volume 59 special issue (november 2025) : 108-114,   Doi: 10.18805/IJARe.A-6464

Multifaceted Plant Growth Promoting Yeasts Isolated from Rice and its Functional Characterization

G
Geethanjali Muthuramalingam1
S
Shobana Narayanasamy1
A
Akihiko Kamoshita2
S
Sivakumar Uthandi1,*
1Biocatalysts Laboratary Department of Agricultural Microbiology, Tamil Nadu Agricultural University, Coimbatore-641 003, Tamil Nadu, India.
2Asian Research Centre for Bioresources and Environmental Sciences, Graduate School of Agricultural and Life Sciences, The University of Tokyo.
Cite article:- Muthuramalingam Geethanjali, Narayanasamy Shobana, Kamoshita Akihiko, Uthandi Sivakumar (2025). Multifaceted Plant Growth Promoting Yeasts Isolated from Rice and its Functional Characterization . Indian Journal of Agricultural Research. 59(2025): 108-114. doi: 10.18805/IJARe.A-6464.

Background: Rice is a staple food crop worldwide and enhancing its resilience to abiotic stress such as drought is crucial for sustainable agriculture.

Methods: In this study, yeast strains associated with rice plants were isolated and characterized for their plant growth-promoting (PGP) traits. Yeasts isolated from rice rhizosphere VIR1, DIN2 and VIR3 were evaluated for key PGP traits such as 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase activity, production of indole-3-acetic acid (IAA), siderophore and mineral solubilization.

Result: Among them, isolate VIR1 demonstrated the highest activity, producing ACC deaminase (112.5±0.8 nmol a-ketobutyrate mg-1 protein h-1), IAA (12.5±1.0 mg mL-1), siderophores (36.8±2.3% SU), phosphate solubilization (86.7±0.6 mg mL-1) and zinc solubilization (11.9±0.9 mg mL-1). Molecular identification using 18S rRNA gene sequencing revealed VIR1 and VIR3 as Candida tropicalis and Saccharomyces cerevisiae, respectively. 

One of the most important foods on Earth, rice (Oryza sativa L.) is consumed by around three billion people every day. To keep up with economic demands, rice output must increase in response to the growing population. This prompted a shift in emphasis towards more efficient farming methods, including the introduction of high-yielding rice varieties, better irrigation strategies and cutting-edge agricultural technology (Yang et al., 2019). In spite of these advancements, rice output is still low in several parts of the world due to issues connected to biotic and abiotic stress. According to Narayanasamy and Uthandi (2024), drought is one of the abiotic factors that impacts almost 42 million hectares of rice production in Asia. Damage to rice crops and the production of harmful oxidative stress from reactive oxygen species (ROS) are consequences of drought stress, which interferes with the plant’s morpho-physiological, biochemical and molecular responses (Ghosh et al., 2020). A potential solution to these problems is to harness the power of plant growth-promoting (PGP) microbes. These bacteria can improve plant development, increase yield and aid in disease defence while reducing the impact of biotic and abiotic pressures. Environmental factors likely influence the survival, development and interaction of PGPR with host plants, which in turn affects their performance, making the application of PGPR questionable (Gouda et al., 2018). On the other hand, new research has shown that yeasts which are unicellular fungi that occur naturally in soil and on plant surfaces are crucial for the expression of PGP characteristics. These yeast varieties are gaining attention as fascinating microbiological alternatives for use in sustainable agriculture; they are also safe to cultivate (Singh and Gaur, 2021). A wide range of yeast genera isolated from the soil, rhizosphere, phyllosphere and other parts of the plants (Abdel-Kareem  et al., 2021; Bright et al., 2022; Muthukrishnan et al., 2024) exhibits various PGP traits, which includes the production of phytohormones such as Indole acetic acid, Gibberellic acid, cytokinin, exopolysaccharides (EPS), nutrient solubilisation, iron chelation, ACC deaminase (ACCD), production of hydrolytic enzymes, antagonistic action against potential phytopathogens (Nimsi et al., 2023; Ruspi et al., 2025; Ruspi et al., 2024) and stimulation of mycorrhizal-root colonisation (Sarabia et al., 2018). Moreover, according to Ruspi et al. (2025), the main yeast genera that display PGP features and have the ability to improve plant development and stress resilience include Rhodotorula spp., Candida spp., Saccharomyces and Cryptococcus. Nevertheless, there is a lack of study on the use of PGPY as bioinoculants and the exact method by which PGPY may affect plant growth remains unclear. Research has shown that certain bacterial and fungal biofertilizers can be used to support sustainable rice production. These include Azospirillum, Pseudomonas, Bacillus, Phosphobacteria, Methylobacterium, Burkholderia, Azotobacter, Trichoderma spp., Gliocladium virens and Arbuscular mycorrhizal fungi (Adedayo and Babalola, 2023; Nimsi et al., 2023) to name a few. Despite yeasts’ reputation for safety and their many useful PGP features, research and development into bioinoculants derived from yeasts for rice is limited. With this background, it is postulated that the multifunctional PGP features exhibited by native yeast strains associated with rice plants could improve plant health and fitness when exposed to harsh climatic conditions. So far, this study has cleared the way for the creation of new yeast-based bio-stimulants for environmentally friendly rice cultivation by identifying and characterising native yeast species in the rice plant’s phyllosphere and rhizosphere and by testing their PGP traits.
Survey details and sample collection
 
