Identification of β Casein Genotypes in Indian Gir and Crossbred Exotic Cows from Mumbai Dairy Farms

Milk is a natural food that provides complete nutrition for the growth and care of human body. It is a rich source of first class proteins as well as other nutritional elements for vegetarians and non-vegetarians. Presence of immunoglobulins, cytokines, growth factors, hormones, multiple vitamins and trace elements makes it an essential part of human nourishment (Godse et al., 2017). In last few years reports on adverse effects of milk such as milk allergy, lactose intolerance and risk of diabetes and cardiovascular diseases have generated confusion about milk consumption even for babies (Lamb et al., 2015). Cow milk containing A1 β casein and its association with various health complications has increased the confusion even more.
       
In last two decades, β-casein polymorphism has acknowledged substantial research interest in animal breeding and dairy industry. A1 and B variants of β-casein are sources of exogenous bioactive peptides, considered to be a risk factor for a spectrum of diseases (Elliot et al., 1999, McLachlan 2001). This association has engrossed the interest of dairy scientist and industry in evaluation of β casein genotype distribution.
       
β-casein is one of the vital proteins present in bovine milk. The β casein gene is known as a highly polymorphic gene. Up till now 12 β casein variants have been identified viz. A1, A2, A3, B, C, D, E, F, H1, H2, I and G (Kaminiski et al., 2007). Among these variants, A1 and A2 forms are most common in dairy cattle followed by B (Farrell et al., 2004). A1 β casein was derived from single point mutation that occurred in A2-β casein gene in European-origin cattle (Pal et al., 2015). This mutation changes β-casein reading frame, from CCT to CAT which causes replacement of proline with histidine at 67^th position of amino acid chain (Ng-Kwai-Hang and Grosclaude 2002). Isoleucine (at 66^th position) and histidine peptide bond (A1 and B β casein) is more susceptible to proteolytic enzymes as compared to isoleucine and proline bond (A2 β casein). Due to this secondary conformational change, proteolytic digestion of A1 β casein releases β-casomorphin (BCM-7) in the intestine (Kaminski et al., 2007).
       
BCM-7 is a heptapeptide (H-Tyr-Pro-Phe-Pro-Gly-Pro-Ile-OH) which is the most studied β-casomorphin. Presence of three proline residues makes it highly resistant to enzymatic degradation. These proline residues provide a distinctive low energy conformation, structurally similar to morphines (Trivedi et al., 2014, Kumar et al., 2020). Also N-terminal tyrosine residue of BCM-7 increases its affinity to opioid receptors. Activation of opioid receptors of immune, nervous and endocrine system causes various health implications such as ischemic heart disease, sudden infant death syndrome, schizophrenia, autism, type 1 diabetes and milk intolerance (Kamiñski et al., 2006, Caroli et al., 2009).
       
These considerations have evolved an argument about A1 and A2 milk types in the dairy industry for over two decades. Various methods have been developed to evaluate β casein polymorphism in cows viz. DNA amplification (PCR-RFLP, allele specific-PCR; multiplex-PCR), microarray based methods, sequencing etc. Although the hypothesis of correlation between consumption of A1 milk and risk of several diseases requires further research, many European countries have started screening and accordingly crossbreeding of cows.
       
All Indian zebu cattle harbor A2 β casein, however crossbreeding with exotic breeds for genetic improvement has introduced A1 allele in Indian cows. As per the 19^th livestock census report, (2012) Indian milch cattle population was 67.54 million, where indigenous milch cattle are 48.12 million and exotic milch cattle are 19.42 million. There was an increase of 0.17% in the population of indigenous milch cattle over the previous census (2007) whereas the exotic/crossbred milch cattle are increased by 34.78%. Further in 2019 exotic milch cattle have become 26.08 million with an increase of 34.3% and indigenous milch cattle are 46.57 million with a marginal increase of 0.8%. In this scenario preferring A2 herds and shifting the frequency of breeds towards A2 becomes difficult.
       
In this study we have analyzed cows for β casein polymorphism from three local dairy farms in Mumbai. These farms are located in the middle of the city allowing limited free movement and tracking of cows. This also facilitated to study their feeding and milking routine in the farm. This is the first report of the status of β casein polymorphism in cow from a metropolitan city of India. We are also first to report the β casein genotype of a pure Gir herd in India.

We collected samples from 95 cows from 3 dairy farms during the period of 2017 and 2019. These farms are maintained by Bombay Gowrakshak Trust. The milk of these farms is supplied in dairies as well as donated in the orphanages. In these farms cows are well taken care for their health. There were total 56 pure Gir, 20 crossbred Holstein Friesian and 19 crossbred Jersey cows. Only milking cows were randomly selected for blood collection and their details were recorded. Pedigree details of these animals were provided by the farm management. Blood samples were collected from 95 cows and 10 hair samples and 10 milks samples were also collected from these cows for method standardization and comparison.
       
About 5 ml of blood was collected aseptically from each animal from jugular vein in an EDTA tube. The blood samples were immediately transported under cold condition to our laboratory at Kasturba Health Society and Medical Research Centre, Vile Parle. The samples were stored at 4°C and processed within 24 hrs. Bovine genomic DNA was isolated from cow blood by proteinase K enzymatic digestion and phenol chloroform precipitation (Sambrook et al., 1989). DNA extraction from hair samples was carried out using the protocol described previously (Kumar et al., 2005).  Genomic DNA extraction method described by De et al., (2000) was employed for raw milk samples. The DNA samples were analyzed for purity and stored at -20°C till further processing. The samples were genotyped for β casein gene using PCR-RFLP method.
       
