Loading...

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

DOI: 10.18805/IJAR.B-1394    | Article Id: B-1394 | Page : 1430-1438
Citation :- A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes.Indian Journal of Animal Research.2021.(55):1430-1438
Handong Wang, Ye Chen, Wei Shi, Yongyao Guo, Jinghong He, Zhangjie Chu, Bo Zhao 648047299@qq.com
Address : College of Fisheries, Zhejiang Ocean University, No. 1, Haida South Road, Lincheng Street, Zhoushan, Zhejiang Province, China.
Submitted Date : 31-05-2021
Accepted Date : 26-10-2021

Abstract

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. 
Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa.
Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

Keywords

Control region Geoemyda spengleri Mitochondrial genome Phylogenetic relationships

References

  1. Bramble, D.M. (1974). Emydid shell kinesis: Biomechanics and evolution. Copeia. 3: 707-727.
  2. Das, S., Das, P.J., Das, P.P., Das, B. and Bhattacharya, T.K. (2018). Mitochondrial DNA variation, phylogeography and social organization of Asian elephant (Elephas maximus) of north east India. Indian Journal of Animal Research. 53: 1121-1128.
  3. Debraga, M. and Rieppel, O. (2010). Reptile phylogeny and the interrelationships of turtles. Zoological Journal of the Linnean Society. 120: 281-354.
  4. Ernst, C. H. and Barbour, R.W. (1989). Snakes of Eastern North America. Copeia. 1990: 253.
  5. Gaffney, E.S., Meylan, P.A. and Wyss, A.R. (1991). A computer assisted analysis of the relationships of the higher categories of turtles. Cladistics. 7: 313-335.
  6. Gaffney, E.S. and Meylan, Pa. (1988). A phylogeny of turtles. The phylogeny and classification of the tetrapods. International Symposium. pp: 157-219.
  7. Gauthier, J., Kluge, A.G. and Rowe, T. (1988). Amniote phylogeny and the importance of fossils. Cladistics. 4: 105.
  8. Guangxin, E., Huang, Y.F., Zhao, Y.J., Na, R.S. and Qiu, X.Y. (2015). Comparative analysis the variability of a complete mitochondrial genome of polledness intersexual goat (PIS- -) from china. Indian Journal of Animal Research. 49(6): 761-763.
  9. Haiduk, M.W. and Bickham, J.W. (1982). Chromosomal homologies and evolution of testudinoid turtles with emphasis on the systematic placement of platysternon. Copeia. pp 60-66.
  10. Hedges, S.B. and Poling, L.L. (1999). A molecular phylogeny of reptiles. Science. 283: 998-1001.
  11. Hirayama, R. (1984). Cladistic analysis of batagurine turtles (Batagurinae: Emydidae: testudinoidea); A preliminary result. Studia Geologica Salamanticensia. 1.
  12. Honda, M., Yasukawa, Y., Hirayama, R. and Ota, H. (2002). Phylogenetic relationships of the Asian box turtles of the genus Cuora sensu lato (Reptilia: Bataguridae) inferred from mitochondrial DNA sequences. Zool. Sci. 19: 1305- 1312.
  13. Iverson, J.B. (1992). Correlates of reproductive output in turtles (Order Testudines). Herpetological Monographs. 6: 25-42.
  14. Lee, D.J. and Kim, I.C. (2019). The new freshwater crab belongs to the genus geothelphusa as inferred from mitochondrial and nuclear DNA markers. Indian Journal of Animal Research. 54: 424-429.
  15. Parham, J.F., Feldman, C.R. and Boore, J.L. (2006). The complete mitochondrial genome of the enigmatic bigheaded turtle (Platysternon): Description of unusual genomic features and the reconciliation of phylogenetic hypotheses based on mitochondrial and nuclear DNA. BMC Evol. Biol. 6: 11.
  16. Sambrook, J., Russell, D., Maccallum, P. and Russell, D. (2001). Molecular Cloning: A Laboratory Manual, 3rd edition. Immunology. 49: 895-909.
  17. Shaffer, H.B., Meylan, P. and McKnight, M.L. (1997). Tests of turtles phylogeny: Molecular, morphological and paleontological approaches. Syst. Biol. 46: 235-268.
  18. Whetstone, K.N. (1978). Additional record of the fossil snapping turtle Macroclemys schmidti from the marsland formation (Miocene) of Nebraska with notes on interspecific skull variation within the genus Macroclemys. Copeia. 1978: 159-162. 
  19. Wu, P., Zhou, K.Y. and Yang, Q. (2004). Sequence analysis and phylogeny of 12S rRNA gene fragments in Asian freshwater and terrestrial turtles. Acta Zoologica Sinica. 45: 260-267.
  20. Zhang, Y., Nie, L.W. and Song, J.L. (2007). Sequencing and analysis of the complete mitochondrial genome of the Burmese tortoises. Acta Zoologica Sinica. 53: 153-160.
  21. Zhou, T. (2004). Classified Atlas of Turtles and Turtles. Agriculture Press.

Global Footprints