volume 60 issue 4 (april 2026) : 577-585,   Doi: 10.18805/IJAR.B-5723

Baseline Morpho-molecular Insights Into Indigenous Ornamental Fish Zebra Loach, Botia striata from Koyna River, Western Ghats, India

V
Vikas Kumar Ujjania1
P
Paramita Banerjee Sawant1,*
S
Sukham Munilkumar1
G
Gouranga Biswas4
A
A.K. Jaiswar2
K
Kiran D. Rasal3
D
Debajit Sarma1
1Aquaculture Division, ICAR-Central Institute of Fisheries Education, Mumbai-400 061, Maharashtra, India.
2Fisheries Resources, Harvest and Post Harvest Management Division, ICAR-Central Institute of Fisheries Education, Mumbai- 400 061, Maharashtra, India.
3Fish Genetics and Biotechnology Division, ICAR-Central Institute of Fisheries Education, Mumbai-400 061, Maharashtra, India.
4ICAR- Central Institute of Fisheries Education (Kolkata Centre), Kolkata-700 091, West Bengal, India.
Cite article:- Ujjania Kumar Vikas, Sawant Banerjee Paramita, Munilkumar Sukham, Biswas Gouranga, Jaiswar A.K., Rasal D. Kiran, Sarma Debajit (2026). Baseline Morpho-molecular Insights Into Indigenous Ornamental Fish Zebra Loach, Botia striata from Koyna River, Western Ghats, India . Indian Journal of Animal Research. 60(4): 577-585. doi: 10.18805/IJAR.B-5723.

Background: Botia striata (zebra loach), an endangered ornamental species endemic to the Western Ghats, is threatened by habitat loss and restricted distribution. Limited baseline data exist on its morphology, growth and genetic identity. This study uses an integrative morpho-molecular approach to characterise Koyna River populations and support conservation planning.

Methods: A total of 360 specimens were collected from the Koyna River (August 2023-July 2024). Sixteen morphometric traits and five meristic counts were measured. Length-weight relationships and condition factor were estimated using log-transformed regressions. Muscle tissues were preserved for DNA extraction. The COI gene was amplified using universal FishF1-FishR1 primers and the purified PCR products were sequenced to generate consensus sequences. Bioinformatic analyses included BLASTn identification, nucleotide composition, genetic divergence and Maximum Likelihood phylogeny (T92+I model).

Result: Morphometric analysis revealed total length ranging from 3.2 to 5.6 cm, with strong positive correlations among major body dimensions. Meristic counts (D: I-9; A: I-6; C: 18; V: I-8; P: 13) were consistent with earlier descriptions for Botia spp. LWR analyses showed strong length–weight association (R² = 0.880-0.925) and negative allometric growth (b = 2.395-2.597). Condition factor values (1.19-2.799) indicated an overall healthy population status. COI barcoding generated a 662 bp sequence exhibiting low intraspecific divergence (0-0.6%) and formed a well-supported clade (bootstrap 96-97%) with authenticated B. striata sequences, validating taxonomic identity.

Cypriniformes, the largest order of freshwater fishes (Nelson, 1998), comprises the superfamilies Cyprinoidea (carps) and Cobitoidea (loaches). Cobitids were historically regarded as a monophyletic group based on the presence of a movable, bifurcated suborbital spine, a defining feature of the spined loaches (Bohlen and Šlechtovα, 2016). Later studies, however, distinguished Cobitidae from Botiidae by differences in barbel arrangement and swim bladder ossification (Nalbant, 2002). The genus Botia, belonging to the family Botiidae, includes about 20 species (Dey et al., 2015) and nine genera (Kottelat, 2004) and is well known for its vibrant colouration, active behaviour and ornamental importance (Shaji et al., 2000). The Western Ghats of India, a recognised biodiversity hotspot, harbour Botia striata, a species listed as endangered and threatened on the IUCN Red List due to habitat degradation and restricted distribution (Dahanukar et al., 2004; Dahanukar, 2013; Keskar et al., 2014). Its narrow range and continuing habitat loss highlight the species’ vulnerability and the urgent need for conservation attention.
       
Morphological assessment, including morphometric and meristic analyses, is fundamental to taxonomy, stock identification and understanding evolutionary patterns (Ujjania, 2003; Suyani et al., 2021). Such data support evaluations of species health and are essential for estimating key biological parameters related to growth, reproduction, life-history traits, population dynamics and overall stock resilience (Meshram et al., 2021). Specimen size, influenced by ecological and physiological factors, further enhances the value of morphometric studies (Kalayci et al., 2007). Morphometric relationships are widely recognised as critical tools in fisheries biology (Ujjania and Choudhary, 2021) and taxonomic investigations (Poria et al., 2013), particularly given the pronounced morphological plasticity exhibited by fish in response to environmental variability (Mir et al., 2014). Abiotic factors such as water physicochemical properties, habitat structure and substrate type, alongside biotic pressures including competition and predation, shape morphological expression and thereby influence stock assessments and taxonomic interpretations (Shah et al., 2024). Length-weight relationships (LWRs) further contribute to fisheries science by informing biomass estimation and growth assessment, especially for threatened species (Beverton and Holt, 1957; Froese, 2006; Guo et al., 2020). Anthro-pogenic impacts-such as overfishing, dam construction, habitat modification and biological pollution-continue to alter species composition and abundance (Shuman et al., 2022), while metrics like frequency of occurrence and length-weight distribution provide valuable insights into population structure and ecosystem functioning (Zhao et al., 2017).
       
Although isometric growth theoretically follows a cube law, where weight increases proportionally to the cube of length (Lagler, 1952), resulting in an exponent of 3 in the LWR equation, deviations from this idealised value, indicative of allometric growth, are frequently observed. These deviations are often attributed to environmental conditions and the physiological state of individual fish (Le Cren, 1951). Given the limited existing data on the biology and ecology of B. striata and its endangered status within the Koyna River region of the Western Ghats, this study was initiated to establish essential baseline data to inform conservation strategies for this ornamental freshwater fish. Biotechnological analysis, including DNA barcoding, has emerged as a reliable approach for species-level identification based on mitochondrial DNA sequences, facilitating the examination of evolutionary and taxonomic relationships among various taxa. This method relies on a standardised fragment of approximately 655 base pairs from the mitochondrial Cytochrome Oxidase Subunit I gene, amplified using universal primers (Hebert et al., 2003). The global interest in fisheries and biodiversity conservation led to the establishment of the “Barcode of Life Project (iBOL)” (Hebert et al., 2003), which identified the COI gene as a robust molecular marker for fish species differentiation due to the rapid evolution of mitochondrial DNA, its strict maternal inheritance and haploid nature (Moore, 1995).
       
The zebra loach (B. striata) from the Koyna River is a prominent freshwater ornamental fish, for which limited data exist on its biology and ecology. This study employed an integrated approach combining morphological and genetic assessments to elucidate the relationships among morphometric parameters, meristic counts and DNA barcoding. Subsequent bioinformatic analyses will be beneficial for fish biologists in developing conservation strategies for freshwater ornamental fish that are naturally vulnerable.
The study was conducted in the Koyna River, a major tributary of the Krishna River system in the Western Ghats, Maharashtra, India. Originating in the Mahabaleshwar hill ranges, the river flows southward for about 65 km before turning east near Helwak and subsequently joining the Krishna River at Karad (Jadhav et al., 2011). A total of 360 specimens of Botia striata were collected systematically from August 2023 to July 2024 from its major gene pool at Patan, Satara (17.33996oN, 73.95691oE) (Fig 1). The specimens were stored in sterilised ice-filled containers and transported to the Division of Aquaculture, ICAR-Central Institute of Fisheries Education, Mumbai, for further examination. Identification was carried out using standard taxonomic keys (Talwar and Jhingran, 1991). Sixteen morphometric variables-total length, standard length, fork length, head length, pre-dorsal length, dorsal fin length, post-dorsal length, caudal fin length, caudal height, snout length, eye diameter, pectoral fin length, pelvic fin length, pre-anal length, post-anal length and body width-were measured following standard procedures (Fig 2). Five meristic characters, including counts of dorsal, caudal, anal, ventral and pectoral fin rays, were recorded following Sharma et al., (2014), Menon (1992), Hossen et al., (2016) and Paunikar and Panwar (2021). All measurements were taken from the snout tip to defined anatomical landmarks using a vernier caliper supported by a metal divider, with precision up to 0.1 cm. Body weight was recorded to the nearest 0.1 g using an electronic single-pan balance after removing excess water and debris. The collected morphometric and meristic data were used to compute minimum, maximum, range and percentage variation for each trait.

