30), final extension step (72; 07:00; 1), hold step (10; 10:00, 1).
 
Standard sequencing
 
The PCR products were delivered to Macrogen Corporation - Korea for Sanger sequencing utilising an automated DNA sequencer called an ABI3730XL. Geneious software was utilized to analyse the findings after receiving them over email.

Statistical analysis
 
Data analysis was carried out with the help of GraphPad Prism 7.0. For parametric data, an unpaired t-test was used; for non-parametric data, a Mann-Whitney U test was used to determine the likelihood. To determine the likelihood of categorical data, either the chi-square or Fisher exact tests were utilized. The spearman correlation test was used to determine the level of correlation between the values. In order to do ROC analysis, the SPSS statistical tool was used. A statistically significant difference was defined as a P value lower than 0.05.

RESULTS AND DISCUSSION

General characteristics
 
The comparison among acute and chronic individuals with ITP yielded the following results: Age was not significantly different among acute and chronic individuals with ITP (5.6 ±3.81 vs. 7.54± 3.55 years, p=0.0749). Sex distribution was also comparable among the two groups (62.96% male in acute vs. 47.83% in chronic, p=0.3926). BMI was similar among acute and chronic individuals with ITP (32 vs. 32.7, p=0.6261). As expected, the period of illness differed, with 33.34% of acute individuals with ITP having symptoms for <1 month and 78.26% of chronic individuals with ITP having symptoms for <1 year. Treatment status differed, with all chronic individuals with ITP receiving treatment and 25.93% of acute individuals with ITP not receiving treatment, as represented in Table 1.

Table 1: Demographic parameters and medical history of acute and chronic cases with ITP.


 
Hematological study
 
Hematological parameters, including mean ±  SD of RBC (4.78±0.483 vs. 4.64±0.41 × 106/µL, p=0.2685) and Hb (12.56±1.43 vs. 12.34±1.68 g/dl, p=0.631) as well as median of WBC (9.9 vs. 8.9 × 103/µL, p=0.674) and PLT (186 vs. 72 × 103/µL, p=0.2893) detected no significant variations among acute and chronic individuals with ITP, respectively, as represented in Fig 1.
 

Fig 1: Hematological parameters among acute and chronic cases of ITP.



Serological study
 
The comparison among acute and chronic individuals with ITP revealed the following results: ANA levels were not significantly different among acute and chronic individuals with ITP (8.2 vs. 4.7, p=0.3225). IL-40 levels detected a trend towards being greater in acute individuals with ITP, but the variation did not reach statistical significance (10.5 vs. 9.04, p=0.0676). PA-Ab levels were significantly greater in acute individuals with ITP compared to chronic individuals with ITP (16.6 vs. 9.5, p=0.0233), as represented in Fig 2.

Fig 2: Serological parameters of acute and chronic cases with ITP.



Analyses evaluating the relative strengths of ANA, PA-Ab and IL-40 as diagnostic tools for differentiating between acute and chronic ITP showed mixed results. There was no statistically significant difference between ANA and chance, but the AUC of 0.603 was good and the sensitivity was high at 84.62% with a poor specificity of 50%. There is modest diagnostic potential for IL-40, as it produced a respectable AUC of 0.651, reasonable sensitivity (60.87%) and specificity (66.67%) and a p-value (0.0674) that is approaching towards significance.  PA-Ab shown promising biomarker potential with an AUC of 0.689, which was statistically significant (p = 0.0239) and had a well-balanced sensitivity (69.57%) and specificity (66.67%), as represented in Fig 3. 

Fig 3: ROC of PA-Ab, ANA and IL-40 among acute and chronic cases with ITP.


 
Molecular study
 
Gene expression
 
The comparison among acute and chronic individuals with ITP detected that PTPN22 expression levels were not significantly different among the two groups (0.34 vs. 0.225, p=0.7799). The wide range of expression levels in both groups (0.01-2.84 in acute and 0.01-3.41 in chronic) suggests variability in PTPN22 expression among individuals, but overall, the median expression levels were comparable among acute and chronic individuals with ITP, as represented in Table 2.

Table 2: Gene expression of PTPN22 among acute and chronic cases with ITP.



The study found that PTPN22 expression fold is not a reliable biomarker for distinguishing between acute and chronic individuals with ITP. The area under the curve (AUC) was 0.527, which is considered “unsatisfactory” and not significantly different from random chance (p-value 0.7726). The optimal cut-off value had a sensitivity of 66.67% and specificity of 52.17%, which is not sufficient for a reliable diagnostic test, as represented in Fig 4.

Fig 4: ROC analysis of PTPN22 gene expression among acute and chronic cases with ITP.


 
Genotyping
 
The PCR amplification of rs2488457 specific region were performed and the results, as represented in Fig 5, indicated single band of 782 bp of rs2488457 for patients with ITP.

Fig 5: The outcomes of the specific area amplification of rs2488457 were processed utilising gel electrophoresis of 1.5% agarose stained with Eth.Br.



Sanger sequencing method were utilized in order to estimate the sequence of each SNP (rs2488457) in PTPN22 gene, as represented in Fig 6.

Fig 6: Sanger sequencing analysis of PTPN22 gene rs2488457 SNP.



The comparison of rs2488457 genotype frequencies among acute and chronic individuals with ITP detected no significant variation (p=0.4996). The distribution of genotypes was similar among the two groups, with homozygous wild-type being the most common genotype in both acute (55.6%) and chronic (69.6%) individuals with ITP, followed by heterozygous genotypes (37% in acute and 21.7% in chronic), as represented in Table 3.

Table 3: Frequency of rs2488457 among acute and chronic with ITP.


 
Correlation study
 
The analysis of PTPN22 expression based on rs2488457 genotype detected no significant variations in both acute and chronic individuals with ITP. In acute individuals with ITP, the median PTPN22 expression levels were 2.84 for the wild-type genotype (limited to one value), 0.34 for the homozygous genotype and 0.19 for the heterozygous genotype (p=0.7965). In chronic individuals with ITP, the median PTPN22 expression levels were 0.495 for the wild-type genotype, 0.165 for the homozygous genotype and 0.295 for the heterozygous genotype (p=0.4313), as represented in Table 4.

Table 4: Correlation between PTPN22 expression and rs2488457 genotype among acute and chronic cases with ITP.



The correlation analysis in chronic individuals with ITP revealed several significant relationships. Age detected a high negative correlation with BMI (r = -0.72, p<0.0001). ANA levels detected significant high positive correlations with IL-40 (r = 0.63, p<0.05), as represented in Table 5.

Table 5: Correlations between BMI, age, hematological and serological parameters among acute cases with ITP.



This study focuses on the role of immunological biomarkers (IL-40) and genetic marker (PTPN22 gene) in incidence of acute and chronic ITP cases.