We chose three sites in Tamil Nadu to collect soil and crop samples from because their soil types, cropping patterns, fertilizer management and crop durations were different. The fields of Dindigul (S1), Virudhunagar-Narikudi (S2) and Kundukulam (S3) were sampled for rice rhizosphere soil, roots and leaves at 10o25'18.48" N, 78o05'32.64"E, 9o35'06.32" N and 77o57'28.33" E, respectively. Samples were taken following the 25th day of crop establishment in all districts that used organic nutrient management. While S1 and S3 grew RNR rice, S2 included white ponni. In S1 and S2, the crop sequence is rice followed by vegetables, whereas in S3, the crop sequence is rice monocropping. The soil and roots of healthy rice plants were extracted from a depth of 10-20 cm, which is known as the rhizosphere. At 4oC, soil samples were collected from five separate plots, combined and sent in a polypropylene sample box for further examination.
 
Isolation and characterization of yeast from rice
 
Using the conventional serial dilution technique, yeast was isolated from the rice plant samples (rhizosphere soil, stem, root and leaves). The root and leaf segments were immersed in 70% ethanol for 1 minute, then in 5% sodium hypochlorite for 3 minutes. After that, they were treated with 70% ethanol for 30 seconds and finally, they were rinsed three times with sterile distilled water, in order to isolate endophytic yeast. Following the sterilisation of the root and leaf samples, they were ground in a phosphate buffer (Mahaffee  and Kloepper, 1997). The resulting homogenate was further diluted in a series of steps up to a concentration of 10-8. Soil samples were placed in yeast peptone dextrose (YPD) plates after being serially diluted and then incubated at 28oC. The YPD agar plates allowed for the observation and purification of yeast colonies with different morphologies. For long-term maintenance, the cultures were kept in 30% glycerol stocks and stored at -80oC (Robinson and Erasmus, 2016).
 
Functional characterization of yeast isolates for their PGP attributes
 
IAA production
       
Yeast isolates at log phase growth were inoculated into 100 mL of YPD broth containing 1.0 mM L-tryptophan and incubated at room temperature for 7 days. A parallel culture without tryptophan supplementation was maintained as a control. Following incubation, 1.5 mL of yeast culture was centrifuged at 8000 rpm for 10 min and the supernatant was collected separately. Accurately 4 mL of Salkowski reagent comprising 0.5 M ferric chloride (FeCl3) and 35% perchloric acid (HClO4) was added to the supernatant as described (Mohite, 2013). The reaction mixture was incubated for 30 min at room temperature in a darkened environment and the absorbance was measured at 520 nm and expressed as µg mL-1.
 
ACC deaminase activity
 
Quantitative estimation of ACC deaminase (ACCd) activity was conducted following the protocol outlined (Honma and Shimomura, 1978). The yeast isolates were cultured in 5 mL of tryptic soy broth (TSB) at room temperature for 24 h. Following cultivation, the cells were harvested by centrifugation at 3000 rpm for 5 min, then resuspended and washed twice with 0.1 M Tris-HCl (pH 7.5). The resulting cell pellet was resuspended in 2 mL of modified dworkin and foster (DF) minimal medium supplemented with 3 mM ACC as the sole nitrogen source. Cultures were incubated at 37oC for 2-3 days under agitation on an orbital shaker. ACC deaminase activity was quantified by measuring the concentration of a-ketobutyrate produced and the enzymatic activity was expressed as nanomoles of a-ketobutyrate released per milligram of protein per hour (nmol a-ketobutyrate mg-1 protein h-1).
 
Siderophore production
 
Quantitative estimation of siderophore was carried out by growing yeast cultures [~108 colony-forming units (cfu) mL-1] in Fiss Glucose medium (Vellore, 2001) at 37±2°C in a rotary shaker set at 180 rpm. After 72 h of incubation, the cultures were centrifuged at 14000 rpm for 20 min at 4oC. Subsequently, 2 mL of the culture supernatant was mixed with 4 mL of CAS solution and incubated in the dark for 10 min. The uninoculated broth with CAS reagent served as a reference. The colour change from blue to yellow was observed by measuring the absorbance at 600 nm, using uninoculated broth without reagent as the blank and siderophore desferrioxamine (up to 50 µM) as the standard (Henderson and Payne, 1994).
 