Fig 1: Geographic representation of the sampling site along the Koyna River, located within the Western Ghats, India.



Fig 2: Morphometric measurements of Botia striata (Rao, 1920) from the Koyna River, Western Ghats, India.


       
The length-weight relationship (LWR) of fish specimens was established using the logarithmic transformation approach proposed by Le Cren (1951). The association between total length (cm) and body weight (g) was quantified using the length-weight equation:
 
W = aLb 
 
Where
‘a and b’ = Represent the relationship’s intercept and slope or growth coefficient, respectively.

To determine these parameters, a linear regression analysis was conducted on the logarithmically transformed equation:
 
log (W) = log (a)±b log (L)
 
Where
“a” = Stood for the relationship’s intercept.
“b” = Its slope or growth constant.
       
The values of the compiled growth condition were used for the calculation of the condition factor (K) was calculated by the formula:

 
Where,
W = Total body weight (g).
L = Total length (cm).
b = Growth constant.
       
Conservation management faces significant challenges in the accurate identification of fishery resources, particularly eggs, larvae and juvenile stages, due to pronounced morphological similarities among closely related taxa (Balaganesan et al., 2025). DNA barcoding has emerged as a robust species categorization tool, enabling the assignment of unknown specimens to recognised species through the analysis of standardized DNA barcode sequences and has been successfully applied across a wide range of organisms (Schindel and Miller, 2005; Rathipriya et al., 2022). In this context, molecular approaches, especially DNA barcoding, offer a reliable and precise means of species authentication. Accordingly, for biotechno- logical assessment, muscle tissue was dissected from the right side of each specimen and immediately preserved in 95% ethanol for subsequent genomic DNA extraction. Genomic DNA was extracted from approximately 25-40 mg of ethanol-preserved tissue using the standard phenol-chloroform-isoamyl alcohol protocol described by Sambrook and Russell (2001). The mitochondrial Cytochrome c Oxidase Subunit I (COI) gene was selected for molecular analysis and amplified using the universal primers FishF1 (5′ - TCAACCAACCACAAAGACATT GGCAC-3′) and FishR1 (5′ -TAGACTTCTGGGTGGCCAA AGAATCA-3′) (Ward et al., 2005). PCR reactions were performed in a 25 μl volume containing 1× PCR buffer, 2 mM MgCl‚ , 100 μM of each dNTP, 5 pmol of each primer, 2 U of Taq DNA polymerase and approximately 100 ng of template DNA. Thermal cycling conditions consisted of an initial denaturation at 94oC for 3 min, followed by 35 cycles of denaturation at 94oC for 50 s, annealing at 54oC for 30 s and extension at 72oC for 80 s, with a final extension at 72oC for 10 min. PCR products were purified with ExonucleaseI and FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific) and sequenced using the Sanger dideoxyn-ucleotide chain-termination method (Sanger et al., 1977) on an ABI 3500 Genetic Analyser (Applied Biosystems, USA).
       
The obtained COI sequences were curated by visual inspection of chromatograms in FinchTV, with trimming of ambiguous bases and submitted to GenBank under accession number PV564526. Sequence identity was confirmed using BLASTn searches against the GenBank nucleotide database. Genetic divergence within and between species was estimated in MEGA 12 (Kumar et al., 2024) and phylogenetic relationships were inferred using the maximum likelihood method.
Morphometric and meristic characterisation
 
The morphometric characterisation of Botia striata (Rao, 1920) was conducted and the traits are illustrated in Fig 2. The total length (TL) ranged from 3.2 to 5.6 cm and body weight (BW) varied between 0.600 and 3.800 g (Table 1). The morphometric parameters were described in Table 1, where fork length was 2.900-5.400 (4.649±0.032), noted the largest one contributing 80.952-96.875 (93.488±0.124%), while eye diameter was 0.200-0.400 (0.325±0.003), noted the smallest one that contributed 5.357-7.895 (6.543±0.047%). Furthermore, the multiple correlation for various morphometric variables was calculated and it was noted that the correlation coefficient (r) was maximum (0.983) and minimum (0.409) in total length v/s fork length and eye diameter v/s snout length, respectively (Fig 3). Comparative analysis revealed a close morphological resemblance between Botia striata and Nemacheilus triangularis, as previously reported by Mercy et al., (2007) and with Botia birdi, as documented by Sharma et al., (2014). These findings highlight the taxonomic and morphological affinities of Botia striata within its related taxa, providing valuable insights into its structural and developmental characteristics.

Table 1: Observations and their percentages with different morphometric parameters of Botia striata (Rao, 1920) from the Koyna River, Western Ghats, India.



Fig 3: Correlation among the different morphometric variables of Botia striata (Rao, 1920) from the Koyna River, Western Ghat of India.


       
The meristic characteristics of the examined specimens were recorded as follows: Dorsal fin rays (I-9), caudal fin rays (18.0), anal fin rays (I-6), ventral fin rays (I-8) and pectoral fin rays (13.0), as detailed in Table 2. These meristic counts exhibit notable similarity to the findings reported by Hossen et al., (2016) for Botia lohachata and by Paunikar and Panwar (2021) for Nemacheilus botia, indicating consistency in fin-ray patterns across related loach species. However, despite this meristic overlap, Botia striata can be distinguished in the field by its well-defined vertical zebra-like bands, deeper laterally compressed body and the presence of a distinct movable suborbital spine, a diagnostic feature of botiid loaches.

Table 2: Meristic counts of the Botia striata from the Koyna River.


 
Length-weight relationship (LWR) and condition factor (K)
 
The length-weight relationship of Botia striata was analysed based on measured total length (TL), standard length (SL) and weight (WT) variables and results were depicted that the intercept was 1.974 and 1.594, the correlation coefficient (R2) was 0.880 and 0.925 and the growth constant (b) was 2.395 and 2.597 in total length v/s weight and standard length v/s weight, respectively (Fig 4 and 5). The correlation coefficient indicates a strong positive relationship between total length, standard length and weight. In contrast, the growth constant reveals negative allometric growth of the fish in the studied area. The ‘b’ values of the LWR for B. striata in this study were within the limits reported by Carlander (1969). Our findings align with those reported by Sui et al., (2015), Froese and Pauly (2021), Khan and Sabah (2013), Bashir et al., (2016) and Sheikh and Ahmed (2019), reinforcing the consistency of observed trends across various studies. The condition factor of zebra loach was analysed and found to range from 1.190 to 2.799, with a mean value of 2.074±0.012 (Table 1), which serves as an indicator of the overall health and well-being of the studied fish supported by Caldwell and Beyer (1987). These analyses provide valuable insights into the species’ growth dynamics, morphological variation and physiological condition, contributing to a more comprehensive understanding of its ecological adaptations and population structure. To account for seasonal variations influencing the parameter b, fish specimens were categorised based on their capture period: cold season (fall and winter) and warm season (spring and summer) (Zaher et al., 2015). Wherever a significant seasonal effect was not evident, the evaluation of b proceeded at a broader temporal scale. Given the influence of environmental factors and the physiological state of fish, the value of b may diverge from the theoretical isometric growth coefficient of 3, as established by Ricker (1958). When b < 3, fish exhibit negative allometric growth, becoming progressively thinner as their length increases. Conversely, when b > 3, fish demonstrate positive allometric growth, signifying increased weight gain and optimal growth conditions.

Fig 4: Length weight relationship (total length and weight) of Botia striata (Rao, 1920) from the Koyna River, Western Ghat of India.



Fig 5: Length weight relationship (standard length and weight) of Botia striata (Rao, 1920) from the Koyna River, Western Ghat of India.


       
This variation in growth patterns is further reflected in the seasonal fluctuations of the condition factor (K value) of B. dario, as reported by Haque and Biswas (2014), with values ranging from 1.03 to 1.11. These findings align closely with the results of the present study, reinforcing the role of environmental conditions in shaping fish physiology. Moreover, the consistency of these trends, as documented by previous researchers-including Dasgupta (1991) and Paswan et al., (2012) -highlights the broader applicability of these observations across different studies. Taken together, these insights emphasise the necessity of incorporating seasonal and environmental considerations when assessing fish condition and habitat quality, ensuring a more comprehensive understanding of aquatic ecosystems.