Depending these outcomes, the difference in PTPN22 expression of acute and chronic cases was not statistically significant. This contrasts with findings in other autoimmune and inflammatory diseases, where PTPN22 expression tends to be elevated. For instance, (Ruan et al., 2022). reported an upregulation of PTPN22 in immune cells within the aortic tissue of patients with abdominal aortic aneurysm (AAA), suggesting a pro-inflammatory role. Similarly,  (Hassan et al., 2024). observed significantly increased PTPN22 expression in individuals with autoimmune inflammatory diseases (AID), further supporting its involvement in heightened immune response. On the other hand, (Moneim et al., 2023) did not observe a significant difference in PTPN22 mRNA expression between systemic lupus erythematosus (SLE) patients and healthy controls, indicating disease-specific variation in gene regulation. In addition, gene expression of PTPN22 decreased in patients of SLE in compared to healthy controls (HCs)  (Román-Fernández et al.,  2022). Moreover, (Menchaca-Tapia et al., 2023). reported a remarkable 17-fold increase in PTPN22 expression in patients with primary Sjögren’s syndrome (pSS), highlighting a strong association between the gene and glandular autoimmunity. Similarly,  (Ramírez-Pérez et al.,  2019). found that PTPN22 was linked to higher gene expression in rheumatoid arthritis (RA), reinforcing the gene’s role in T-cell regulation and autoimmunity. These findings collectively suggest that PTPN22 may act as a regulatory hub in immune-mediated diseases, with expression levels varying depending on the underlying pathophysiology of each condition. PTPN22 is expressed in most human leukocyte types, including neutrophils, CD4+ T cells, dendritic cells, macrophages, monocytes, NK cells, B cells and CD8+ T cells. Of these cells, PTPN22 has the highest expressions in activated naïve CD4+ and CD8+ T cells, followed by B cells and NK cells, with lower levels in monocytes (Armitage et al., 2021). The PTPN22 gene plays a significant role in immune regulation and is implicated in various diseases, particularly autoimmune disorders. Variants in this gene can lead to altered protein function, which affects T-cell activation and signaling pathways (Brownlie et al., 2024).. This dysregulation can increase susceptibility to autoimmune diseases such as rheumatoid arthritis  (Budlewski et al., 2023) type 1 diabetes  (Newman et al., 2023) and SLE (Ates et al., 2025) where the immune system mistakenly attacks the body’s own tissues.

This study and (Tian et al., 2022) focus on the association of the PTPN22 gene SNP (rs2488457) with ITP. Tian et al. found that carriers of genotypes of GG were 1.51 times more susceptible to ITP than carriers of CC, with a significant p-value of 0.009. This suggests that while this study observed no difference in genotype frequency, Tian et al. provided evidence of a meaningful association with susceptibility, highlighting a potential inconsistency in findings ( Zhang et al., 2022; Bhat et al., 2024) identified a significant relationship between rs2488457 polymorphisms and uveitis susceptibility, showing that the C allele was associated with increased risk (OR = 1.18, p = 0.029). This contrasts with this study, which reported no significant differences in the distribution of genotypes among both cases with ITP. The study by (Menchaca-Tapia et al., 2023). found no significant differences in genotype frequencies for rs2488457 between primary Sjögren’s syndrome patients and HCs, aligning with the lack of significant findings in this study regarding ITP. This suggests a possible commonality in that both immune disorders may not exhibit strong associations with this particular SNP, indicating a need for further investigation into genetic risk factors for these conditions.

(Kaymaz et al., 2023) examined the frequency of the G allele in lung sarcoidosis, reporting a G allele frequency of 67%, whereas this study found 8% of ITP patients with the GG genotype. The stark difference in genotype frequencies suggests that the impact of rs2488457 may be disease-specific. This reinforces the notion that genetic susceptibility can vary significantly across different diseases, necessitating a tailored approach to genetic research in immune disorders. (Jiménez-Becerra  et al.,  2024; Ngurthankhumi et al., 2024) reported a range of 36% to 48% for the risk allele PTPN22 rs2488457G in systemic lupus erythematosus. In contrast, this study reported a lower prevalence of the GG genotype in ITP. The variation in allele distribution highlights the complexity of genetic influences on autoimmunity and suggests that while certain SNPs may be implicated in multiple conditions, their prevalence and impact can differ markedly.

Lu et al., (2022) found no contribution of rs2488457 to chronic spontaneous urticaria susceptibility, echoing the findings of this study regarding ITP. Both studies suggest that rs2488457 may not be a critical risk factor in certain immune-related conditions, prompting further research to identify other genetic variations that could better explain susceptibility. (Bufalo et al., 2021) reported significant associations between the CC genotype of rs3789607 and Graves’ disease susceptibility, contrasting with this study’s focus on rs2488457 and its lack of significant findings in ITP. This highlights the specificity of genetic markers in different autoimmune diseases, suggesting that while some SNPs may be important for one condition, they may not hold the same relevance for another. (Jabeen et al., 2024) demonstrated a notable association between the CT genotype of rs2488457 and type 1 diabetes, with significant odds ratios. This study, however, found no significant differences in genotype frequencies among ITP patients. The differing results suggest that rs2488457 may play a more prominent role in type 1 diabetes than in ITP, emphasizing the need for condition-specific genetic investigations.

Zhang et al., (2025) found rs2488457 significantly associated with acute lymphoblastic leukemia progression-free survival, highlighting its potential importance in hematological malignancies. In contrast, this study reported no significant associations in ITP, which may indicate that while certain SNPs can influence disease outcomes in cancer, they may not have the same implications in autoimmune disorders like ITP, underscoring the diverse genetic landscape across diseases. (Su et al., 2025). revealed a significant association between rs2476601 and an increased risk of type 1 diabetes, while this study found no significant associations for rs2488457 with ITP. This divergence emphasizes the possibility that different SNPs may have varying impacts on distinct autoimmune diseases, suggesting a complex interplay of genetic factors that warrants further exploration in the context of immune dysregulation.

CONCLUSION

As a whole, PA-Ab showed the most diagnostic promise in differentiating between acute and chronic ITP. The similar distribution of genotypes suggests that rs2488457 may not be associated with disease duration or progression from acute to chronic. The lack of significant variations suggests that rs2488457 genotype may not have a substantial impact on PTPN22 expression levels in either acute or chronic individuals with ITP.

ACKNOWLEDGEMENT

Everyone who helped with this research, whether they were participants, physicians or guiders, is appreciated. 
 
Funding
 
Self-funding.
 
Ethical clearance
 
The study proposal, outlining its objectives and methodologies, was submitted for ethical review to the Ethics Committee at the College of Science, University of Baghdad. Ethical clearance was granted under the reference number CSEC/0224/0021, dated 20 February 2024. The study adhered to the consent form guidelines as stipulated by the Iraqi Ministry of Health.

CONFLICT OF INTEREST

The authors declare that they have no conflicts of interest.

REFERENCES


  1. Al-Aqabi, A.S. and Alwan, A.F. (2010). Idiopathic autoimmune thrombocytopenic purpura (ITP) in adult; review of 50 cases admitted to Baghdad teaching hospital. Journal of the Faculty of Medicine Baghdad. 52(2): 167-171.

  2. Al-Naddawi, M., Ibraheem, M.F. and Sharhan, F.J. (2014). Acute immune thrombocytopenic purpura in childhood presentation and treatment a hospital based study. Journal of the Faculty of Medicine Baghdad. 56(3): 249-253.