The 251 base pair fragment of exon 7 at CSN2 gene was amplified by the primers reported previously (Lien et al., 1992). Polymerase chain reaction was performed using a total reaction volume of 25 μl containing 50ng of genomic DNA, 100 μM dNTPs, 10 pmol of each primer, 2.5 mM MgCl₂ and 1.5 U Taq DNA polymerase. Thermal cycling conditions were programmed at 95°C for 5 min, followed by 30 cycles at 94°C for 30 sec, 63°C for 40 sec and 72°C for 20 seconds. Final extension was performed at 72°C for 3 min. The amplified product of 251 base pairs (bp) was digested with 0.5U Taq I restriction enzyme at 65°C for 4 hours. The digested fragments were resolved on 3% agarose gels in 1× TAE buffer. The genotypes of samples were recorded according to the size of digested fragment.
 
Primers used for PCR
 
CASB67R
 
5'CCTGCAGAATTCTAGTCTATCCCTTCCCTGGGCCC ATCG'
 
CASB122L
 
5'GAGTCGACTGCAGATTTTCAACATCAGTGAGAGTCAGGCCCTG3

Beta casein genotype analysis in 3 cattle populations was investigated. 95 cows from 3 farms were included in this analysis. They were kept in the same herd and fed with a standard diet. None of the selected cows showed any clinical symptoms of mastitis or any other illness.
       
Genetic characterization of exon 7 of CSN2 gene was carried out by PCR-RFLP method. Different genotypes showing representative banding patterns observed on gel are shown in Fig 1. The heterozygous A1A2 pattern had 251 bp, 213 bp and 38 bp and A2A2 pattern had fragments of 251 bp.
 

       
All pure Gir cows had A2A2 β casein genotype. In crossbred Jersey cows A2  (frequency: 0.605) was the most common allelic variant of β casein followed by A1 (frequency: 0.394). The heterozygous β casein genotype A1A2 was the most frequent in this group (frequency: 0.473), followed by A2A2 (frequency: 0.368) and A1A1 (frequency: 0.158). Crossbred Holstein Frisian cows also had A2 as the most common allelic variant (frequency: 0.633) followed by A1 (frequency: 0.366). Maximum cows had heterozygous genotype A1A2 (frequency: 0.6), followed by A2A2 (frequency: 0.333) and A1A1 (frequency: 0.066) genotypes (Table 1).
 

       
The data indicates that pure indigenous cows have A2A2 as a fixed β casein genotype. Whereas greater proportion of A2 allele in crossbred Jersey and crossbred Holstein cows was observed; although among these crossbred cows 93% cows had 50% inheritance from indigenous breed and 7% cows had 38% inheritance from indigenous breed.
       
The present study concurs with the results of Mishra et al., (2009) where they have reported the status of β casein genotype in 15 indigenous cow breeds from all over the India. According to their report, the entire indigenous cow breeds lack A1 β casein allele except two breeds with low frequency. Further, the same group has reported β casein genotype in Holstein Frisian, Jersey and crossbred cows (Sodhi et al., 2012). The mean allelic distribution of A2 and A1 β casein was 0.645 and 0.355 respectively. This data also corresponds to our results of crossbred Jersey and Holstein Frisian cows’ genotype analysis. Rupasinghe et al., (2020) also reported higher frequency of A1 beta casein (0.47) in Holstein Friesian cattle in Sri Lanka as compared to their native cattle breed.
       
In another report by Ganguly et al., (2013) one more native cow breed Ongole was analyzed for β casein genotype. In these cows allelic frequency of A2 and A1 β casein were 0.94 and 0.06 respectively. Ramesha et al., (2016) have analyzed β casein genotypes of indigenous breeds Khillar, Deoni, Malnad Gidda and Kasargod cattles. Among these Khillar and Deoni breeds had fixed A2 allele whereas Malnad Gidda and Kasargod cattles had A1 allelic frequency as 0.014 and 0.042 respectively.
       
Evidently the indigenous cow breeds are gradually drifting towards A1 β casein type due to crossbreeding with exotic cows (Raja et al., 2021, Kumar et al., 2019). The study with native cow breeds was reported a decade ago where there were two native cow breeds had A1A2 variant of β casein gene (Mishra et al., 2009). It is possible that in this decade drastically increasing population of crossbred and exotic cows may have incorporated A1 allele in other native breeds as well.
       
In India, existence of large populations of exotic and crossbred cattle with higher frequencies of the A1 β casein allele, make it necessary to take effective measures to preserve existing A2-predominant gene pool of native cattle. Standard procedures for genotype screening and certification methods for A2 milk are essential to disseminate possible undesirable effects of A1 β casein (Cielinska et al., 2019). Systemic monitoring for β casein genotype along with milk production enhancement would be the effective approach to be on the safer side until the A1/A2 beta casein controversy is resolved. Further if the adverse effects of A1 β casein are validated, India will have a great opportunity in global A2 milk industry; wherein A2 allele is predominant in native cattle.
       
Our study demonstrated, Gir which is a native Indian breed has fixed A2A2 β casein variant whereas crossbred Jersey and Holstein Frisian have A1A2 as a most common genotype. Although the link between A1 β casein and associated health risks is not well established it is better to take precautionary actions in crossbreeding of cattle. According to the research carried out at National Dairy Research Institute, Karnal, screening of cattle for β casein genotypes is vital to monitor the frequency of A1 beta casein in native Indian cow breeds (Shashank et al., 2018). Finally resolution of the A1/A2 β casein problem is crucial for human health as well as preservation of native Indian cows.

We are grateful to Bombay Gow Rakshak Trust, Mumbai for supporting the research project.