DNA barcoding
 
A total of 662 base pairs of the mitochondrial cytochrome c oxidase subunit I (COI) gene were analysed from Botia striata sequences. The overall nucleotide composition consisted of 57.3% adenine and thymine (AT) and 42.7% guanine and cytosine (GC) content. Codon position-specific analysis revealed an AT content of 56.56% at the 1st codon position, 71.04% at the 2nd position and 44.09% at the 3rd position, indicating notable codon bias typically observed in mitochondrial genes. Model selection for nucleotide substitution was conducted using the Bayesian Information Criterion (BIC) in MEGA software. The best-fit model identified was the Tamura 3-parameter model with invariant sites (T92+I). This model was subsequently employed for Maximum Likelihood (ML) phylogenetic analysis, providing a robust framework for evaluating evolutionary relationships among the sequences. The pairwise genetic distances (p-distance) among five Botia striata sequences ranged from 0 to 0.6%, indicating very low intraspecific variation. The sequence from the present study (KRCIFE01) showed 0-0.6% divergence compared to GenBank sequences. The Maximum Likelihood (ML) phylogenetic tree presented in Fig 6, derived from COI gene sequences, validated the identification of the Botia striata specimen from this study (KRCIFE01). It exhibited strong clustering with a bootstrap support of 97%, aligning closely with other B. striata sequences from GenBank (KF738186, KX384742). All B. striata sequences formed a distinct clade with 96% support, clearly separated from the outgroup species Channa stewartii (MK599531), indicating strong genetic relatedness and validating species-level identification. Hebert et al., (2003) introduced the concept that a short nucleotide sequence from the mitochondrial genome could serve as a DNA barcode for species identification, particularly in eukaryotic organisms, with a primary focus on animals. This approach has demonstrated its efficacy as a rapid and accurate method for identifying biological specimens. Several studies have validated the efficacy of COI-based DNA barcoding in distinguishing closely related fish species (Steinke et al., 2005; Ward et al., 2005; Ratnasingham and Hebert, 2007; Hubert et al., 2008; Lakra et al., 2011; Chandra et al., 2012; Ambili et al., 2014; Alam et al., 2020; Goswami et al., 2022), reinforcing its utility in taxonomic classification and biodiversity assessment. These findings further establish the utility of mitochondrial markers in differentiating and classifying fish species with high precision.

Fig 6: Maximum likelihood (ML) phylogenetic tree based on mitochondrial COI gene sequences.

The present investigation employed an integrative approach, combining morphological and molecular methodologies, to establish foundational reference data for Botia striata populations inhabiting the Western Ghats ecosystem of India. Morphometric analyses revealed distinct structural patterns, accompanied by consistent meristic counts and a negative allometric growth trajectory, collectively indicative of favourable population vitality. The condition factor further substantiated the overall physiological well-being of the species. Molecular validation via Cytochrome c oxidase I (COI) barcoding corroborated the taxonomic identity of B. striata, with negligible intraspecific genetic variation, suggesting a genetically cohesive population structure. These multidimensional insights offer a comprehensive baseline essential for targeted conservation initiatives and underscore the synergistic utility of classical taxonomy and molecular diagnostics in advancing biodiversity management frameworks.
The authors gratefully acknowledge the Director and Vice-Chancellor of the ICAR-Central Institute of Fisheries Education, Mumbai, for providing the necessary research facilities to carry out this study. We also extend our sincere appreciation to Dr. N.C. Ujjania, Mr. Samad Sheikh and Dr. Mahendra Verma for their valuable support and guidance in specific components of the research. The first author further acknowledges the Indian Council of Agricultural Research (ICAR) for providing a doctoral fellowship.
The authors declare that there is no conflict of interest.

  1. Alam, A., Chadha, N.K., Kumar, A.P., Chakraborty, S.K., Joshi, K.D., Sawant, P.B., Das, S.C.S., Kumar, J. and Kumar, T. (2020). DNA barcoding and biometric investigation on the invasive Oreochromis niloticus (Linnaeus, 1758) from the River Yamuna of Uttar Pradesh. Indian Journal of Animal Research. 54(7): 856-863. doi: 10.18805/ijar.B-3833.

  2. Ambili, C.S., Nandan, S.B., Jayasankar, P., Krishnan, P. and Lakra, W.S. (2014). DNA barcoding of commercially important fishes of Indian seas. Mitochondrial DNA. 25(4): 270-278.

  3. Balaganesan, M., Shanmugam, S.A., Kathirvelpandian, A., Agarwal, D., Ramya, R. and Suresh, E. (2025). Character-based identification system (CBIS) for authentication and conservation of fishes from the Thamirabarani River, Western Ghats of India. Indian Journal of Animal Research. 59(12): 2028-2036. doi: 10.18805/IJAR.B-5403.

  4. Bashir, A., Sharma, N.K., Bisht, B.S., Singh, R., Mir, J.I. and Akhtar, M.S. (2016). Length-weight relationship of five commercially important freshwater fish species in the Kashmir Valley, India. Journal of Applied Ichthyology. 32(4): 740-741.

  5. Beverton, R.J.H. and Holt, S.J. (1957). On the Dynamics of Exploited Fish Populations. Blackburn Press. 

  6. Bohlen, J. and Šlechtová, V. (2016). Leptobotia bellacauda, a new species of loach from the lower Yangtze Basin in China (Teleostei: Cypriniformes: Botiidae). Zootaxa. 4205(1): 65-72.

  7. Caldwell, N.J. and Beyer, J.E. (1987). On length-weight relationships. Part I: Computing the mean weight of the fish of a given length class. Fishbyte. 5: 11-13.

  8. Carlander, K.D. (1969). Handbook of Freshwater Fishery Biology, Vol. 1. Iowa State University Press, Ames, IA.

  9. Chandra, G., Asokan, P.K., Afsal, V.V., Rajagopal, S. and Gopala krishnan, A. (2012). DNA barcoding of marine fish species from Indian waters. Indian Journal of Fisheries. 59(4): 123-130.

  10. Dahanukar, N. (2013). Botia striata. The IUCN Red List of Threatened Species 2013: e.T168591A6521075. International Union for Conservation of Nature (IUCN). https://doi.org/ 10.2305/IUCN.UK.2011-1.RLTS.T168591A6521075.en.

  11. Dahanukar, N., Raut, R. and Bhat, A. (2004). Distribution, endemism and threat status of freshwater fishes in the Western Ghats of India. Journal of Biogeography. 31(1): 123-136.

  12. Dasgupta, M. (1991). Length-weight relationship and condition factor (K value) for Tor putitora from Garo Hills, Meghalaya. Indian Journal of Fisheries. 38(1): 35-38.

  13. Dey, A., Sarkar, D. and Barat, S. (2015). Spawning biology, embryonic development and captive breeding of vulnerable loach Botia dario (Hamilton). Journal of Entomology and Zoology Studies. 3(6): 183-188.

  14. Froese, R. (2006). Cube law, condition factor and weight-length relationships: History, meta-analysis and recommendations. Journal of Applied Ichthyology. 22(4): 241-253.

  15. Froese, R. and Pauly, D. (2021). FishBase. Available at: www.fishbase. org. Accessed June 2021.

  16. Goswami, M., Kumar, A.P., Patil, G.S., George, T., Nath, R., Bhuyan, R.N., Siva, C., Laskar, M.A. and Sumer, S. (2022). Molecular identification of ornamental loaches of NE India using mitochondrial genes. Animal Gene. 26: 200136.

  17. Guo, H., Zhang, Y., Tang, W., Liu, D. and Zhang, X. (2020). Length- weight relationships of ten fish species from the Jingjiang Reach of the Yangtze River, China. Journal of Applied Ichthyology. 36(3): 369-372.

  18. Haque, S. and Biswas, S.P. (2014). Length-weight relationship and condition factor of Botia dario (Hamilton-Buchanan) from Sivasagar district. International Journal of Fisheries and Aquatic Studies. 2(1): 244-247.

  19. Hebert, P.D.N., Cywinska, A., Ball, S.L. and Waard, J.R. (2003). Biological identifications through DNA barcodes. Proceedings of the Royal Society B. 270: 313-322.

  20. Hebert, P.D.N., Ratnasingham, S. and Waard, J.R. (2003). Barcoding animal life: Cytochrome coxidase subunit 1 differences among closely related species. Royal Society of London B (Supplement). 270: 96-99.

  21. Hossen, M.A., Hossain, M.Y., Pramanik, M.N.U., Nawer, F., Khatun, D., Parvin, M.F. and Rahman, M.M. (2016). Morphological characters of Botia lohachata. Journal of Coastal Life Medicine. 4(9): 689-692.