  3. Abbas, H.K., Saleh, B.O. and Ghali, H.H. (2024). Frequency of 25- Hydroxyvitamin D deficiency in pediatric patients with immune thrombocytopenia: Disease phase and therapy options. Journal of the Faculty of Medicine Baghdad. 66(4): 460-465.

  4. Ahmed, A.H. and Altaee, M.F. (2024). The association of DAZ1 gene deletion with azoospermia in Iraqi Infertile Men. Iraqi Journal of Science. 65(6): 3112-3121.

  5. Al Shami, M.A. and Saud, A.M. (2024). Assessing gene expression of factor XIII-A1 in Iraqi patients with FXIII deficiency. Journal of Bioscience and Applied Research. 10(1): 103-110.

  6. Armitage, L.H., Wallet, M.A., Mathews, C.E. (2021).Influence of PTPN22 allotypes on innate and adaptive immune function in health and disease. Front Immunol. 12: 636618. 

  7. Ates, I., Terzi, U., Suzen, S., Irham, L.M. (2025). An overview on Sjögren’s syndrome and systemic lupus erythematosus’ genetics. Toxicol Res (Camb). 14(1): tfae194. 

  8. Audia, S., Mahévas, M., Nivet, M., Ouandji, S., Bonnotte, B. (2021). Immune thrombocytopenia: Recent advances in pathogenesis and treatments. Hemasphere. 5(6): e574. 

  9. Bhat, S.V., Shynu, M., Divya, P.D., Desai, A.G. and Akhil, G.H. (2024). Molecular markers for metabolic adaptation in dairy cows: SNAI2 gene variations. Asian Journal of Dairy and Food Research. 43(4): 762-765. doi: 10.18805/ajdfr.DR-1763.

  10. Brownlie, R.J., Salmond, R.J. (2024). Regulation of T cell signaling and immune responses by PTPN22. Mol Cell Biol. 44(10): 443-452. 

  11. Budlewski, T., Sarnik, J., Galita, G., Dragan, G., Brzeziñska, O., Pop³awska, M., et al. (2023). SNP in PTPN22, PADI4 and STAT4 but Not TRAF1 and CD40 increase the risk of rheumatoid arthritis in polish population. Int J Mol Sci. 24(8): 7586. 

  12. Bufalo, N.E., Dos Santos, R.B., Rocha, A.G., Teodoro, L., Romaldini, J.H., Ward, L.S. (2021). Polymorphisms of the genes CTLA4, PTPN22, CD40 and PPARG and their roles in Graves’ disease: susceptibility and clinical features. Endocrine. 71: 104-112. 

  13. Bussel, J., Cooper, N., Boccia, R., Zaja, F., Newland, A. (2021). Immune thrombocytopenia. Expert Rev Hematol. 14(11): 1013-25. 

  14. Elsaid, D.S., Elhamid Elbedewy, T.A., Soliman, N.A., Shalaby, K.A., Abdel-Hamid, Haroun, R. (2022).  Interleukin-37, vascular endothelial growth factor A and transforming growth factor-â1: Promising biomarkers in primary immune thrombocytopenia. Expert Rev Hematol. 15(8): 757-768. 

  15. Hassan, M.A., Agban, M.N., Elkhawaga, A.A. (2024). Correlation between IL-17, TGF-â and PTPN-22 Levels and Covid- 19 severity in patients with and without autoimmune diseases. Egypt J. Med Microbiol. 33(2). 

  16. Jabeen, A., Riaz, S., Usman, M., Parveen, A., Mukhtar, M., Wajid, A. et al. (2024). Association of polymorphism of NLRP3, ICAM-1, PTPN22, INS genes in childhood onset type 1 diabetes in a Pakistani population. Mol Biol Rep. 51(1): 1070. 

  17. Jiménez-Becerra, E.D., Ramírez-Bello, J., Nakazawa-Ueji, Y.E., González-Herrera, L.J., Rubi-Castellanos, R., Barbosa- Cobos, R.E. et al. (2024). PTPN22 rs2488457C> G and TRAF1-C5 rs10818488A> G and rs3761847G> A variants in mexican mestizo women with systemic lupus erythematosus. Med Res Arch. 12(6). 

  18. Kaymaz, S., Kavas, M., Demiray, A., Karasu, U., Çobankara, V., Boğa, S. (2023). Investigation of the relationship between Ptpn22 polymorphisms and lung sarcoidosis: A Cross Sectional Study. Rheumatology (Bulgaria). 

  19. Livak, K.J., Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2- ΔΔCT method. Methods. 25(4): 402-408. 

  20. Lu, N., Tan, X., Liu, X., Niu, L., Yao, S., Lu, B. (2022). Lack evidence of association of PTPN 22 and CTLA 4 polymorphisms with risk of chronic spontaneous urticaria in Han Chinese population. J. Cosmet Dermatol. 21(3): 1326-1327. 

  21. Lubis, I., Junaedi, A. and Sopandie, D. (2024). The role of net assimilation rate and nitrogen management in optimizing rice (Oryza sativa L.) yield. Indian Journal of Agricultural Research. 58(4): 627-633. doi: 10.18805/IJARe.AF-813.

  22. Menchaca-Tapia, P.A., Marín-Rosales, M., Salazar-Camarena, D.C., Cruz, A. Oregon-Romero, E., Tapia-Llanos, R. et al. (2023).  Analysis of PTPN22-1123 G> C,+ 788 G> A and+ 1858 C> T polymorphisms in patients with primary sjögren’s syndrome. Diagnostics. 13(5): 899. 

  23. Mititelu, A., Onisâi, M.C., Ro’ca, A., Vlãdãreanu, A.M. (2024). Current understanding of immune thrombocytopenia: A review of pathogenesis and treatment options. Int J. Mol Sci. 25(4): 2163. 

  24. Moneim, N.H.A., Hosny, M.M., Omar, H.H., Abdelnaby, M.M., Fouad, M.M., Abd El-Waheed, W.O. et al. (2023).  Relative CTLA-4, PTPN-22 and interleukin 37 mRNA expressions in patients with lupus nephritis. Reumatol Clin. 19(4): 180-187. 

  25. Newman, J.R.B., Concannon, P., Ge, Y. (2023). UBASH3A interacts with PTPN22 to regulate IL2 expression and risk for type 1 diabetes. Int J. Mol Sci. 24(10): 8671. 

  26. Ngurthankhumi, R., Hazarika, T.K., Lalruatsangi, E., Lalhmachhuani, H. and Debbarma, P. (2024). Anticancer screening of few wild edible fruits in Mizoram, Northeast India using MTT Assay. Indian Journal of Agricultural Research. 58 special issue: 1042-1047. doi: 10.18805/IJARe.A-6249.  

  27. Ramírez-Pérez, S., Sánchez-Zuno, G.A., Chavarría-Buenrostro, L.E., Montoya-Buelna, M., Reyes-Pérez, I.V., Ramírez- Dueñas, M.G. et al. (2019). PTPN22+ 788 G> A (R263Q) polymorphism is associated with mRNA expression but it is not a susceptibility marker for rheumatoid arthritis patients from Western Mexico. Biochem Genet. 57: 455-465. 