Nutrient solubilisation
 
Phosphorus solubilization
 
The selected isolates were screened for the quantitative estimation of phosphorus solubilization. Exactly 24 h old cultures of yeast isolates (~108 cfu mL-1) were inoculated into 50 mL of Pikovskaya’s broth containing 0.5% of TCP and incubated in a rotary shaker at 180 rpm for 10 days at 37±2oC (Nautiyal et al., 2000). A blank without inoculation was run simultaneously. Following incubation, the cultures were centrifuged at 12,000 g for 15 min and the supernatant was collected to quantify P solubilisation by the molybdenum blue method (Watanabe and Olsen, 1965). Then, 1 mL of the supernatant was taken for quantification and the pellet was stored at -20oC for protein estimation. To the supernatant (1 mL), 10 mL of ammonium molybdate solution was added and the volume was made up to 45 mL. Furthermore, 5 drops of Chlorostannous acid were added and the final volume was maintained at 50 mL. The mixture was then mixed well and the optical density at 600 nm was determined using a UV-Vis Spectrophotometer. The amount of phosphate solubilized was calculated from the standard curve and expressed as µg mg protein-1.
 
Zinc solubilization
 
Zinc solubilization was assessed in culture medium fortified with 0.1% insoluble zinc compound (ZnO) as described (Bunt and Rovira, 1955). Flasks were inoculated with 1% of metabolically active yeast culture containing a population of 8 x 105 cells. Cultures were incubated under aerobic conditions at 30oC with continuous shaking at 100 rpm for 5 days. Following incubation, the samples were centrifuged at 5000 x g for 15 min and the supernatant was analyzed for pH and soluble zinc content.
 
Production of ammonia and hydrogen cyanide (HCN)
 
Ammonia production by yeast isolates was assessed (Hakim et al., 2021). The isolates were cultured in 10 mL of peptone broth overnight and incubated at 30oC for 48 h in a shaker cum incubator. Following incubation, Nessler’s reagent (0.5 mL) was added to each culture. A colour transition from yellow to dark brown was indicative of a positive reaction for ammonia production. The absorbance was recorded at 450 nm using a spectrophotometer.
       
Hydrogen cyanide (HCN) production by yeast cultures was assessed following the method (Ahmad et al., 2008). The isolates were streaked onto nutrient agar medium fortified with 4.4 g/L glycine. Filter paper discs soaked in a 0.5% picric acid solution were placed on the lids of the Petri dishes, which were then sealed to prevent gas exchange. The sealed plates were incubated at 28oC for 4 days. A colour change from yellow to orange in the filter paper is a positive indicator for HCN production by the yeast isolates.
 
Molecular characterization and identification of selected yeast isolates
 
The genomic DNA of yeast isolates was obtained using the cetyl-trimethyl ammonium bromide (CTAB) method for two isolates (VIR1 and VIR3), which were segregated based on morphological and biochemical characteristics. Yeast species were amplified using primers of NL1 (5' GCATATCAATAAGCGGAGGAAAAG 3') and NL4 (5' GGTCCGTGTTTCAAGACGG 3'). Using NCBI Blast, similarity between the sequences was identified. The phylogenetic tree was constructed using MEGA 11.0 to determine the close and distant relationships between sequences.
Isolation of yeasts
 
A total of three morphologically distinct yeast isolates (VIR1, DIN2 and VIR3) were isolated only from rice rhizosphere soil collected from Virudhunagar (S1 and S3) and Dindigul (S2).  Notably, no isolates were recovered from other niches investigated, viz., root, stem and leaves. The colour of the yeast isolates VIR1 and VIR3 was observed to be creamy white and DIN 2 was light yellowish. The margin and elevation of the respective colonies were smooth and raised.
 
Quantitative assay for IAA production
 
IAA concentrations of the 3 yeast isolates ranged from 6.21 to 12.55 µg mL-1. VIR1 exhibited the highest IAA production (12.55 µg mL-1), followed by DIN2 (8.68 µg mL-1). The lowest IAA production was recorded in VIR3 (6.21 µg mL-1). However, all values were lower than those of the positive control, Bacillus altitudinus FD48, which exhibited a highest IAA concentration of 16.42 µg mL-1 (Fig 1).

Fig 1: Quantitative assay for IAA and siderophore production by yeast isolates VIR1, DIN2 and VIR3 from rice rhizosphere.


 
Quantitative assay for siderophore production
 
Quantitative estimation of siderophore production was performed using the CAS liquid assay. The results revealed that siderophore production ranged from 14.85% to 36.86% siderophore units (% SU). Among the isolates, VIR1 demonstrated the highest siderophore production at 36.86% SU, followed by VIR3 at 23.42% SU and DIN2 at 14.85% SU (Fig 1).
 
