Background: Mitochondria are organelles called power plants of the cell, which are found in eukaryotic cells and are responsible for the production of energy needed by the cells through aerobic respiration. Mitochondrial dysfunction causes endocrinological, cardiovascular, metabolic and neurodegenerative diseases. The aim of this study was to examine the effects of body condition score (BCS), lactation, pregnancy, age and gender on Mitochondrial-Derived Peptide (MOTS-c) and Brain Mitochondrial Transporter Protein 1 (BMCP1) levels in Akkaraman sheep. 
 
Methods: Sheep are classified into 3 categories according to BCS (BCS&lt;2, BCS=3-3.5, BCS&ge;4). In creating groups in terms of BCS, it was determined by the palpation method applied to the waist area. The sheep included in the study were divided into 4 groups: early lactation, early pregnancy, late pregnancy (dry period) and age (female and male sheep).1st group, ewes in the first period of pregnancy (on the 100th day of the first pregnancy) (n = 30), 2nd group, ewes in the early lactation period (n = 30), 3rd group, ewes in the dry period (the last two months of pregnancy) (n = 30) and in the 4th group, &lt;2 (young) (n=30), 2-8 (adult) (n=30), 8&gt; (old) (n=30), male and female sheep (n=30) of different ages. =180) total of 270 animals. Blood samples were taken from the jugular vein of the sheep before the morning feeding. MOTSc and BMCP1 levels were determined in blood serum samples by ELISA method. 
 
Result: In the study, serum MOTS-c and BMCP1 levels in sheep during lactation and pregnancy were determined to be lowest in the VKS&lt;2 group and highest in the VKS&ge;4 groups. Likewise, in age and gender groups, the highest level was detected in young lambs and yearlings in the VKS&lt;2 group, while the highest level was detected in old sheep and rams in the VKS&ge;4 group. As a result, it was determined that different age, gender, pregnancy and lactation periods affected serum MOTS-c and BMCP1 levels depending on the change in BCS (P&lt;0.05). It was concluded that MOTS-c and BMCP1 may be useful parameters in the evaluation of mitochondrial function, energy metabolism and metabolic profile.

The Relationship of Mitochondrial-derived Peptide (MOTS-c) and Brain Mitochondrial Carrier Protein 1 (BMCP1) Response in Sheep with Some Physiological Parameters

<div>Pulses assume special significance in the cropping systems and daily diets in India. Traditionally pulses are used for human consumption as dehusked seed splits after minimal processing. They are also the important ingredient of popular Indian snacks. The present paper reviews the research studies done on various components of value chain of pulses and draws upon the learnings. The value chains of pulses in India are long and complexed with a number of actors performing specific roles. The input providers, farmers, aggregators, wholesaler, commission agents, retailers, processors, millers, consumers, financial institutions, ware houses, researchers and policy makers together work to build the pulses value chains in India.</div>

Pulse Value Chains in India- Challenges and Prospects: A Review

<div>Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources.&nbsp; 
 
Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. 
 
Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3&rsquo; end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.</div>

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

<div>Bovine Respiratory diseases are responsible for economic losses in livestock industry worldwide. The present study aiming to investigate the occurrence of respiratory viral antigens of Bovine herpesvirus-1 (BoHV-1), Bovine respiratory syncytial virus (BRSV), Bovine viral diarrhoea virus (BVDV) and Bovine parainfluenza 3 virus (BPI3V) in bovines and describe the distribution of respiratory viruses in unvaccinated animals in Punjab. A total of 55 nasal swab samples were collected from the cattle and buffaloes exhibiting the clinical signs of respiratory disease. All samples were tested for the detection of all four viral antigens by commercially available sandwich ELISA kit. BoHV-1 and BPI3V antigen were detected in 1 and 3 samples with the percentage of 1.8 and 5.4, respectively, whereas none of the sample was found positive for BRSV and BVDV antigen. The present study concluded the existence of BoHV-1 and BPI3V infection in respiratory tract and plays the important role in the respiratory viral infections of bovines. This study suggests the prevention measures should be taken to control the economic losses due to respiratory diseases in cattle and buffaloes.</div>

Detection of Respiratory Viral Antigens in Nasal Swabs of Bovine by Sandwich ELISA

Background: Broiler production is crucial for global food security as a high-quality protein source. However, climate change causes extreme temperature fluctuations, including severe cold stress. Sudden ambient temperature drops impair broiler growth and health. This study investigates how continuously decreasing ambient temperature affects oxidative stress and mitochondrial activity in broiler blood cells. 
 