  28. Román-Fernández, I.V., Machado-Contreras, J.R., Muñoz-Valle, J.F., Cruz, A., Salazar-Camarena, D.C., Palafox-Sánchez, C.A. (2022). Altered Ptpn22 and Il10 mrna expression is associated with disease activity and renal involvement in systemic lupus erythematosus. Diagnostics. 12(11): 2859. 

  29. Ruan, P., Gao, L., Jiang, H., Chu, T., Ge, J., Kong, X. (2022).  Identification of PTPN22 as a potential genetic biomarker for abdominal aortic aneurysm. Front Cardiovasc Med. 9: 1061771. 

  30. Su, Y., Li, X., Wu, P. dong, Zhang, Y. long, Fang, P. fei, Wu, F. fei, et al. (2025). The Association between PTPN22 SNPs and susceptibility to type 1 diabetes: An updated meta- analysis. PLoS One. 20(4): e0321624.

  31. Tian, H., Xu, W., Wen, L., Tang, L., Zhang, X., Song, T., et al. (2022). Association of PTPN22 SNP1858 (rs2476601) and gene SNP1123 (rs2488457) polymorphism with primary immune thrombocytopenia susceptibility: A meta-analysis of case-control studies and trial sequential analysis. Front Genet. 13: 893669. 

  32. Zakaria, M., Beshir, M., Hassan, T., Esh, A., Abdelaziz, E., Tayib, R. et al. (2023). Role of interleukin 4 (IL4) and interleukin 6 (IL6) in the pathogenesis and prognosis of childhood primary immune thrombocytopenia. Eur J. Pediatr. 182(7): 3129-3138. 

  33. Zhan, Y., Cheng, L., Wu, B., Ji, L., Chen, P., Li, F. et al. (2021).  Interleukin (IL)-1 family cytokines could differentiate primary immune thrombocytopenia from systemic lupus erythematosus-associated thrombocytopenia. Ann Transl Med. 9(3): 222. 

  34. Zhang, A., Liu, W., Can, C., Guo, X., Jia, H., Wei, Y. et al. (2025). Immune-related genetic single-nucleotide polymorphisms contribute to prognosis and response to chemotherapy in patients with acute lymphoblastic leukemia. Inflammation Research. 74(1): 1-16. 

  35. Zhang, J., Zhou, P., Hu, S., Qi, J. (2022). Meta-analysis of the genetic association between PTPN22 and CTLA-4 Variants and Risk of Uveitis. Ophthalmic Research. 65: 264-275.
Published In
Asian Journal of Dairy and Food Research
Article Metrics
Metrics Icon
0
Views
0
Citations
Reviewed By
Share Article
Download Article
In this Article
    Contact us
    Follow us

    Full Research Article

    The Role of Serum Interleukins and PTPN22 in the Pathogenesis and Progression of Immune Thrombocytopenia

    S
    Sarah Nabeel Lamam1,2,*
    S
    Shaima R. Ibraheem1
    1Department of Biotechnology, College of Science, University of Baghdad, Baghdad, Iraq.
    2National Center of Hematology, Mustansiriyah University, Baghdad, Iraq.

    ABSTRACT

    Background: Immune thrombocytopenia (ITP) is a common acquired hematologic autoimmune illness. Objectives: this work goals to examine the role of interleukins (ILs) and polymorphisms of PTPN22 gene in the progression and pathogenesis of ITP. 

    Methods: 50 ITP patients were included. Human serum levels of antinuclear antibodies (ANA), anti-platelet antibody (PA-Ab) and IL-40 were measured using enzyme linked immunosorbent assay (ELISA). Gene expression of Protein tyrosine phosphatase non-receptor type 22 (PTPN22) were determined using Real-time polymerase chain reaction (RT-PCR), while the sequencing of this gene was determined using Sanger method and genotyping was detected using conventional PCR. 

    Result: No significant variations were observed in serum level of ANA, PA-Ab and IL-40, PTPN22 gene expression and its single nucleotide polymorphism (rs2488457) in acute and chronic cases of ITP. 

    INTRODUCTION

    Immune thrombocytopenia (ITP) is an illness of raised peripheral platelets’ damage or/and declined or insufficient production of platelets. This illness is a rare autoimmune illness with an occurrence approximately 3/100,000 individual-years, with a peak among males older than seventy-five years (9/100,000 individual-years). Factors originating ITP are unidentified; however, seasonal variations have been indicated with a raised occurrence throughout winter, supposing a role for viral infectious illnesses. Nevertheless, both chronic (>12 months after diagnosis) and persistent ITP (>3 months after diagnosis) affect 70% of adult individuals and are less susceptible to such variations, supposing the involvement of other parameters (Audia et al., 2021; Abbas et al., 2024; Al-Naddawi et al., 2014; Al-Aqabi and Alwan, 2010).

    The ITP is an illness that may be chronic or transient and it is categorized by The International Working Group in ITP as primary or secondary according to the presence of a predisposing condition or an apparent precipitating parameter. In adults, 80% of newly detected individuals have primary ITP, which is marked by isolated thrombocytopenia. Secondary ITP is activated or linked with a hematological condition (autoimmune lymphoproliferative syndrome, lymphoma, or chronic lymphocytic leukemia), an autoimmune illness (rheumatoid arthritis, or lupus erythematosus), a chronic infectious illness (hepatitis C virus-HCV, or Helicobacter pylori), or subsequent therapy with drugs like quinidine and heparin (Mititelu et al., 2024; Ahmed et al., 2024).

    Main factors responsible for abnormalities of ITP are platelet-specific glycoproteins and autoantibodies targeting megakaryocytes as well as cytotoxic T cells directly acting on platelets. Despite the fact that antibodies to specific glycoproteins of platelet membranes are exist in the majority of patients, the specific mechanism by which autoantibodies toward platelets are formed remains an unknown. Besides, the precursor of platelet in the bone marrows, megakaryocytes, may suffer distribution by autoantibodies of platelet which limits their synthesis of platelet. (Bussel et al., 2021; Zakaria et al., 2023). Immunologically, T cells’ dysfunction in individuals with ITP may result in tolerance loss, which have a vital function in the pathogenesis of this disease. Besides, T lymphocytes polarize into response of helper T-1 marked principally via the presence of tumour necrosis factor (TNF)-α and interferon-γ as well as response of helper T-2 forms IL-10, IL-4 and IL-13. Several serum interleukins, IL-11 and IL-1β,  could be vital biomarkers in the ITP diagnosis. (Zhan et al., 2021; Elsaid et al., 2022; Al Shami et al.,  2024; Lubis et al., 2024).

    In this context, this work goals to examine the role of interleukins (ILs), including  IL-40, in addition to polymorphisms of PTPN22 gene in the progression and pathogenesis of ITP.

    MATERIALS AND METHODS

    Subjects
     
    A total of 50 ITP patients (27 acute cases and 23 chronic cases) were included. The blood sample collected from Central Teaching Hospital pediatric (Baghdad/ Iraq) from February to August 2024. The physician was diagnosed the patients with ITP using complete blood count (CBC) and blood film.
     
    Included criteria
     
    These cases comprised of 22 females and 28 males with ages ranging from 1 to 15 years.
     