Screening for PGP traits
 
Quantitative estimation of nutrient solubilization
 
Quantitative estimation of P and Zn solubilization was carried out in liquid culture under standardized incubation conditions. Phosphorus solubilization was highest in isolate VIR1, with a concentration of 86.78 µg mL-1 of soluble phosphate released into the medium. This was followed by VIR3 and DIN2, which recorded 45.78 µg mL-1 and 23.42 µg mL-1, respectively. Zinc solubilization followed a similar trend. VIR1 exhibited the highest solubilized Zn content (11.92 µg mL-1), followed by VIR3 (7.21 µg mL-1) and DIN2 (4.92 µg mL-1) (Fig 2).

Fig 2: Quantitative assessment of P and Zn solubilization by yeast strains-VIR1.


 
Ammonia and HCN production
 
Among the selected yeast isolates, ammonia production was detected in VIR1 and VIR3. The presence of ammonia was confirmed by the development of a brown to yellow coloration upon the addition of Nessler’s reagent to the culture supernatant, indicating positive ammonia synthesis. In contrast, none of the three isolates demonstrated hydrogen cyanide (HCN) production, as evidenced by the absence of colour change in the picrate assay. 
 
ACC deaminase activity
 
Among the three yeast isolates tested, VIR1 exhibited the highest ACC deaminase activity, recording 112.58 nmol a-ketobutyrate mg-1 protein h-1, followed by VIR3 with 91.94 nmol a-ketobutyrate mg-1 protein h-1. The lowest activity was observed in DIN2, which recorded 71.38 nmol a-ketobutyrate mg-1 protein h-1. In comparison, the positive control, B. altitudinus FD48, showed a significantly higher activity of 173.45 nmol a-ketobutyrate mg-1 protein h-1, indicating a strong ACC deaminase potential (Fig 3).

Fig 3: Quantitative assay for ACCd production (n moles a-ketobutyrate mg-1 protein h-1) by rice yeast isolates, where VIR1, DIN2 and VIR3 are yeast morphotypes.


 
Molecular identification
 
Using sequencing of the internal transcribed spacer (ITS) region, the chosen yeast isolates VIR1 and VIR3 were molecularly characterised. Virtually every amino acid in VIR1 was identical to C. tropicalis, according to phylogenetic analysis, multiple sequence alignment and BLASTn. Fig 4 shows that VIR3 was quite similar to S. cerevisiae, with a similarity score of 99%. Under the accession numbers PQ455181 for C. tropicalis and PQ455185 for S. cerevisiae, the validated sequences were uploaded to the NCBI GenBank database.

Fig 4: Phylogenetic analysis of 18S rRNA of yeast isolates VIR1 and VIR3 from rice rhizosphere constructed using Neighbour Joining Method in MEGA 11.0.


       
Plant growth and health can be enhanced by microbial communities culled from a variety of soil types and biological niches. Because of their capacity to generate enzymes, antioxidants, phytohormones and amino acids, all of which contribute to plant health and biomass accumulation, PGPYs have lately gained a lot of interest as potential bio-stimulants (Koza et al., 2022). Despite the diversity and abundance of yeasts in natural ecosystems, very little is known regarding their presence in agricultural soil (Sarabia et al., 2018). This study set out to identify yeasts in three different places in Tamil Nadu-Sengulathupatti (Dindigul), Kundukulam and Narikudi by isolating them from soil in the rhizosphere as well as stem, root and leaf samples taken from rice plants. Surprisingly, no yeast isolates were obtained from any other plant niche; the three morphologically different isolates, VIR1, DIN2 and VIR3, were all obtained from the soil of the rice rhizosphere. This finding lends credence to the idea that diverse microbial populations in the rhizosphere promote plant health by way of different PGP properties (Sarabia et al., 2018).
       
The ability of the yeast isolates to produce ACC deaminase, which helps plants extend their roots and remain vigorous in the face of abiotic stress, further demonstrated their drought tolerance (Yim et al., 2010). According to Sessitsch et al. (2005), yeast isolates with higher ACC deaminase activity lower ethylene levels and aid plants in surviving abiotic stress. VIR1 had the highest ACCD activity in this investigation, measuring 112.58 n moles a-ketobutyrate mg protein-1 h-1. The results were consistent with those of Hussein’s previous research, which found that the ACCD gene was expressed by Cyberlindnera subhashii YEAST-17, which in turn boosted salinity tolerance in Triticum aestivum (Hussein et al., 2022). Likewise, under stress, pea seedlings (Pisum sativum) were able to grow better when exposed to the ACCd-producing yeast strain DH16 (Kaur and Manhas, 2022).
       