  22. Hubert, N., Hanner, R., Holm, E., Mandrak, N.E., Taylor, E., Burridge, M. et al. (2008). Identifying Canadian freshwater fishes through DNA barcodes. PLoS One. 3(6): e2490.

  23. Jadhav, B.V., Kharat, S.S., Raut, R.N., Paingankar, M. and Dahanukar, N. (2011). Freshwater fish fauna of Koyna River, Northern Western Ghats, India. Journal of Threatened Taxa. 3(1): 1449-1455.

  24. Kalayci, F., Samsun, N., Bilgin, S. and Samsun, O. (2007). Length-weight relationship of 10 fish species caught by trawls from the Middle Black Sea. Turkish Journal of Fisheries and Aquatic Sciences. 7: 33-36.

  25. Keskar, A., Padhye, A. and Dahanukar, N. (2014). Fighting against all odds: Hill stream loaches of Western Ghats. Mini- Newsletter of the Freshwater Fish Specialist Group (FFSG). 2: 25-29.

  26. Khan, M.A. and Sabah (2013). Length-weight and length-length relationships for five fish species from Kashmir Valley. Journal of Applied Ichthyology. 29(1): 283-284.

  27. Kottelat, M. (2004). Botia kubotai, a new species of loach (Teleostei: Cobitidae) from the Ataran River basin (Myanmar), with comments on botiine nomenclature and diagnosis of a new genus. Zootaxa. 401: 1-18.

  28. Kumar, S., Stecher, G., Suleski, M., Sanderford, M., Sharma, S. and Tamura, K. (2024). Molecular evolutionary genetics analysis  version 12. Molecular Biology and Evolution. 41: 1-9.

  29. Lagler, K.F. (1952). Freshwater Fishery Biology. Wim C. Brown Co., Dubuque, Iowa.

  30. Lakra, W.S., Verma, M.S., Goswami, M., Lal, K.K., Mohindra, V., Punia, P., Gopalakrishnan, A., Singh, K.V., Ward, R.D. and Hebert, P.D.N. (2011). DNA barcoding Indian marine fishes. Molecular Ecology Resources. 11: 60-71.

  31. Le Cren, E.D. (1951). The length-weight relationship and seasonal cycle in perch. Journal of Animal Ecology. 20: 201-219.

  32. Menon, A.G.K. (1992). Taxonomy of mahseer fishes of genus Tor. Journal of the Bombay Natural History Society. 899: 210-228.

  33. Mercy, T.V.A., Rema Devi, K. and Indra, T.J. (2007). Freshwater fishes of the Western Ghats, India. Zoological Survey of India, Kolkata. pp. 259.

  34. Meshram, M.M., Rajesh, M., Rajesh, K.M. and Suyani, N.K. (2021). Morphology and condition factor of Sphyraena obtusata. Indian Journal of Geo-Marine Sciences. 50: 480-488.

  35. Mir, F.A., Mir, J.I. and Chandra, S. (2014). Detection of morphometric differentiation in snowtrout. Revista de Biologia Tropical. 62(1): 119-127.

  36. Moore, W.S. (1995). Inferring phylogenies from mtDNA variation. Evolution. 49: 718-726.

  37. Nalbant, T.T. (2002). Sixty million years of evolution. Part one: Family Botiidae (Pisces: Ostariophysi: Cobitoidea). Travaux du Muséum National d’Histoire Naturelle “Grigore Antipa”. 44: 309-333.

  38. Nelson, J.S. and Wilson, M.V.H. (1998). Origin and Phylogenetic Interrelationships of Teleosts. Verlag Dr. Friedrich Pfeil, München. pp. 295-316.

  39. Paswan, G., Abujam, S.K.S., Dey, M. and Biswas, S.P. (2012). Length-weight relationship of Trichogaster. Journal of Bio Innovations. 1(1): 6-13.

  40. Paunikar, S. and Panwar, S. (2021). Morphometric and meristic study of freshwater fishes of Song River. Journal of Entomology and Zoology Studies. 9(5): 288-292.

  41. Poria, M., Fathali, N., Ghanbary, K. and Poria, H. (2013). Interrelationship between morphometric variables in Capoeta trutta. World Journal of Fish and Marine Sciences. 5(6): 674-679.

  42. Rao, C.R.N. (1920). On some new fishes from the Western Ghats. Records of the Indian Museum. 19: 19-25.

  43. Rathipriya, A., Kathirvelpandian, A., Shanmugam, S.A., Uma, A., Suresh, E. and Felix, N. (2022). Character-based diagnostic keys, molecular identification and phylogenetic relationships of fishes based on mitochondrial gene from Pulicat Lake, India: A tool for conservation and fishery management purposes. Indian Journal of Animal Research. 56(8): 933-940. doi: 10.18805/IJAR.B-4905.

  44. Ratnasingham, S. and Hebert, P.D.N. (2007). The barcode of life data system. Available at: www.barcodinglite.org.

  45. Ricker, W.E. (1958). Handbook of Computations for Biological Statistics of Fish Populations. Bulletin of the Fisheries Research Board of Canada. 119: 1-300.

  46. Sambrook, J. and Russell, D.W. (2001). Molecular cloning: A Laboratory Manual. 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

  47. Sanger, F., Nicklen, S. and Coulson, A.R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74(12): 5463-5467.

  48. Schindel, D.E. and Miller, S.E. (2005). DNA barcoding a useful tool for taxonomists. Nature. 435. pp 17.  

  49. Shah, N.P., Ujjania, N.C. and Pardeshi, A. (2024). Morphometry of stripped catfish culture. Ecology, Environment and Conservation. 30(SI): 449-454.

  50. Shaji, C.P., Easa, P.S. and Gopalakrishnan, A. (2000). Freshwater fish diversity of Western Ghats. In: Endemic Fish Diversity of Western Ghats. NBFGR-NATP Publication, Lucknow. pp. 35-35.

  51. Sharma, N.K., Mir, J.I., Pandey, N. and Singh, R. (2014). Morphometric and meristic characteristics of Botia birdi. World Journal of Fish and Marine Sciences. 6(3): 262-266.

  52. Sheikh, Z.A. and Ahmed, I. (2019). Length-weight relationship of seven indigenous fish species of Kashmir Himalaya. Iranian Journal of Ichthyology. 6(3): 240-243.

  53. Shuman, L.A., Selyukov, A.G., Nekrasov, I.S., Elifanov, A.V. and Yurchenko, V.V. (2022). Data on length-weight and condition factor of Rutilus rutilus and Perca fluviatilis. Data in Brief. 42: 108067.

  54. Sokal, R. and Rohlf, F. (1987). Biometry: Principles and Practice of Statistics in Biological Research. 2nd ed.

  55. Steinke, D., Vences, M., Salzburger, W. and Meyer, A. (2005). TaxI: A software tool for DNA barcoding. Philosophical Transactions of the Royal Society B. 360: 1847-1857.

  56. Sui, X.Y., Li, X.Q., Sun, H.Y. and Chen, Y.F. (2015). Length-weight relationship of 13 species from Ili River. Journal of Applied Ichthyology. 31(6): 1155-1157.

  57. Suyani, N.K., Rajesh, M., Rajesh, K.M., Meshram, M.M. and Vandana, K. (2021). Morphometry and condition factor of Odonus niger. Journal of Environmental Biology. 42: 1026-1032.

  58. Talwar, P.K. and Jhingran, A.G. (1991). Inland Fishes of India and Adjacent Countries, Vol. 2. A.A. Balkema, Rotterdam.

  59. Ujjania, N.C. (2003). Comparative Performance of Indian Major Carps. Ph.D. Thesis, ICAR-CIFE, Mumbai.

  60. Ujjania, N.C. and Chaudhari, S.H. (2021). Assessment of growth pattern of Catla catla in Vallabhsagar Reservoir. International Journal of Livestock Research. 11(1): 69-74.

  61. Ward, R.D., Zemlak, T.S., Innes, B.H., Last, P.R. and Hebert, P.D.N. (2005). DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B: Biological Sciences. 360: 1847-185.

  62. Zaher, F.M., Rahman, B.M.S., Rahman, A., Alam, M.A. and Pramanik, M.H. (2015). Length-weight relationship and gonadosomatic index of hilsa, Tenualosa ilisha (Hamilton, 1822) fishes in Meghna River, Bangladesh. International Journal of Natural and Social Sciences. 2: 82-88.

  63. Zhao, J., Cao, J., Tian, S., Chen, Y., Zhang, S. and Zhou, X. (2017). Influence of sampling frequency on detectability of fish communities. Aquaculture and Fisheries. 2(2): 94-102.