    Excluded criteria
     
    Each individual with age out of 1 and 15 years, not have ITP, having disease rather than ITP.
     
    Collection of blood samples
     
    From each ITP patient, a 5ml of samples of blood were obtained and separated into 3 parts: 2 ml of blood samples were kept in EDTA at -20°C till usage for genotyping. A 2.5 ml of blood was obtained in a gel plane tube and serum separated directly via centrifugation and transported into another plane tube and kept at -20°C for immunologic tests. A 0.5 ml blood was added to the Eppendorf tube containing 0.5 ml of TRIzol™ Reagent and kept at -20°C for molecular analysis.
     
    Immunological assay
     
    Serum levels of ANA and IL-40 were measured using ELISA kit (Sunlong/ China), while serum level of PA-Ab was measured using ELISA kit (Shanghai YL Biont/China).
     
    Molecular study
     
    Gene expression determination
     
    RNA extraction
     
    The TRIzolTM Reagent technique was utilised to isolate RNA. The concentration of extracted RNA was measured using a Quantus Fluorometer to assess the quality of samples for future usage. The findings showed that the RNA concentrations varied from 6 to 651 ng/L.
     
    Primer design and preparation
     
    The β-Globin gene was obtained from the National Center for Biotechnology Information Gene Bank (NCBI). The Premier 3 software was utilized to design PTPN22 gene primers (Macrogen Company, Korea), as follows: β-Globin-reverse (5'-CAACTTCATCCACGTTCACC-3') and β-Globin-forward (5'-ACACAACTGTGTTCACTAG C-3'), with lengths of 20 bp and annealing temperature of 65°C while PTPN22-reverse (5'-GTAGCTGGAATCCTCATCAGAGG-3') and PTPN22-forward (5'-ACA ACTGT GGCTGA GAAGCC CA-3') with length of 22 and 23 bp, respectively and annealing temperature of 60°C.
     
    RT-qPCR
     
    GoTaq® qPCR Master Mix Real time (Promega/USA) was utilized to accomplish the whole reaction, from synthesis of cDNA to amplification of PCR.  A total volume of 1 μl of RNA had to be reverse-transcribed and the reaction volume was 10 μl. The reaction mixture was modified to a total volume of 10 μl, following the manufacturer’s recommendation. It consisted of 5 μl qPCR Master Mix (1X), 0.3 μl of each primer (10 μM), 3.4 μl nuclease-free water and 1 μl cDNA (5-15 ng/μl). The mix was transferred to an RT-qPCR program (BioMolecular System, Australia) that was programmed for each step (temperature; time m:s; cycle), as follows: RT-Enzyme Activation step (37; 15:00; 1), Initial Denaturation step (95; 05:00; 1), Denaturation step (95; 00:20; 40), Annealing step (60 or 65; 00:20; 40), Extension step (72; 00:20; 40).
     
    Gene expression
     
    The ΔΔCt method (Livak et al., 2001).was utilized to normalize the expression data for PTPN22 versus β-Globin and the results were presented as changes of folding (2-ΔΔCt) in expression of genes.
     
    Genotyping determination
     
    DNA extraction
     
    Genomic DNA was isolated from blood sample according to the protocol ReliaPrep™ Blood gDNA Miniprep System as manufacturer’s recommendations (Promega/USA). As a means of gauging the sample’s quality for further uses, the Quantus Fluorometer measured the concentration of extracted DNA. gDNA concentrations were ranged between 10-22 ng/µl.
     
    SNP genotyping
     
    To amplify the (782 bp) region of PTPN22 gene SNPs (rs2488457), conventional PCR was utilized. Reverse primer (5' - CAGGAAACAGCTATGACGACCAGACAGTT AGCTCAATAC -3') and forward primer (5' - TGTAAAA CGAC GGCCAGTCGTTACTTAGA GCAGCAAGAA - 3') of PTPN22 gene SNP (rs2488457) with length of 39 bp and annealing temperature of 50°C. The whole volume for the PCR reaction was 25 μl, including 12.5 μl of GoTaq green Master mix, 7.5 μl of nuclease-free distilled water, 1 μl of each primer, Forward and Reverse (10 μM) and 3 μl of DNA sample (20-29 ng). To confirm the presence of amplification after amplification of PCR, gel electrophoresis of agarose (1.5%) was utilized. The mix was transferred to a conventional PCR program (BioMolecular System, Australia) that was programmed for each step (temperature; time m:s; cycle), as follows: initial denaturation step (95; 05:00; 1), denaturation step (95; 00:30; 30), annealing step (55; 00:30; 30), extension step (72; 00:45; 30), final extension step (72; 07:00; 1), hold step (10; 10:00, 1).
     
    Standard sequencing
     
    The PCR products were delivered to Macrogen Corporation - Korea for Sanger sequencing utilising an automated DNA sequencer called an ABI3730XL. Geneious software was utilized to analyse the findings after receiving them over email.

    Statistical analysis
     
    Data analysis was carried out with the help of GraphPad Prism 7.0. For parametric data, an unpaired t-test was used; for non-parametric data, a Mann-Whitney U test was used to determine the likelihood. To determine the likelihood of categorical data, either the chi-square or Fisher exact tests were utilized. The spearman correlation test was used to determine the level of correlation between the values. In order to do ROC analysis, the SPSS statistical tool was used. A statistically significant difference was defined as a P value lower than 0.05.

    RESULTS AND DISCUSSION

    General characteristics
     
    The comparison among acute and chronic individuals with ITP yielded the following results: Age was not significantly different among acute and chronic individuals with ITP (5.6 ±3.81 vs. 7.54± 3.55 years, p=0.0749). Sex distribution was also comparable among the two groups (62.96% male in acute vs. 47.83% in chronic, p=0.3926). BMI was similar among acute and chronic individuals with ITP (32 vs. 32.7, p=0.6261). As expected, the period of illness differed, with 33.34% of acute individuals with ITP having symptoms for <1 month and 78.26% of chronic individuals with ITP having symptoms for <1 year. Treatment status differed, with all chronic individuals with ITP receiving treatment and 25.93% of acute individuals with ITP not receiving treatment, as represented in Table 1.

    Table 1: Demographic parameters and medical history of acute and chronic cases with ITP.


     
    Hematological study
     
    Hematological parameters, including mean ±  SD of RBC (4.78±0.483 vs. 4.64±0.41 × 106/µL, p=0.2685) and Hb (12.56±1.43 vs. 12.34±1.68 g/dl, p=0.631) as well as median of WBC (9.9 vs. 8.9 × 103/µL, p=0.674) and PLT (186 vs. 72 × 103/µL, p=0.2893) detected no significant variations among acute and chronic individuals with ITP, respectively, as represented in Fig 1.
     

    Fig 1: Hematological parameters among acute and chronic cases of ITP.



    Serological study
     
    The comparison among acute and chronic individuals with ITP revealed the following results: ANA levels were not significantly different among acute and chronic individuals with ITP (8.2 vs. 4.7, p=0.3225). IL-40 levels detected a trend towards being greater in acute individuals with ITP, but the variation did not reach statistical significance (10.5 vs. 9.04, p=0.0676). PA-Ab levels were significantly greater in acute individuals with ITP compared to chronic individuals with ITP (16.6 vs. 9.5, p=0.0233), as represented in Fig 2.