For plants to develop and grow better, they must be able to solubilise nutrients, produce growth-promoting chemicals such IAA, hydrogen cyanide and siderophore and synthesise these substances (Ma et al., 2009). Yeast isolates VIR1 and VIR3 exhibited the highest P and Zn solubilisation in mineral medium supplemented with insoluble sources, according to the present study’s PGP trait screening. By lowering the pH and producing organic acids, phosphorus is more easily soluble and made available to plants (Fankem et al., 2006). Zinc, in contrast to phosphorus, is essential for plants in very little amounts; however, it is an essential element for many plant metabolic and enzymatic processes. This agrees with earlier results, for example, that Cryptococcus laurentii JYC370 successfully dissolved zinc oxide (ZO) and dicalcium phosphate (DCP) with SE units of 1.25 and 1.86, respectively (Fu et al., 2016).
       
It is proposed that auxin production by the isolates is an important strategy for promoting growth. Initiation of root development, regulation of fruit ripening and leaf fall and overall plant growth and development are all impacted by it (Trotsenko et al., 2001). There has been a lot of buzz about the possibility of using microbes that produce IAA as biofertilizers recently (Saharan and Nehra, 2011). The VIR1 strain produced the most IAA (12.55 µg mL¹) out of all the isolates. A range of IAA concentrations, from 38.6±1.7 to 103.9±21.2 µg/mL, has been found in Cryptococcus flavus strains, according to Sun et al. (2014).
       
In order to promote plant growth and minimise plant diseases, several microbes release tiny molecular molecules called siderophores. These chemicals have a strong affinity for ferric iron. The isolates that were part of this study produced siderophores in different ways. Our results corroborated those of Nutaratat and colleagues, who found that the yeast R. paludigenum DMKU-RP301 produced the highest amount of IAA (29.3 mg g-1 DCW) together with NH3 and siderophore (Nutaratat et al., 2014).
       
Additionally, all of the yeast isolates tested here produced ammonia. The generation of ammonia by microbes is a promising PGP activity that could greatly benefit plant growth promotion by increasing nitrogen availability (Mpanga et al., 2019). Two possible PGPYs, VIR1 and VIR3, were isolated from soil in the rice rhizosphere. Using 18S rRNA analysis, they were able to be identified to the species level; VIR1 showed sequence resemblance to C. tropicalis, while VIR3 showed sequence closeness to S. cerevisiae. Our research showed that when these isolates are under stress, they exhibit more PGP traits. This jibes with prior research suggesting that prevalent yeast species such Rhodotorula mucilaginosa, Moesziomyces aphidis, C. tropicalis and Aureobasidium pullulans can stimulate plant development (Fu et al., 2016). In addition, commercial biofertilizer formulations have acknowledged and utilised yeasts including Candida, Geotrichum, Rhodotorula, Saccharomyces and Williopsis for their different advantageous qualities (Nimsi et al., 2023). This study’s findings suggest that C. tropicalis VIR1 and S. cerevisiae VIR3, two yeasts found in the rice rhizosphere, may have PGP properties that could be useful in rice farming. This method encourages ecologically sound, climate-resilient rice cultivation when integrated into the agro-ecosystem. Future research into yeast-based biostimulants in various agro-ecosystems should help with the creation of more productive and environmentally friendly rice cultivation methods.
This research set out to isolate and describe yeast strains from soil in the rice rhizosphere throughout several parts of Tamil Nadu. We obtained three isolates VIR1, DIN2 and VIR3 and tested them for PGP characteristics. The C. tropicalis VIR1 strain had the greatest potential for PGP features, such as IAA (12.5±1.0 mg/ mL-1), ACCd (112.5±0.8 n moles a-ketobutyrate mg protein-1h-1) and siderophore synthesis (36.8±2.3% units). Supporting sustainable rice agriculture, these findings lead to the creation of newer yeast-based bio-stimulants employing C. tropicalis VIR1. These bio-stimulants can boost plant growth in demanding situations. With the help of system biology methods, future research should investigate the signalling pathways linked to yeast-rice interactions. Furthermore, next-generation biostimulants for climate-resilient, sustainable crop production will open new possibilities with large-scale adoption across varied ecosystems and the development of appropriate yeast-based formulations and delivery modalities.
The authors are grateful to Indo-Japan Project for funding Research Assistantship on “Development of AMF -based microbial inoculant package for semi dry rice: Understanding the mechanism of action by metabolomic and gene expression analyses” for financial support to SU.
 
Declarations
 
Ethical approval
 
Not applicable.
 