Baseline Morpho-molecular Insights Into Indigenous Ornamental Fish Zebra Loach, Botia striata from Koyna River, Western Ghats, India

V
Vikas Kumar Ujjania1
P
Paramita Banerjee Sawant1,*
S
Sukham Munilkumar1
G
Gouranga Biswas4
A
A.K. Jaiswar2
K
Kiran D. Rasal3
D
Debajit Sarma1
1Aquaculture Division, ICAR-Central Institute of Fisheries Education, Mumbai-400 061, Maharashtra, India.
2Fisheries Resources, Harvest and Post Harvest Management Division, ICAR-Central Institute of Fisheries Education, Mumbai- 400 061, Maharashtra, India.
3Fish Genetics and Biotechnology Division, ICAR-Central Institute of Fisheries Education, Mumbai-400 061, Maharashtra, India.
4ICAR- Central Institute of Fisheries Education (Kolkata Centre), Kolkata-700 091, West Bengal, India.
Cite article:- Ujjania Kumar Vikas, Sawant Banerjee Paramita, Munilkumar Sukham, Biswas Gouranga, Jaiswar A.K., Rasal D. Kiran, Sarma Debajit (2026). Baseline Morpho-molecular Insights Into Indigenous Ornamental Fish Zebra Loach, Botia striata from Koyna River, Western Ghats, India . Indian Journal of Animal Research. 60(4): 577-585. doi: 10.18805/IJAR.B-5723.

Background: Botia striata (zebra loach), an endangered ornamental species endemic to the Western Ghats, is threatened by habitat loss and restricted distribution. Limited baseline data exist on its morphology, growth and genetic identity. This study uses an integrative morpho-molecular approach to characterise Koyna River populations and support conservation planning.

Methods: A total of 360 specimens were collected from the Koyna River (August 2023-July 2024). Sixteen morphometric traits and five meristic counts were measured. Length-weight relationships and condition factor were estimated using log-transformed regressions. Muscle tissues were preserved for DNA extraction. The COI gene was amplified using universal FishF1-FishR1 primers and the purified PCR products were sequenced to generate consensus sequences. Bioinformatic analyses included BLASTn identification, nucleotide composition, genetic divergence and Maximum Likelihood phylogeny (T92+I model).

Result: Morphometric analysis revealed total length ranging from 3.2 to 5.6 cm, with strong positive correlations among major body dimensions. Meristic counts (D: I-9; A: I-6; C: 18; V: I-8; P: 13) were consistent with earlier descriptions for Botia spp. LWR analyses showed strong length–weight association (R² = 0.880-0.925) and negative allometric growth (b = 2.395-2.597). Condition factor values (1.19-2.799) indicated an overall healthy population status. COI barcoding generated a 662 bp sequence exhibiting low intraspecific divergence (0-0.6%) and formed a well-supported clade (bootstrap 96-97%) with authenticated B. striata sequences, validating taxonomic identity.

Cypriniformes, the largest order of freshwater fishes (Nelson, 1998), comprises the superfamilies Cyprinoidea (carps) and Cobitoidea (loaches). Cobitids were historically regarded as a monophyletic group based on the presence of a movable, bifurcated suborbital spine, a defining feature of the spined loaches (Bohlen and Šlechtovα, 2016). Later studies, however, distinguished Cobitidae from Botiidae by differences in barbel arrangement and swim bladder ossification (Nalbant, 2002). The genus Botia, belonging to the family Botiidae, includes about 20 species (Dey et al., 2015) and nine genera (Kottelat, 2004) and is well known for its vibrant colouration, active behaviour and ornamental importance (Shaji et al., 2000). The Western Ghats of India, a recognised biodiversity hotspot, harbour Botia striata, a species listed as endangered and threatened on the IUCN Red List due to habitat degradation and restricted distribution (Dahanukar et al., 2004; Dahanukar, 2013; Keskar et al., 2014). Its narrow range and continuing habitat loss highlight the species’ vulnerability and the urgent need for conservation attention.
       
Morphological assessment, including morphometric and meristic analyses, is fundamental to taxonomy, stock identification and understanding evolutionary patterns (Ujjania, 2003; Suyani et al., 2021). Such data support evaluations of species health and are essential for estimating key biological parameters related to growth, reproduction, life-history traits, population dynamics and overall stock resilience (Meshram et al., 2021). Specimen size, influenced by ecological and physiological factors, further enhances the value of morphometric studies (Kalayci et al., 2007). Morphometric relationships are widely recognised as critical tools in fisheries biology (Ujjania and Choudhary, 2021) and taxonomic investigations (Poria et al., 2013), particularly given the pronounced morphological plasticity exhibited by fish in response to environmental variability (Mir et al., 2014). Abiotic factors such as water physicochemical properties, habitat structure and substrate type, alongside biotic pressures including competition and predation, shape morphological expression and thereby influence stock assessments and taxonomic interpretations (Shah et al., 2024). Length-weight relationships (LWRs) further contribute to fisheries science by informing biomass estimation and growth assessment, especially for threatened species (Beverton and Holt, 1957; Froese, 2006; Guo et al., 2020). Anthro-pogenic impacts-such as overfishing, dam construction, habitat modification and biological pollution-continue to alter species composition and abundance (Shuman et al., 2022), while metrics like frequency of occurrence and length-weight distribution provide valuable insights into population structure and ecosystem functioning (Zhao et al., 2017).
       
Although isometric growth theoretically follows a cube law, where weight increases proportionally to the cube of length (Lagler, 1952), resulting in an exponent of 3 in the LWR equation, deviations from this idealised value, indicative of allometric growth, are frequently observed. These deviations are often attributed to environmental conditions and the physiological state of individual fish (Le Cren, 1951). Given the limited existing data on the biology and ecology of B. striata and its endangered status within the Koyna River region of the Western Ghats, this study was initiated to establish essential baseline data to inform conservation strategies for this ornamental freshwater fish. Biotechnological analysis, including DNA barcoding, has emerged as a reliable approach for species-level identification based on mitochondrial DNA sequences, facilitating the examination of evolutionary and taxonomic relationships among various taxa. This method relies on a standardised fragment of approximately 655 base pairs from the mitochondrial Cytochrome Oxidase Subunit I gene, amplified using universal primers (Hebert et al., 2003). The global interest in fisheries and biodiversity conservation led to the establishment of the “Barcode of Life Project (iBOL)” (Hebert et al., 2003), which identified the COI gene as a robust molecular marker for fish species differentiation due to the rapid evolution of mitochondrial DNA, its strict maternal inheritance and haploid nature (Moore, 1995).
       
The zebra loach (B. striata) from the Koyna River is a prominent freshwater ornamental fish, for which limited data exist on its biology and ecology. This study employed an integrated approach combining morphological and genetic assessments to elucidate the relationships among morphometric parameters, meristic counts and DNA barcoding. Subsequent bioinformatic analyses will be beneficial for fish biologists in developing conservation strategies for freshwater ornamental fish that are naturally vulnerable.
The study was conducted in the Koyna River, a major tributary of the Krishna River system in the Western Ghats, Maharashtra, India. Originating in the Mahabaleshwar hill ranges, the river flows southward for about 65 km before turning east near Helwak and subsequently joining the Krishna River at Karad (Jadhav et al., 2011). A total of 360 specimens of Botia striata were collected systematically from August 2023 to July 2024 from its major gene pool at Patan, Satara (17.33996oN, 73.95691oE) (Fig 1). The specimens were stored in sterilised ice-filled containers and transported to the Division of Aquaculture, ICAR-Central Institute of Fisheries Education, Mumbai, for further examination. Identification was carried out using standard taxonomic keys (Talwar and Jhingran, 1991). Sixteen morphometric variables-total length, standard length, fork length, head length, pre-dorsal length, dorsal fin length, post-dorsal length, caudal fin length, caudal height, snout length, eye diameter, pectoral fin length, pelvic fin length, pre-anal length, post-anal length and body width-were measured following standard procedures (Fig 2). Five meristic characters, including counts of dorsal, caudal, anal, ventral and pectoral fin rays, were recorded following Sharma et al., (2014), Menon (1992), Hossen et al., (2016) and Paunikar and Panwar (2021). All measurements were taken from the snout tip to defined anatomical landmarks using a vernier caliper supported by a metal divider, with precision up to 0.1 cm. Body weight was recorded to the nearest 0.1 g using an electronic single-pan balance after removing excess water and debris. The collected morphometric and meristic data were used to compute minimum, maximum, range and percentage variation for each trait.