    Fig 2: Serological parameters of acute and chronic cases with ITP.



    Analyses evaluating the relative strengths of ANA, PA-Ab and IL-40 as diagnostic tools for differentiating between acute and chronic ITP showed mixed results. There was no statistically significant difference between ANA and chance, but the AUC of 0.603 was good and the sensitivity was high at 84.62% with a poor specificity of 50%. There is modest diagnostic potential for IL-40, as it produced a respectable AUC of 0.651, reasonable sensitivity (60.87%) and specificity (66.67%) and a p-value (0.0674) that is approaching towards significance.  PA-Ab shown promising biomarker potential with an AUC of 0.689, which was statistically significant (p = 0.0239) and had a well-balanced sensitivity (69.57%) and specificity (66.67%), as represented in Fig 3. 

    Fig 3: ROC of PA-Ab, ANA and IL-40 among acute and chronic cases with ITP.


     
    Molecular study
     
    Gene expression
     
    The comparison among acute and chronic individuals with ITP detected that PTPN22 expression levels were not significantly different among the two groups (0.34 vs. 0.225, p=0.7799). The wide range of expression levels in both groups (0.01-2.84 in acute and 0.01-3.41 in chronic) suggests variability in PTPN22 expression among individuals, but overall, the median expression levels were comparable among acute and chronic individuals with ITP, as represented in Table 2.

    Table 2: Gene expression of PTPN22 among acute and chronic cases with ITP.



    The study found that PTPN22 expression fold is not a reliable biomarker for distinguishing between acute and chronic individuals with ITP. The area under the curve (AUC) was 0.527, which is considered “unsatisfactory” and not significantly different from random chance (p-value 0.7726). The optimal cut-off value had a sensitivity of 66.67% and specificity of 52.17%, which is not sufficient for a reliable diagnostic test, as represented in Fig 4.

    Fig 4: ROC analysis of PTPN22 gene expression among acute and chronic cases with ITP.


     
    Genotyping
     
    The PCR amplification of rs2488457 specific region were performed and the results, as represented in Fig 5, indicated single band of 782 bp of rs2488457 for patients with ITP.

    Fig 5: The outcomes of the specific area amplification of rs2488457 were processed utilising gel electrophoresis of 1.5% agarose stained with Eth.Br.



    Sanger sequencing method were utilized in order to estimate the sequence of each SNP (rs2488457) in PTPN22 gene, as represented in Fig 6.

    Fig 6: Sanger sequencing analysis of PTPN22 gene rs2488457 SNP.



    The comparison of rs2488457 genotype frequencies among acute and chronic individuals with ITP detected no significant variation (p=0.4996). The distribution of genotypes was similar among the two groups, with homozygous wild-type being the most common genotype in both acute (55.6%) and chronic (69.6%) individuals with ITP, followed by heterozygous genotypes (37% in acute and 21.7% in chronic), as represented in Table 3.

    Table 3: Frequency of rs2488457 among acute and chronic with ITP.


     
    Correlation study
     
    The analysis of PTPN22 expression based on rs2488457 genotype detected no significant variations in both acute and chronic individuals with ITP. In acute individuals with ITP, the median PTPN22 expression levels were 2.84 for the wild-type genotype (limited to one value), 0.34 for the homozygous genotype and 0.19 for the heterozygous genotype (p=0.7965). In chronic individuals with ITP, the median PTPN22 expression levels were 0.495 for the wild-type genotype, 0.165 for the homozygous genotype and 0.295 for the heterozygous genotype (p=0.4313), as represented in Table 4.

    Table 4: Correlation between PTPN22 expression and rs2488457 genotype among acute and chronic cases with ITP.



    The correlation analysis in chronic individuals with ITP revealed several significant relationships. Age detected a high negative correlation with BMI (r = -0.72, p<0.0001). ANA levels detected significant high positive correlations with IL-40 (r = 0.63, p<0.05), as represented in Table 5.

    Table 5: Correlations between BMI, age, hematological and serological parameters among acute cases with ITP.



    This study focuses on the role of immunological biomarkers (IL-40) and genetic marker (PTPN22 gene) in incidence of acute and chronic ITP cases.

    Depending these outcomes, the difference in PTPN22 expression of acute and chronic cases was not statistically significant. This contrasts with findings in other autoimmune and inflammatory diseases, where PTPN22 expression tends to be elevated. For instance, (Ruan et al., 2022). reported an upregulation of PTPN22 in immune cells within the aortic tissue of patients with abdominal aortic aneurysm (AAA), suggesting a pro-inflammatory role. Similarly,  (Hassan et al., 2024). observed significantly increased PTPN22 expression in individuals with autoimmune inflammatory diseases (AID), further supporting its involvement in heightened immune response. On the other hand, (Moneim et al., 2023) did not observe a significant difference in PTPN22 mRNA expression between systemic lupus erythematosus (SLE) patients and healthy controls, indicating disease-specific variation in gene regulation. In addition, gene expression of PTPN22 decreased in patients of SLE in compared to healthy controls (HCs)  (Román-Fernández et al.,  2022). Moreover, (Menchaca-Tapia et al., 2023). reported a remarkable 17-fold increase in PTPN22 expression in patients with primary Sjögren’s syndrome (pSS), highlighting a strong association between the gene and glandular autoimmunity. Similarly,  (Ramírez-Pérez et al.,  2019). found that PTPN22 was linked to higher gene expression in rheumatoid arthritis (RA), reinforcing the gene’s role in T-cell regulation and autoimmunity. These findings collectively suggest that PTPN22 may act as a regulatory hub in immune-mediated diseases, with expression levels varying depending on the underlying pathophysiology of each condition. PTPN22 is expressed in most human leukocyte types, including neutrophils, CD4+ T cells, dendritic cells, macrophages, monocytes, NK cells, B cells and CD8+ T cells. Of these cells, PTPN22 has the highest expressions in activated naïve CD4+ and CD8+ T cells, followed by B cells and NK cells, with lower levels in monocytes (Armitage et al., 2021). The PTPN22 gene plays a significant role in immune regulation and is implicated in various diseases, particularly autoimmune disorders. Variants in this gene can lead to altered protein function, which affects T-cell activation and signaling pathways (Brownlie et al., 2024).. This dysregulation can increase susceptibility to autoimmune diseases such as rheumatoid arthritis  (Budlewski et al., 2023) type 1 diabetes  (Newman et al., 2023) and SLE (Ates et al., 2025) where the immune system mistakenly attacks the body’s own tissues.

    This study and (Tian et al., 2022) focus on the association of the PTPN22 gene SNP (rs2488457) with ITP. Tian et al. found that carriers of genotypes of GG were 1.51 times more susceptible to ITP than carriers of CC, with a significant p-value of 0.009. This suggests that while this study observed no difference in genotype frequency, Tian et al. provided evidence of a meaningful association with susceptibility, highlighting a potential inconsistency in findings ( Zhang et al., 2022; Bhat et al., 2024) identified a significant relationship between rs2488457 polymorphisms and uveitis susceptibility, showing that the C allele was associated with increased risk (OR = 1.18, p = 0.029). This contrasts with this study, which reported no significant differences in the distribution of genotypes among both cases with ITP. The study by (Menchaca-Tapia et al., 2023). found no significant differences in genotype frequencies for rs2488457 between primary Sjögren’s syndrome patients and HCs, aligning with the lack of significant findings in this study regarding ITP. This suggests a possible commonality in that both immune disorders may not exhibit strong associations with this particular SNP, indicating a need for further investigation into genetic risk factors for these conditions.