Author’s contribution
 
Geethanjali Muthuramalingam: Conceptualization, Methodology, Investigation, Software, Writing- original draft. Shobana Narayanasamy: Data curation, Formal analysis, Software, Writing-review and editing. Akihiko Kamoshita: Supervised the workflow, Reviewing, Editing and assisted in manuscript preparation. Sivakumar Uthandi: Conceptualized the workflow, Experimental designing, Investigation, Project supervision. All authors read and approved the final manuscript.
 
Availability of data and materials
 
All data of this manuscript are included. No separate external data source is required. Any additional information required will be provided by communicating with the corresponding author via the official mail: usiva@tnau.ac.in.
The authors declare that they have no competing interests.

  1. Abdel-Kareem, M.M., Zohri, A.-N.A. and Nasr, S.A.E.E. (2021). Novel marine yeast strains as plant growth-promoting agents improve defense in wheat (Triticum aestivum) against Fusarium oxysporum. Journal of Plant Diseases and Protection. 128(4): 973-988.

  2. Adedayo, A.A. and Babalola, O.O. (2023). Genomic mechanisms of plant growth-promoting bacteria in the production of leguminous crops. Frontiers in Genetics. 14: 1276003.

  3. Ahmad, F., Ahmad, I. and Khan, M. (2008). Screening of free-living rhizospheric bacteria for their multiple plant growth promoting activities. Microbiological Research. 163(2): 173-181.

  4. Bright, J.P., Karunanadham, K., Maheshwari, H.S., Karuppiah, E.A.A., Thankappan, S., Nataraj, R., Pandian, D., Ameen, F., Poczai, P. and Sayyed, R.Z. (2022). Seed-borne probiotic yeasts foster plant growth and elicit health protection in black gram (Vigna mungo L.). Sustainability. 14(8): 4618.

  5. Bunt, J. and Rovira, A. (1955). Microbiological studies of some subantarctic soils. Journal of Soil Science. 6(1): 119-128.

  6. Fankem, H., Nwaga, D., Deubel, A., Dieng, L., Merbach, W. and Etoa,  F.X. (2006). Occurrence and functioning of phosphate solubilizing microorganisms from oil palm tree (Elaeis guineensis) rhizosphere in Cameroon. African Journal of Biotechnology. 5(24): 2450-2460.

  7. Fu, S.-F., Sun, P.-F., Lu, H.-Y., Wei, J.-Y., Xiao, H.-S., Fang, W.-T., Cheng, B.-Y. and Chou, J.-Y. (2016). Plant growth-promoting traits of yeasts isolated from the phyllosphere and rhizosphere of Drosera spatulata Lab. Fungal Biology. 120(3): 433-448.

  8. Ghosh, A., Agrawal, M. and Agrawal, S.B. (2020). Effect of water deficit stress on an Indian wheat cultivar [Triticum aestivum  (L.) HD 2967] under ambient and elevated level of ozone. Science of The Total Environment. 714: 136837.

  9. Gouda, S., Kerry, R.G., Das, G., Paramithiotis, S., Shin, H.-S. and Patra, J.K. (2018). Revitalization of plant growth promoting rhizobacteria for sustainable development in agriculture. Microbiological Research. 206: 131-140.

  10. Hakim, S., Naqqash, T., Nawaz, M.S., Laraib, I., Siddique, M.J., Zia,  R., Mirza, M.S. and Imran, A. (2021). Rhizosphere engineering with plant growth-promoting microorganisms for agriculture and ecological sustainability. Frontiers in Sustainable Food Systems. 5: 617157.

  11. Henderson, D.P. and Payne, S.M. (1994). Vibrio cholerae iron transport systems: Roles of heme and siderophore iron transport in virulence and identification of a gene associated with multiple iron transport systems. Infection and Immunity.  62(11): 5120-5125.

  12. Honma, M. and Shimomura, T. (1978). Metabolism of 1-aminocy- clopropane-1-carboxylic acid. Agricultural and Biological Chemistry. 42(10): 1825-1831.

  13. Hussein, K.A., Tohamy, T.A. and El-Maraghy, S.S. (2022). Amino- cyclopropane-1-carboxylate deaminase (ACCD) producing yeasts improved salinity tolerance of Triticum aestivum L. Rhizosphere. 23: 100548.

  14. Kaur, T. and Manhas, R.K. (2022). Evaluation of ACC deaminase and indole acetic acid production by Streptomyces hydrogenans DH16 and its effect on plant growth promotion. Biocatalysis and Agricultural Biotechnology. 42: 102321.

  15. Koza, N.A., Adedayo, A.A., Babalola, O.O. and Kappo, A.P. (2022). Microorganisms in plant growth and development: Roles in abiotic stress tolerance and secondary metabolites secretion. Microorganisms. 10(8): 1528.