Fig 1: Geographic representation of the sampling site along the Koyna River, located within the Western Ghats, India.



Fig 2: Morphometric measurements of Botia striata (Rao, 1920) from the Koyna River, Western Ghats, India.


       
The length-weight relationship (LWR) of fish specimens was established using the logarithmic transformation approach proposed by Le Cren (1951). The association between total length (cm) and body weight (g) was quantified using the length-weight equation:
 
W = aLb 
 
Where
‘a and b’ = Represent the relationship’s intercept and slope or growth coefficient, respectively.

To determine these parameters, a linear regression analysis was conducted on the logarithmically transformed equation:
 
log (W) = log (a)±b log (L)
 
Where
“a” = Stood for the relationship’s intercept.
“b” = Its slope or growth constant.
       
The values of the compiled growth condition were used for the calculation of the condition factor (K) was calculated by the formula:

 
Where,
W = Total body weight (g).
L = Total length (cm).
b = Growth constant.
       
Conservation management faces significant challenges in the accurate identification of fishery resources, particularly eggs, larvae and juvenile stages, due to pronounced morphological similarities among closely related taxa (Balaganesan et al., 2025). DNA barcoding has emerged as a robust species categorization tool, enabling the assignment of unknown specimens to recognised species through the analysis of standardized DNA barcode sequences and has been successfully applied across a wide range of organisms (Schindel and Miller, 2005; Rathipriya et al., 2022). In this context, molecular approaches, especially DNA barcoding, offer a reliable and precise means of species authentication. Accordingly, for biotechno- logical assessment, muscle tissue was dissected from the right side of each specimen and immediately preserved in 95% ethanol for subsequent genomic DNA extraction. Genomic DNA was extracted from approximately 25-40 mg of ethanol-preserved tissue using the standard phenol-chloroform-isoamyl alcohol protocol described by Sambrook and Russell (2001). The mitochondrial Cytochrome c Oxidase Subunit I (COI) gene was selected for molecular analysis and amplified using the universal primers FishF1 (5′ - TCAACCAACCACAAAGACATT GGCAC-3′) and FishR1 (5′ -TAGACTTCTGGGTGGCCAA AGAATCA-3′) (Ward et al., 2005). PCR reactions were performed in a 25 μl volume containing 1× PCR buffer, 2 mM MgCl‚ , 100 μM of each dNTP, 5 pmol of each primer, 2 U of Taq DNA polymerase and approximately 100 ng of template DNA. Thermal cycling conditions consisted of an initial denaturation at 94oC for 3 min, followed by 35 cycles of denaturation at 94oC for 50 s, annealing at 54oC for 30 s and extension at 72oC for 80 s, with a final extension at 72oC for 10 min. PCR products were purified with ExonucleaseI and FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific) and sequenced using the Sanger dideoxyn-ucleotide chain-termination method (Sanger et al., 1977) on an ABI 3500 Genetic Analyser (Applied Biosystems, USA).
       
The obtained COI sequences were curated by visual inspection of chromatograms in FinchTV, with trimming of ambiguous bases and submitted to GenBank under accession number PV564526. Sequence identity was confirmed using BLASTn searches against the GenBank nucleotide database. Genetic divergence within and between species was estimated in MEGA 12 (Kumar et al., 2024) and phylogenetic relationships were inferred using the maximum likelihood method.
Morphometric and meristic characterisation
 
The morphometric characterisation of Botia striata (Rao, 1920) was conducted and the traits are illustrated in Fig 2. The total length (TL) ranged from 3.2 to 5.6 cm and body weight (BW) varied between 0.600 and 3.800 g (Table 1). The morphometric parameters were described in Table 1, where fork length was 2.900-5.400 (4.649±0.032), noted the largest one contributing 80.952-96.875 (93.488±0.124%), while eye diameter was 0.200-0.400 (0.325±0.003), noted the smallest one that contributed 5.357-7.895 (6.543±0.047%). Furthermore, the multiple correlation for various morphometric variables was calculated and it was noted that the correlation coefficient (r) was maximum (0.983) and minimum (0.409) in total length v/s fork length and eye diameter v/s snout length, respectively (Fig 3). Comparative analysis revealed a close morphological resemblance between Botia striata and Nemacheilus triangularis, as previously reported by Mercy et al., (2007) and with Botia birdi, as documented by Sharma et al., (2014). These findings highlight the taxonomic and morphological affinities of Botia striata within its related taxa, providing valuable insights into its structural and developmental characteristics.

Table 1: Observations and their percentages with different morphometric parameters of Botia striata (Rao, 1920) from the Koyna River, Western Ghats, India.



Fig 3: Correlation among the different morphometric variables of Botia striata (Rao, 1920) from the Koyna River, Western Ghat of India.


       
The meristic characteristics of the examined specimens were recorded as follows: Dorsal fin rays (I-9), caudal fin rays (18.0), anal fin rays (I-6), ventral fin rays (I-8) and pectoral fin rays (13.0), as detailed in Table 2. These meristic counts exhibit notable similarity to the findings reported by Hossen et al., (2016) for Botia lohachata and by Paunikar and Panwar (2021) for Nemacheilus botia, indicating consistency in fin-ray patterns across related loach species. However, despite this meristic overlap, Botia striata can be distinguished in the field by its well-defined vertical zebra-like bands, deeper laterally compressed body and the presence of a distinct movable suborbital spine, a diagnostic feature of botiid loaches.

Table 2: Meristic counts of the Botia striata from the Koyna River.


 
Length-weight relationship (LWR) and condition factor (K)
 
The length-weight relationship of Botia striata was analysed based on measured total length (TL), standard length (SL) and weight (WT) variables and results were depicted that the intercept was 1.974 and 1.594, the correlation coefficient (R2) was 0.880 and 0.925 and the growth constant (b) was 2.395 and 2.597 in total length v/s weight and standard length v/s weight, respectively (Fig 4 and 5). The correlation coefficient indicates a strong positive relationship between total length, standard length and weight. In contrast, the growth constant reveals negative allometric growth of the fish in the studied area. The ‘b’ values of the LWR for B. striata in this study were within the limits reported by Carlander (1969). Our findings align with those reported by Sui et al., (2015), Froese and Pauly (2021), Khan and Sabah (2013), Bashir et al., (2016) and Sheikh and Ahmed (2019), reinforcing the consistency of observed trends across various studies. The condition factor of zebra loach was analysed and found to range from 1.190 to 2.799, with a mean value of 2.074±0.012 (Table 1), which serves as an indicator of the overall health and well-being of the studied fish supported by Caldwell and Beyer (1987). These analyses provide valuable insights into the species’ growth dynamics, morphological variation and physiological condition, contributing to a more comprehensive understanding of its ecological adaptations and population structure. To account for seasonal variations influencing the parameter b, fish specimens were categorised based on their capture period: cold season (fall and winter) and warm season (spring and summer) (Zaher et al., 2015). Wherever a significant seasonal effect was not evident, the evaluation of b proceeded at a broader temporal scale. Given the influence of environmental factors and the physiological state of fish, the value of b may diverge from the theoretical isometric growth coefficient of 3, as established by Ricker (1958). When b < 3, fish exhibit negative allometric growth, becoming progressively thinner as their length increases. Conversely, when b > 3, fish demonstrate positive allometric growth, signifying increased weight gain and optimal growth conditions.

Fig 4: Length weight relationship (total length and weight) of Botia striata (Rao, 1920) from the Koyna River, Western Ghat of India.



Fig 5: Length weight relationship (standard length and weight) of Botia striata (Rao, 1920) from the Koyna River, Western Ghat of India.


       
This variation in growth patterns is further reflected in the seasonal fluctuations of the condition factor (K value) of B. dario, as reported by Haque and Biswas (2014), with values ranging from 1.03 to 1.11. These findings align closely with the results of the present study, reinforcing the role of environmental conditions in shaping fish physiology. Moreover, the consistency of these trends, as documented by previous researchers-including Dasgupta (1991) and Paswan et al., (2012) -highlights the broader applicability of these observations across different studies. Taken together, these insights emphasise the necessity of incorporating seasonal and environmental considerations when assessing fish condition and habitat quality, ensuring a more comprehensive understanding of aquatic ecosystems.