    (Kaymaz et al., 2023) examined the frequency of the G allele in lung sarcoidosis, reporting a G allele frequency of 67%, whereas this study found 8% of ITP patients with the GG genotype. The stark difference in genotype frequencies suggests that the impact of rs2488457 may be disease-specific. This reinforces the notion that genetic susceptibility can vary significantly across different diseases, necessitating a tailored approach to genetic research in immune disorders. (Jiménez-Becerra  et al.,  2024; Ngurthankhumi et al., 2024) reported a range of 36% to 48% for the risk allele PTPN22 rs2488457G in systemic lupus erythematosus. In contrast, this study reported a lower prevalence of the GG genotype in ITP. The variation in allele distribution highlights the complexity of genetic influences on autoimmunity and suggests that while certain SNPs may be implicated in multiple conditions, their prevalence and impact can differ markedly.

    Lu et al., (2022) found no contribution of rs2488457 to chronic spontaneous urticaria susceptibility, echoing the findings of this study regarding ITP. Both studies suggest that rs2488457 may not be a critical risk factor in certain immune-related conditions, prompting further research to identify other genetic variations that could better explain susceptibility. (Bufalo et al., 2021) reported significant associations between the CC genotype of rs3789607 and Graves’ disease susceptibility, contrasting with this study’s focus on rs2488457 and its lack of significant findings in ITP. This highlights the specificity of genetic markers in different autoimmune diseases, suggesting that while some SNPs may be important for one condition, they may not hold the same relevance for another. (Jabeen et al., 2024) demonstrated a notable association between the CT genotype of rs2488457 and type 1 diabetes, with significant odds ratios. This study, however, found no significant differences in genotype frequencies among ITP patients. The differing results suggest that rs2488457 may play a more prominent role in type 1 diabetes than in ITP, emphasizing the need for condition-specific genetic investigations.

    Zhang et al., (2025) found rs2488457 significantly associated with acute lymphoblastic leukemia progression-free survival, highlighting its potential importance in hematological malignancies. In contrast, this study reported no significant associations in ITP, which may indicate that while certain SNPs can influence disease outcomes in cancer, they may not have the same implications in autoimmune disorders like ITP, underscoring the diverse genetic landscape across diseases. (Su et al., 2025). revealed a significant association between rs2476601 and an increased risk of type 1 diabetes, while this study found no significant associations for rs2488457 with ITP. This divergence emphasizes the possibility that different SNPs may have varying impacts on distinct autoimmune diseases, suggesting a complex interplay of genetic factors that warrants further exploration in the context of immune dysregulation.

    CONCLUSION

    As a whole, PA-Ab showed the most diagnostic promise in differentiating between acute and chronic ITP. The similar distribution of genotypes suggests that rs2488457 may not be associated with disease duration or progression from acute to chronic. The lack of significant variations suggests that rs2488457 genotype may not have a substantial impact on PTPN22 expression levels in either acute or chronic individuals with ITP.

    ACKNOWLEDGEMENT

    Everyone who helped with this research, whether they were participants, physicians or guiders, is appreciated. 
     
    Funding
     
    Self-funding.
     
    Ethical clearance
     
    The study proposal, outlining its objectives and methodologies, was submitted for ethical review to the Ethics Committee at the College of Science, University of Baghdad. Ethical clearance was granted under the reference number CSEC/0224/0021, dated 20 February 2024. The study adhered to the consent form guidelines as stipulated by the Iraqi Ministry of Health.

    CONFLICT OF INTEREST

    The authors declare that they have no conflicts of interest.

    REFERENCES


    1. Al-Aqabi, A.S. and Alwan, A.F. (2010). Idiopathic autoimmune thrombocytopenic purpura (ITP) in adult; review of 50 cases admitted to Baghdad teaching hospital. Journal of the Faculty of Medicine Baghdad. 52(2): 167-171.

    2. Al-Naddawi, M., Ibraheem, M.F. and Sharhan, F.J. (2014). Acute immune thrombocytopenic purpura in childhood presentation and treatment a hospital based study. Journal of the Faculty of Medicine Baghdad. 56(3): 249-253.

    3. Abbas, H.K., Saleh, B.O. and Ghali, H.H. (2024). Frequency of 25- Hydroxyvitamin D deficiency in pediatric patients with immune thrombocytopenia: Disease phase and therapy options. Journal of the Faculty of Medicine Baghdad. 66(4): 460-465.

    4. Ahmed, A.H. and Altaee, M.F. (2024). The association of DAZ1 gene deletion with azoospermia in Iraqi Infertile Men. Iraqi Journal of Science. 65(6): 3112-3121.

    5. Al Shami, M.A. and Saud, A.M. (2024). Assessing gene expression of factor XIII-A1 in Iraqi patients with FXIII deficiency. Journal of Bioscience and Applied Research. 10(1): 103-110.

    6. Armitage, L.H., Wallet, M.A., Mathews, C.E. (2021).Influence of PTPN22 allotypes on innate and adaptive immune function in health and disease. Front Immunol. 12: 636618. 

    7. Ates, I., Terzi, U., Suzen, S., Irham, L.M. (2025). An overview on Sjögren’s syndrome and systemic lupus erythematosus’ genetics. Toxicol Res (Camb). 14(1): tfae194. 

    8. Audia, S., Mahévas, M., Nivet, M., Ouandji, S., Bonnotte, B. (2021). Immune thrombocytopenia: Recent advances in pathogenesis and treatments. Hemasphere. 5(6): e574. 

    9. Bhat, S.V., Shynu, M., Divya, P.D., Desai, A.G. and Akhil, G.H. (2024). Molecular markers for metabolic adaptation in dairy cows: SNAI2 gene variations. Asian Journal of Dairy and Food Research. 43(4): 762-765. doi: 10.18805/ajdfr.DR-1763.

    10. Brownlie, R.J., Salmond, R.J. (2024). Regulation of T cell signaling and immune responses by PTPN22. Mol Cell Biol. 44(10): 443-452. 

    11. Budlewski, T., Sarnik, J., Galita, G., Dragan, G., Brzeziñska, O., Pop³awska, M., et al. (2023). SNP in PTPN22, PADI4 and STAT4 but Not TRAF1 and CD40 increase the risk of rheumatoid arthritis in polish population. Int J Mol Sci. 24(8): 7586. 

    12. Bufalo, N.E., Dos Santos, R.B., Rocha, A.G., Teodoro, L., Romaldini, J.H., Ward, L.S. (2021). Polymorphisms of the genes CTLA4, PTPN22, CD40 and PPARG and their roles in Graves’ disease: susceptibility and clinical features. Endocrine. 71: 104-112. 