  16. Ma, Y., Rajkumar, M. and Freitas, H. (2009). Improvement of plant growth and nickel uptake by nickel resistant-plant-growth promoting bacteria. Journal of Hazardous Materials. 166(2-3): 1154-1161.

  17. Mahaffee, W. and Kloepper, J. (1997). Temporal changes in the bacterial communities of soil, rhizosphere and endorhiza associated with field-grown cucumber (Cucumis sativus L.). Microbial Ecology. 34: 210-223.

  18. Mohite, B. (2013). Isolation and characterization of indole acetic acid (IAA) producing bacteria from rhizospheric soil and its effect on plant growth. Journal of Soil Science and Plant Nutrition. 13(3): 638-649.

  19. Mpanga, I.K., Nkebiwe, P.M., Kuhlmann, M., Cozzolino, V., Piccolo, A., Geistlinger, J., Berger, N., Ludewig, U. and Neumann, G. (2019). The form of N supply determines plant growth promotion by P-solubilizing microorganisms in maize. Microorganisms. 7(2): 38.

  20. Muthukrishanan, G., Munisamy, J., Gopalasubramaniam, S.K., Subramanian, K.S., Dharmaraj, R., Nath, D.J., Dutta, P. and Devarajan, A.K. (2024). Impact of foliar application of phyllosphere yeast strains combined with soil fertilizer application on rice growth and yield. Environmental Microbiome. 19(1): 102.

  21. Narayanasamy, S. and Uthandi, S. (2024). Plant growth promoting signatory volatiles emitted by a drought-tolerant bacterium Bacillus altitudinis FD48 and its role in moisture stress alleviation in rice (Oryza sativa L.). Plant Stress. 14: 100621.

  22. Nautiyal, C. S., Bhadauria, S., Kumar, P., Lal, H., Mondal, R. and Verma, D. (2000). Stress induced phosphate solubilization in bacteria isolated from alkaline soils. FEMS Microbiology Letters. 182(2): 291-296.

  23. Nimsi, K., Manjusha, K., Kathiresan, K. and Arya, H. (2023). Plant growth-promoting yeasts (PGPY), the latest entrant for use in sustainable agriculture: A review. Journal of Applied Microbiology. 134(2): lxac088.

  24. Nutaratat, P., Srisuk, N., Arunrattiyakorn, P. and Limtong, S. (2014). Plant growth-promoting traits of epiphytic and endophytic yeasts isolated from rice and sugar cane leaves in Thailand. Fungal Biology. 118(8): 683-694.

  25. Robinson, P. and Erasmus, L. (2016). Effects of two yeast based direct fed microbials on performance of high producing dairy cows. Animal Feed Science and Technology. 215: 58-72.

  26. Ruspi, C., Casagrande Pierantoni, D., Conti, A., Scarponi, R., Corte, L. and Cardinali, G. (2025). Plant growth-promoting yeasts (PGPYs) as a sustainable solution to mitigate salt-induced stress on zucchini plant growth. Biology and Fertility of Soils. 61(2): 293-309.

  27. Ruspi, C., Pierantoni, D.C., Conti, A., Favaro, L., Antinori, M.E., Puglisi, E., Corte, L. and Cardinali, G. (2024). Beneficial effects of plant growth-promoting yeasts (PGPYs) on the early stage of growth of zucchini plants. Current Plant Biology. 39: 100357.

  28. Saharan, B. and Nehra, V. (2011). Plant growth promoting rhizobacteria:  A critical review. Life Sci Med Res. 21(1): 30.

  29. Sarabia, M., Jakobsen, I., Grønlund, M., Carreon-Abud, Y. and Larsen, J. (2018). Rhizosphere yeasts improve P uptake of a maize arbuscular mycorrhizal association. Applied Soil Ecology. 125: 18-25.

  30. Sessitsch, A., Coenye, T., Sturz, A., Vandamme, P., Barka, E.A., Salles, J.F., Van Elsas, J., Faure, D., Reiter, B. and Glick, B. (2005). Burkholderia phytofirmans sp. nov., a novel plant-associated bacterium with plant-beneficial properties. International Journal of Systematic and Evolutionary Microbiology. 55(3): 1187-1192.

  31. Singh, N. and Gaur, S. (2021). GRAS fungi: A new horizon in safer food product. Fungi in Sustainable Food Production. pp: 27-37.

  32. Sun, P.-F., Fang, W.-T., Shin, L.-Y., Wei, J.-Y., Fu, S.-F. and Chou, J.-Y. (2014). Indole-3-acetic acid-producing yeasts in the phyllosphere of the carnivorous plant Drosera indica (L.). Plos One. 9(12): e114196.

  33. Trotsenko, Y.A., Ivanova, E. and Doronina, N. (2001). Aerobic methylotrophic bacteria as phytosymbionts. Microbiology. 70: 623-632.