DNA barcoding
 
A total of 662 base pairs of the mitochondrial cytochrome c oxidase subunit I (COI) gene were analysed from Botia striata sequences. The overall nucleotide composition consisted of 57.3% adenine and thymine (AT) and 42.7% guanine and cytosine (GC) content. Codon position-specific analysis revealed an AT content of 56.56% at the 1st codon position, 71.04% at the 2nd position and 44.09% at the 3rd position, indicating notable codon bias typically observed in mitochondrial genes. Model selection for nucleotide substitution was conducted using the Bayesian Information Criterion (BIC) in MEGA software. The best-fit model identified was the Tamura 3-parameter model with invariant sites (T92+I). This model was subsequently employed for Maximum Likelihood (ML) phylogenetic analysis, providing a robust framework for evaluating evolutionary relationships among the sequences. The pairwise genetic distances (p-distance) among five Botia striata sequences ranged from 0 to 0.6%, indicating very low intraspecific variation. The sequence from the present study (KRCIFE01) showed 0-0.6% divergence compared to GenBank sequences. The Maximum Likelihood (ML) phylogenetic tree presented in Fig 6, derived from COI gene sequences, validated the identification of the Botia striata specimen from this study (KRCIFE01). It exhibited strong clustering with a bootstrap support of 97%, aligning closely with other B. striata sequences from GenBank (KF738186, KX384742). All B. striata sequences formed a distinct clade with 96% support, clearly separated from the outgroup species Channa stewartii (MK599531), indicating strong genetic relatedness and validating species-level identification. Hebert et al., (2003) introduced the concept that a short nucleotide sequence from the mitochondrial genome could serve as a DNA barcode for species identification, particularly in eukaryotic organisms, with a primary focus on animals. This approach has demonstrated its efficacy as a rapid and accurate method for identifying biological specimens. Several studies have validated the efficacy of COI-based DNA barcoding in distinguishing closely related fish species (Steinke et al., 2005; Ward et al., 2005; Ratnasingham and Hebert, 2007; Hubert et al., 2008; Lakra et al., 2011; Chandra et al., 2012; Ambili et al., 2014; Alam et al., 2020; Goswami et al., 2022), reinforcing its utility in taxonomic classification and biodiversity assessment. These findings further establish the utility of mitochondrial markers in differentiating and classifying fish species with high precision.

Fig 6: Maximum likelihood (ML) phylogenetic tree based on mitochondrial COI gene sequences.

The present investigation employed an integrative approach, combining morphological and molecular methodologies, to establish foundational reference data for Botia striata populations inhabiting the Western Ghats ecosystem of India. Morphometric analyses revealed distinct structural patterns, accompanied by consistent meristic counts and a negative allometric growth trajectory, collectively indicative of favourable population vitality. The condition factor further substantiated the overall physiological well-being of the species. Molecular validation via Cytochrome c oxidase I (COI) barcoding corroborated the taxonomic identity of B. striata, with negligible intraspecific genetic variation, suggesting a genetically cohesive population structure. These multidimensional insights offer a comprehensive baseline essential for targeted conservation initiatives and underscore the synergistic utility of classical taxonomy and molecular diagnostics in advancing biodiversity management frameworks.
The authors gratefully acknowledge the Director and Vice-Chancellor of the ICAR-Central Institute of Fisheries Education, Mumbai, for providing the necessary research facilities to carry out this study. We also extend our sincere appreciation to Dr. N.C. Ujjania, Mr. Samad Sheikh and Dr. Mahendra Verma for their valuable support and guidance in specific components of the research. The first author further acknowledges the Indian Council of Agricultural Research (ICAR) for providing a doctoral fellowship.
The authors declare that there is no conflict of interest.

  1. Alam, A., Chadha, N.K., Kumar, A.P., Chakraborty, S.K., Joshi, K.D., Sawant, P.B., Das, S.C.S., Kumar, J. and Kumar, T. (2020). DNA barcoding and biometric investigation on the invasive Oreochromis niloticus (Linnaeus, 1758) from the River Yamuna of Uttar Pradesh. Indian Journal of Animal Research. 54(7): 856-863. doi: 10.18805/ijar.B-3833.

  2. Ambili, C.S., Nandan, S.B., Jayasankar, P., Krishnan, P. and Lakra, W.S. (2014). DNA barcoding of commercially important fishes of Indian seas. Mitochondrial DNA. 25(4): 270-278.

  3. Balaganesan, M., Shanmugam, S.A., Kathirvelpandian, A., Agarwal, D., Ramya, R. and Suresh, E. (2025). Character-based identification system (CBIS) for authentication and conservation of fishes from the Thamirabarani River, Western Ghats of India. Indian Journal of Animal Research. 59(12): 2028-2036. doi: 10.18805/IJAR.B-5403.

  4. Bashir, A., Sharma, N.K., Bisht, B.S., Singh, R., Mir, J.I. and Akhtar, M.S. (2016). Length-weight relationship of five commercially important freshwater fish species in the Kashmir Valley, India. Journal of Applied Ichthyology. 32(4): 740-741.

  5. Beverton, R.J.H. and Holt, S.J. (1957). On the Dynamics of Exploited Fish Populations. Blackburn Press. 

  6. Bohlen, J. and Šlechtová, V. (2016). Leptobotia bellacauda, a new species of loach from the lower Yangtze Basin in China (Teleostei: Cypriniformes: Botiidae). Zootaxa. 4205(1): 65-72.

  7. Caldwell, N.J. and Beyer, J.E. (1987). On length-weight relationships. Part I: Computing the mean weight of the fish of a given length class. Fishbyte. 5: 11-13.

  8. Carlander, K.D. (1969). Handbook of Freshwater Fishery Biology, Vol. 1. Iowa State University Press, Ames, IA.

  9. Chandra, G., Asokan, P.K., Afsal, V.V., Rajagopal, S. and Gopala krishnan, A. (2012). DNA barcoding of marine fish species from Indian waters. Indian Journal of Fisheries. 59(4): 123-130.

  10. Dahanukar, N. (2013). Botia striata. The IUCN Red List of Threatened Species 2013: e.T168591A6521075. International Union for Conservation of Nature (IUCN). https://doi.org/ 10.2305/IUCN.UK.2011-1.RLTS.T168591A6521075.en.

  11. Dahanukar, N., Raut, R. and Bhat, A. (2004). Distribution, endemism and threat status of freshwater fishes in the Western Ghats of India. Journal of Biogeography. 31(1): 123-136.

  12. Dasgupta, M. (1991). Length-weight relationship and condition factor (K value) for Tor putitora from Garo Hills, Meghalaya. Indian Journal of Fisheries. 38(1): 35-38.

  13. Dey, A., Sarkar, D. and Barat, S. (2015). Spawning biology, embryonic development and captive breeding of vulnerable loach Botia dario (Hamilton). Journal of Entomology and Zoology Studies. 3(6): 183-188.

  14. Froese, R. (2006). Cube law, condition factor and weight-length relationships: History, meta-analysis and recommendations. Journal of Applied Ichthyology. 22(4): 241-253.

  15. Froese, R. and Pauly, D. (2021). FishBase. Available at: www.fishbase. org. Accessed June 2021.

  16. Goswami, M., Kumar, A.P., Patil, G.S., George, T., Nath, R., Bhuyan, R.N., Siva, C., Laskar, M.A. and Sumer, S. (2022). Molecular identification of ornamental loaches of NE India using mitochondrial genes. Animal Gene. 26: 200136.

  17. Guo, H., Zhang, Y., Tang, W., Liu, D. and Zhang, X. (2020). Length- weight relationships of ten fish species from the Jingjiang Reach of the Yangtze River, China. Journal of Applied Ichthyology. 36(3): 369-372.

  18. Haque, S. and Biswas, S.P. (2014). Length-weight relationship and condition factor of Botia dario (Hamilton-Buchanan) from Sivasagar district. International Journal of Fisheries and Aquatic Studies. 2(1): 244-247.

  19. Hebert, P.D.N., Cywinska, A., Ball, S.L. and Waard, J.R. (2003). Biological identifications through DNA barcodes. Proceedings of the Royal Society B. 270: 313-322.

  20. Hebert, P.D.N., Ratnasingham, S. and Waard, J.R. (2003). Barcoding animal life: Cytochrome coxidase subunit 1 differences among closely related species. Royal Society of London B (Supplement). 270: 96-99.

  21. Hossen, M.A., Hossain, M.Y., Pramanik, M.N.U., Nawer, F., Khatun, D., Parvin, M.F. and Rahman, M.M. (2016). Morphological characters of Botia lohachata. Journal of Coastal Life Medicine. 4(9): 689-692.

  22. Hubert, N., Hanner, R., Holm, E., Mandrak, N.E., Taylor, E., Burridge, M. et al. (2008). Identifying Canadian freshwater fishes through DNA barcodes. PLoS One. 3(6): e2490.