Methods: Blood cells pooled from two broiler chickens were diluted and subjected to a gradual temperature reduction from 42oC to 0oC, with 3oC decrements at each step. Mitochondrial activity, malondialdehyde (MDA), total antioxidant capacity (TAC), hydrogen peroxide (H2O2), reduced glutathione (GSH), catalase activity and nitric oxide (NO) levels were subsequently measured. 
 
Result: Mitochondrial activity and NO levels showed significant quadratic trends (P&lt;0.05), increasing at moderate cold before declining at lower temperatures. From 42oC to 21oC, mitochondrial activity rose significantly at 39-33oC and 21oC (P&lt;0.05), while MDA levels increased at 39-27oC and 21oC (P&lt;0.05). TAC declined significantly from 42oC to colder points (P&lt;0.05). Between 18oC and 0oC, mitochondrial activity and NO fluctuated, suggesting an adaptive response. Conversely, H2O2, GSH and catalase levels remained stable across all temperatures (P&gt;0.05). These findings highlight a complex cellular response to cold stress, emphasizing the need for proper cold stress management in broiler production.

Evaluating Oxidative Stress, Nitric Oxide Production and Mitochondrial Activity Trend in Broiler Blood Cells under Progressive Cold Stress

Background: Animal body color was crucial for genetics and evolution, among which albinism was the result of genetic mutations and there were multiple genetic mechanisms that impede melanin synthesis, thereby affecting animal survival. Studying the phenomenon of albinism could help deepen our understanding of the secrets of genetic and species adaptive evolution. 
 
Methods: This study utilized high-throughput sequencing technology and bioinformatics analysis to investigate the mitochondrial genome of the albino Eothenomys eleusis Thomas 1911. The aim was to reveal its structural or compositional characteristics, phylogenetic locationand evolutionary rate. 
 
Result: The characteristic results indicated that the genome sequence (16,347 bp) contained 37 genes and a control region, with a few genes in the &ldquo;-&rdquo; chain and most genes in the &ldquo;+&rdquo; chain. The base composition and skewness of the whole genome exhibited a significant AT preference. Except for nad1 started with GTG and nad1, cox3 and nad4 ended with T (AA), most of the 13 PCGs followed standard genetic code rules. The most commonly used codons were CUA, AUCand AUA, while the relatively commonly used amino acids were Leu1, Ile and Thr. Numerous U-G mismatches were observed in the secondary structure of tRNAs. Phylogenetic analysis confirmed that albino E. eleusis was closely related to normal E. eleusisand Eothenomys was a monophyletic group. Evolutionary rate analysis suggested that atp8 and nd4l had higher dN/dS mean values, while cox1 and cox2 were the opposite. In conclusion, this study not only revealed for the first time the mitochondrial genome characteristics and phylogenetic relationships of albino E. eleusis, but also provided a new scientific basis and reference direction for the genetic characteristics, diversity and adaptive evolution of Eothenomys and other albino species.

A Rare Mitochondrial Genome of Albino Eothenomys eleusis Thomas 1911 (Cricetidae: Arvicolinae) from Southeastern Yunnan, China and its phylogenetic Analysis

<div>Background: Dairy sector has highly fragmented supply base and unique ecosystem of delivery resulting that a chain of value addition actors involved in its production and distribution. Value chain financing approach provides opportunities to develop equitable business models that better link all actors in the value chain. Accordingly, this study has carried out to assess the diversity of financial arrangements and the actors involved in dairy value chain in the Eastern Uttar Pradesh. The study also brings about the relatively prominent components/actors of the dairy value chain that could be emphasised while financing dairy value chain.&nbsp; 
 
Method: The value chain actors including milk producers have identified purposively and interviewed with well-constructed scheduled. The study has analysed on the data collected from 64 milk producers in 8 villages, 3 inputs suppliers, 8 milk collectors/assemblers, 4 milk transporters, 1 milk processor and 12 distributers for the year 2019-20.&nbsp; 
 
Result: The study observed that there is vast network of financing institutions have engaged in the financing of dairy value chain in the study area. Financing agencies have identified the set of activities associated with milk value chain and determine the structure of finance accordingly, in order to minimize costs, to maximize efficiency and to reduce risk. However, there are several informal mechanism of value chain financings also existed parallel to institutional finance due to informal sources are willing to lend money more easily without collateral. Relationships between actors in the value chain facilitate informal financial flows directly to his client actors is also observed in the study. The study has further inferred that among all the actors involved in milk value chains, the processor, producer and distributer have added greater value addition in comparison to other actors in the value chain.&nbsp;</div>

<div>Value Chain Finance to Dairy Sector-A Case Study of Eastern Uttar Pradesh</div>