    13. Bussel, J., Cooper, N., Boccia, R., Zaja, F., Newland, A. (2021). Immune thrombocytopenia. Expert Rev Hematol. 14(11): 1013-25. 

    14. Elsaid, D.S., Elhamid Elbedewy, T.A., Soliman, N.A., Shalaby, K.A., Abdel-Hamid, Haroun, R. (2022).  Interleukin-37, vascular endothelial growth factor A and transforming growth factor-â1: Promising biomarkers in primary immune thrombocytopenia. Expert Rev Hematol. 15(8): 757-768. 

    15. Hassan, M.A., Agban, M.N., Elkhawaga, A.A. (2024). Correlation between IL-17, TGF-â and PTPN-22 Levels and Covid- 19 severity in patients with and without autoimmune diseases. Egypt J. Med Microbiol. 33(2). 

    16. Jabeen, A., Riaz, S., Usman, M., Parveen, A., Mukhtar, M., Wajid, A. et al. (2024). Association of polymorphism of NLRP3, ICAM-1, PTPN22, INS genes in childhood onset type 1 diabetes in a Pakistani population. Mol Biol Rep. 51(1): 1070. 

    17. Jiménez-Becerra, E.D., Ramírez-Bello, J., Nakazawa-Ueji, Y.E., González-Herrera, L.J., Rubi-Castellanos, R., Barbosa- Cobos, R.E. et al. (2024). PTPN22 rs2488457C> G and TRAF1-C5 rs10818488A> G and rs3761847G> A variants in mexican mestizo women with systemic lupus erythematosus. Med Res Arch. 12(6). 

    18. Kaymaz, S., Kavas, M., Demiray, A., Karasu, U., Çobankara, V., Boğa, S. (2023). Investigation of the relationship between Ptpn22 polymorphisms and lung sarcoidosis: A Cross Sectional Study. Rheumatology (Bulgaria). 

    19. Livak, K.J., Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2- ΔΔCT method. Methods. 25(4): 402-408. 

    20. Lu, N., Tan, X., Liu, X., Niu, L., Yao, S., Lu, B. (2022). Lack evidence of association of PTPN 22 and CTLA 4 polymorphisms with risk of chronic spontaneous urticaria in Han Chinese population. J. Cosmet Dermatol. 21(3): 1326-1327. 

    21. Lubis, I., Junaedi, A. and Sopandie, D. (2024). The role of net assimilation rate and nitrogen management in optimizing rice (Oryza sativa L.) yield. Indian Journal of Agricultural Research. 58(4): 627-633. doi: 10.18805/IJARe.AF-813.

    22. Menchaca-Tapia, P.A., Marín-Rosales, M., Salazar-Camarena, D.C., Cruz, A. Oregon-Romero, E., Tapia-Llanos, R. et al. (2023).  Analysis of PTPN22-1123 G> C,+ 788 G> A and+ 1858 C> T polymorphisms in patients with primary sjögren’s syndrome. Diagnostics. 13(5): 899. 

    23. Mititelu, A., Onisâi, M.C., Ro’ca, A., Vlãdãreanu, A.M. (2024). Current understanding of immune thrombocytopenia: A review of pathogenesis and treatment options. Int J. Mol Sci. 25(4): 2163. 

    24. Moneim, N.H.A., Hosny, M.M., Omar, H.H., Abdelnaby, M.M., Fouad, M.M., Abd El-Waheed, W.O. et al. (2023).  Relative CTLA-4, PTPN-22 and interleukin 37 mRNA expressions in patients with lupus nephritis. Reumatol Clin. 19(4): 180-187. 

    25. Newman, J.R.B., Concannon, P., Ge, Y. (2023). UBASH3A interacts with PTPN22 to regulate IL2 expression and risk for type 1 diabetes. Int J. Mol Sci. 24(10): 8671. 

    26. Ngurthankhumi, R., Hazarika, T.K., Lalruatsangi, E., Lalhmachhuani, H. and Debbarma, P. (2024). Anticancer screening of few wild edible fruits in Mizoram, Northeast India using MTT Assay. Indian Journal of Agricultural Research. 58 special issue: 1042-1047. doi: 10.18805/IJARe.A-6249.  

    27. Ramírez-Pérez, S., Sánchez-Zuno, G.A., Chavarría-Buenrostro, L.E., Montoya-Buelna, M., Reyes-Pérez, I.V., Ramírez- Dueñas, M.G. et al. (2019). PTPN22+ 788 G> A (R263Q) polymorphism is associated with mRNA expression but it is not a susceptibility marker for rheumatoid arthritis patients from Western Mexico. Biochem Genet. 57: 455-465. 

    28. Román-Fernández, I.V., Machado-Contreras, J.R., Muñoz-Valle, J.F., Cruz, A., Salazar-Camarena, D.C., Palafox-Sánchez, C.A. (2022). Altered Ptpn22 and Il10 mrna expression is associated with disease activity and renal involvement in systemic lupus erythematosus. Diagnostics. 12(11): 2859. 

    29. Ruan, P., Gao, L., Jiang, H., Chu, T., Ge, J., Kong, X. (2022).  Identification of PTPN22 as a potential genetic biomarker for abdominal aortic aneurysm. Front Cardiovasc Med. 9: 1061771. 

    30. Su, Y., Li, X., Wu, P. dong, Zhang, Y. long, Fang, P. fei, Wu, F. fei, et al. (2025). The Association between PTPN22 SNPs and susceptibility to type 1 diabetes: An updated meta- analysis. PLoS One. 20(4): e0321624.

    31. Tian, H., Xu, W., Wen, L., Tang, L., Zhang, X., Song, T., et al. (2022). Association of PTPN22 SNP1858 (rs2476601) and gene SNP1123 (rs2488457) polymorphism with primary immune thrombocytopenia susceptibility: A meta-analysis of case-control studies and trial sequential analysis. Front Genet. 13: 893669. 

    32. Zakaria, M., Beshir, M., Hassan, T., Esh, A., Abdelaziz, E., Tayib, R. et al. (2023). Role of interleukin 4 (IL4) and interleukin 6 (IL6) in the pathogenesis and prognosis of childhood primary immune thrombocytopenia. Eur J. Pediatr. 182(7): 3129-3138. 

    33. Zhan, Y., Cheng, L., Wu, B., Ji, L., Chen, P., Li, F. et al. (2021).  Interleukin (IL)-1 family cytokines could differentiate primary immune thrombocytopenia from systemic lupus erythematosus-associated thrombocytopenia. Ann Transl Med. 9(3): 222. 

    34. Zhang, A., Liu, W., Can, C., Guo, X., Jia, H., Wei, Y. et al. (2025). Immune-related genetic single-nucleotide polymorphisms contribute to prognosis and response to chemotherapy in patients with acute lymphoblastic leukemia. Inflammation Research. 74(1): 1-16. 

    35. Zhang, J., Zhou, P., Hu, S., Qi, J. (2022). Meta-analysis of the genetic association between PTPN22 and CTLA-4 Variants and Risk of Uveitis. Ophthalmic Research. 65: 264-275.
    In this Article
      Contact us
      Follow us
      Published In
      Asian Journal of Dairy and Food Research

      Editorial Board

      View all (0)