  23. Jadhav, B.V., Kharat, S.S., Raut, R.N., Paingankar, M. and Dahanukar, N. (2011). Freshwater fish fauna of Koyna River, Northern Western Ghats, India. Journal of Threatened Taxa. 3(1): 1449-1455.

  24. Kalayci, F., Samsun, N., Bilgin, S. and Samsun, O. (2007). Length-weight relationship of 10 fish species caught by trawls from the Middle Black Sea. Turkish Journal of Fisheries and Aquatic Sciences. 7: 33-36.

  25. Keskar, A., Padhye, A. and Dahanukar, N. (2014). Fighting against all odds: Hill stream loaches of Western Ghats. Mini- Newsletter of the Freshwater Fish Specialist Group (FFSG). 2: 25-29.

  26. Khan, M.A. and Sabah (2013). Length-weight and length-length relationships for five fish species from Kashmir Valley. Journal of Applied Ichthyology. 29(1): 283-284.

  27. Kottelat, M. (2004). Botia kubotai, a new species of loach (Teleostei: Cobitidae) from the Ataran River basin (Myanmar), with comments on botiine nomenclature and diagnosis of a new genus. Zootaxa. 401: 1-18.

  28. Kumar, S., Stecher, G., Suleski, M., Sanderford, M., Sharma, S. and Tamura, K. (2024). Molecular evolutionary genetics analysis  version 12. Molecular Biology and Evolution. 41: 1-9.

  29. Lagler, K.F. (1952). Freshwater Fishery Biology. Wim C. Brown Co., Dubuque, Iowa.

  30. Lakra, W.S., Verma, M.S., Goswami, M., Lal, K.K., Mohindra, V., Punia, P., Gopalakrishnan, A., Singh, K.V., Ward, R.D. and Hebert, P.D.N. (2011). DNA barcoding Indian marine fishes. Molecular Ecology Resources. 11: 60-71.

  31. Le Cren, E.D. (1951). The length-weight relationship and seasonal cycle in perch. Journal of Animal Ecology. 20: 201-219.

  32. Menon, A.G.K. (1992). Taxonomy of mahseer fishes of genus Tor. Journal of the Bombay Natural History Society. 899: 210-228.

  33. Mercy, T.V.A., Rema Devi, K. and Indra, T.J. (2007). Freshwater fishes of the Western Ghats, India. Zoological Survey of India, Kolkata. pp. 259.

  34. Meshram, M.M., Rajesh, M., Rajesh, K.M. and Suyani, N.K. (2021). Morphology and condition factor of Sphyraena obtusata. Indian Journal of Geo-Marine Sciences. 50: 480-488.

  35. Mir, F.A., Mir, J.I. and Chandra, S. (2014). Detection of morphometric differentiation in snowtrout. Revista de Biologia Tropical. 62(1): 119-127.

  36. Moore, W.S. (1995). Inferring phylogenies from mtDNA variation. Evolution. 49: 718-726.

  37. Nalbant, T.T. (2002). Sixty million years of evolution. Part one: Family Botiidae (Pisces: Ostariophysi: Cobitoidea). Travaux du Muséum National d’Histoire Naturelle “Grigore Antipa”. 44: 309-333.

  38. Nelson, J.S. and Wilson, M.V.H. (1998). Origin and Phylogenetic Interrelationships of Teleosts. Verlag Dr. Friedrich Pfeil, München. pp. 295-316.

  39. Paswan, G., Abujam, S.K.S., Dey, M. and Biswas, S.P. (2012). Length-weight relationship of Trichogaster. Journal of Bio Innovations. 1(1): 6-13.

  40. Paunikar, S. and Panwar, S. (2021). Morphometric and meristic study of freshwater fishes of Song River. Journal of Entomology and Zoology Studies. 9(5): 288-292.

  41. Poria, M., Fathali, N., Ghanbary, K. and Poria, H. (2013). Interrelationship between morphometric variables in Capoeta trutta. World Journal of Fish and Marine Sciences. 5(6): 674-679.

  42. Rao, C.R.N. (1920). On some new fishes from the Western Ghats. Records of the Indian Museum. 19: 19-25.

  43. Rathipriya, A., Kathirvelpandian, A., Shanmugam, S.A., Uma, A., Suresh, E. and Felix, N. (2022). Character-based diagnostic keys, molecular identification and phylogenetic relationships of fishes based on mitochondrial gene from Pulicat Lake, India: A tool for conservation and fishery management purposes. Indian Journal of Animal Research. 56(8): 933-940. doi: 10.18805/IJAR.B-4905.

  44. Ratnasingham, S. and Hebert, P.D.N. (2007). The barcode of life data system. Available at: www.barcodinglite.org.

  45. Ricker, W.E. (1958). Handbook of Computations for Biological Statistics of Fish Populations. Bulletin of the Fisheries Research Board of Canada. 119: 1-300.

  46. Sambrook, J. and Russell, D.W. (2001). Molecular cloning: A Laboratory Manual. 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

  47. Sanger, F., Nicklen, S. and Coulson, A.R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74(12): 5463-5467.

  48. Schindel, D.E. and Miller, S.E. (2005). DNA barcoding a useful tool for taxonomists. Nature. 435. pp 17.  

  49. Shah, N.P., Ujjania, N.C. and Pardeshi, A. (2024). Morphometry of stripped catfish culture. Ecology, Environment and Conservation. 30(SI): 449-454.

  50. Shaji, C.P., Easa, P.S. and Gopalakrishnan, A. (2000). Freshwater fish diversity of Western Ghats. In: Endemic Fish Diversity of Western Ghats. NBFGR-NATP Publication, Lucknow. pp. 35-35.

  51. Sharma, N.K., Mir, J.I., Pandey, N. and Singh, R. (2014). Morphometric and meristic characteristics of Botia birdi. World Journal of Fish and Marine Sciences. 6(3): 262-266.

  52. Sheikh, Z.A. and Ahmed, I. (2019). Length-weight relationship of seven indigenous fish species of Kashmir Himalaya. Iranian Journal of Ichthyology. 6(3): 240-243.

  53. Shuman, L.A., Selyukov, A.G., Nekrasov, I.S., Elifanov, A.V. and Yurchenko, V.V. (2022). Data on length-weight and condition factor of Rutilus rutilus and Perca fluviatilis. Data in Brief. 42: 108067.

  54. Sokal, R. and Rohlf, F. (1987). Biometry: Principles and Practice of Statistics in Biological Research. 2nd ed.

  55. Steinke, D., Vences, M., Salzburger, W. and Meyer, A. (2005). TaxI: A software tool for DNA barcoding. Philosophical Transactions of the Royal Society B. 360: 1847-1857.

  56. Sui, X.Y., Li, X.Q., Sun, H.Y. and Chen, Y.F. (2015). Length-weight relationship of 13 species from Ili River. Journal of Applied Ichthyology. 31(6): 1155-1157.

  57. Suyani, N.K., Rajesh, M., Rajesh, K.M., Meshram, M.M. and Vandana, K. (2021). Morphometry and condition factor of Odonus niger. Journal of Environmental Biology. 42: 1026-1032.

  58. Talwar, P.K. and Jhingran, A.G. (1991). Inland Fishes of India and Adjacent Countries, Vol. 2. A.A. Balkema, Rotterdam.

  59. Ujjania, N.C. (2003). Comparative Performance of Indian Major Carps. Ph.D. Thesis, ICAR-CIFE, Mumbai.

  60. Ujjania, N.C. and Chaudhari, S.H. (2021). Assessment of growth pattern of Catla catla in Vallabhsagar Reservoir. International Journal of Livestock Research. 11(1): 69-74.

  61. Ward, R.D., Zemlak, T.S., Innes, B.H., Last, P.R. and Hebert, P.D.N. (2005). DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B: Biological Sciences. 360: 1847-185.

  62. Zaher, F.M., Rahman, B.M.S., Rahman, A., Alam, M.A. and Pramanik, M.H. (2015). Length-weight relationship and gonadosomatic index of hilsa, Tenualosa ilisha (Hamilton, 1822) fishes in Meghna River, Bangladesh. International Journal of Natural and Social Sciences. 2: 82-88.

  63. Zhao, J., Cao, J., Tian, S., Chen, Y., Zhang, S. and Zhou, X. (2017). Influence of sampling frequency on detectability of fish communities. Aquaculture and Fisheries. 2(2): 94-102.
In this Article
Published In
Indian Journal of Animal Research

Editorial Board

View all (0)