<div>Respiratory affections are common in dogs. Very young and older dogs are at greater risk as compared to the adult ones. Constant exposure of the respiratory tract to the infectious agents, reaching the upper and lower respiratory tract aerogenously or hematogenously, makes the respiratory system vulnerable to injury. Clinical signs mainly seen in upper respiratory tract diseases involves nasal discharge (serous, mucopurulent or hemorrhagic), sneezing, facial deformity, stertor, lethargy, inappetence and rarely, central nervous system signs whereas additional signs present in lower tract diseases range from dyspnoea, costal or abdominal respiration, cough, nasal discharge and congestion, edema, consolidation of lungs and weight loss. Advanced tests involved in diagnosis of respiratory problems in veterinary practicpe are rhinoscopy, bronchoscopy, transthoracic fine needle aspiration cytology (FNAC) transtracheal wash and bronchoalveolar lavage fluid cytology and culture. This review discusses the causes of upper and lower respiratory tract disorders of canines and various diagnostic tests involved in their diagnosis.</div>

Respiratory Diseases and Their Diagnosis in Dogs: A Review

Background: Bangana dero is a cyprinid fish species that is classified under the subfamily Labeoninae. It occurs in the streams of China, India and Nepal near the foot of the Himalayan range. B. dero&rsquo;s whole mitochondrial genome has been sequenced and annotated. In this work, the tRNAs, protein-coding genes have been characterized and analyzed the phylogenetic relation of this fish with other cyprinid species. 
 
Methods: Nanopore sequencing was utilized to determine the entire mitochondrial genome of B. dero. Utilizing NEBNext Ultra DNA Library Prep Kit, end-repair was performed on the isolated DNA using the. Barcoding adapter ligation (BCA) and cleaned. Sequencing was done. All the long read bases were trimmed based on lowest base quality score, Q&lt;9. Barcode and adapters sequences were also trimmed using a porechop programme and the statistical graph illustrations were generated and genome assembly was done using Canu1.5. 
 
Result: The mitogenome is 16613 bp and contains 13 protein-coding genes, 2 rRNA genes,&nbsp; 22 tRNA genes, as well as a non-coding region. The nucleotide makeup is A=32.5%, T=25.21%, C=26.51% and G=15.77%, G + C = 42.28% and A+T=57.71%. The clover-leaf secondary structure was found in all tRNAs except tRNA-Ser2, which has no dihydrouridine arm. For 12 out of 13 protein-coding genes, the initiation codon was ATG, but COI used GTG. Methionine and tryptophan are unique among amino acids as they are each encoded by a single codon. Origin of light chain replication (OL) could fold into a hairpin secondary structure and carried a sequence 5&#39;-GGCGG-3&#39; in its stem. A long intergenic spacer of 46 bp was observed between tRNA-Leu1 and ND1. In the phylogenetic study, B. dero clustered closely with the Bangana species (AP013327) and Labeo boggut (NC_029450), a grouping supported by a bootstrap value of 100. This is the first study on the entire mitochondrial DNA analysis of B. dero.

&nbsp;

The Complete Mitochondrial Genome of Bangana dero (Cyprinidae: labeoninae) and its Relationship with Other Labeonin Fishes

<div style="text-align:justify">Background: We aimed to elucidate the mechanism of change in mitochondrial fusion- and fission-related mediators for maintaining cell function through the effects of acupuncture treatment and apply findings to a liver disease model. We focused on the optic atrophy-1 (OPA1) and fission protein 1 (Fis1) genes of rat liver cells.&nbsp; 
 
Methods: Sprague Dawley rats were divided into a control group (no treatment) and LR2, LR3, LR4 and LR8 groups (acupuncture treatment to those points). Acupuncture was performed on each point for 10 minutes once daily for 4 days. Changes in the mRNA expression of Peroxisome proliferator-activated receptor-gamma coactivator 1-&alpha; (PGC-1&alpha;) and Fis1 were observed via quantitative real-time polymerase chain reaction (qRT-PCR); changes in OPA1, mitofusin-2 (MFN2), mitofusin-1 (MFN1), dynamin-related protein 1 (DRP1) and adenosine monophosphate-activated protein kinase (AMPK) proteins were observed through western blotting and endothelial nitric oxide synthase (eNOS) and neuronal nitric oxide synthase (nNOS) expressions were observed through immunohistochemistry. 
 
Result: OPA1 decreased in the LR3 and LR8 groups and Fis1 increased in the LR2 and LR4 groups. AMPK and PGC-1&alpha; decreased significantly in all acupuncture groups. eNOS and nNOS expression reduced in all acupuncture groups. Therefore, acupuncture can regulate mitochondrial fusion/fission by influencing the following mediators: AMPK, PGC-1&alpha;, OPA1, Fis1, eNOS and nNOS.</div>