  34. Vellore, J.M. (2001). Iron acquisition in Rhodococcus erythrolpolis: The isolation of mutant (s) that do not produce a siderophore.  East Tennessee State University.

  35. Watanabe, F. and Olsen, S. (1965). Test of an ascorbic acid method for determining phosphorus in water and NaHCO3 extracts from soil. Soil Science Society of America Journal. 29(6): 677-678.

  36. Yang, Y., Guo, M., Sun, S., Zou, Y., Yin, S., Liu, Y., Tang, S., Gu, M., Yang, Z. and Yan, C. (2019). Natural variation of OsGluA2 is involved in grain protein content regulation in rice. Nature Communications. 10(1): 1949.

  37. Yim, W.-J., Chauhan, P., Madhaiyan, M., Tipayno, S. and Sa, T. (2010). Plant Growth Promontory Attributes by 1-aminocyclopropane -1-carboxylate (ACC) Deaminase Producing Methylobacterium  Oryzae Strains Isolated from rice. 19th World Congress of Soil Science, Soil Solutions for a Changing World. Brisbane, Australia: International Union of Soil Sciences.

Multifaceted Plant Growth Promoting Yeasts Isolated from Rice and its Functional Characterization

G
Geethanjali Muthuramalingam1
S
Shobana Narayanasamy1
A
Akihiko Kamoshita2
S
Sivakumar Uthandi1,*
1Biocatalysts Laboratary Department of Agricultural Microbiology, Tamil Nadu Agricultural University, Coimbatore-641 003, Tamil Nadu, India.
2Asian Research Centre for Bioresources and Environmental Sciences, Graduate School of Agricultural and Life Sciences, The University of Tokyo.
Cite article:- Muthuramalingam Geethanjali, Narayanasamy Shobana, Kamoshita Akihiko, Uthandi Sivakumar (2025). Multifaceted Plant Growth Promoting Yeasts Isolated from Rice and its Functional Characterization . Indian Journal of Agricultural Research. 59(2025): 108-114. doi: 10.18805/IJARe.A-6464.

Background: Rice is a staple food crop worldwide and enhancing its resilience to abiotic stress such as drought is crucial for sustainable agriculture.

Methods: In this study, yeast strains associated with rice plants were isolated and characterized for their plant growth-promoting (PGP) traits. Yeasts isolated from rice rhizosphere VIR1, DIN2 and VIR3 were evaluated for key PGP traits such as 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase activity, production of indole-3-acetic acid (IAA), siderophore and mineral solubilization.

Result: Among them, isolate VIR1 demonstrated the highest activity, producing ACC deaminase (112.5±0.8 nmol a-ketobutyrate mg-1 protein h-1), IAA (12.5±1.0 mg mL-1), siderophores (36.8±2.3% SU), phosphate solubilization (86.7±0.6 mg mL-1) and zinc solubilization (11.9±0.9 mg mL-1). Molecular identification using 18S rRNA gene sequencing revealed VIR1 and VIR3 as Candida tropicalis and Saccharomyces cerevisiae, respectively. 

One of the most important foods on Earth, rice (Oryza sativa L.) is consumed by around three billion people every day. To keep up with economic demands, rice output must increase in response to the growing population. This prompted a shift in emphasis towards more efficient farming methods, including the introduction of high-yielding rice varieties, better irrigation strategies and cutting-edge agricultural technology (Yang et al., 2019). In spite of these advancements, rice output is still low in several parts of the world due to issues connected to biotic and abiotic stress. According to Narayanasamy and Uthandi (2024), drought is one of the abiotic factors that impacts almost 42 million hectares of rice production in Asia. Damage to rice crops and the production of harmful oxidative stress from reactive oxygen species (ROS) are consequences of drought stress, which interferes with the plant’s morpho-physiological, biochemical and molecular responses (Ghosh et al., 2020). A potential solution to these problems is to harness the power of plant growth-promoting (PGP) microbes. These bacteria can improve plant development, increase yield and aid in disease defence while reducing the impact of biotic and abiotic pressures. Environmental factors likely influence the survival, development and interaction of PGPR with host plants, which in turn affects their performance, making the application of PGPR questionable (Gouda et al., 2018). On the other hand, new research has shown that yeasts which are unicellular fungi that occur naturally in soil and on plant surfaces are crucial for the expression of PGP characteristics. These yeast varieties are gaining attention as fascinating microbiological alternatives for use in sustainable agriculture; they are also safe to cultivate (Singh and Gaur, 2021). A wide range of yeast genera isolated from the soil, rhizosphere, phyllosphere and other parts of the plants (Abdel-Kareem  et al., 2021; Bright et al., 2022; Muthukrishnan et al., 2024) exhibits various PGP traits, which includes the production of phytohormones such as Indole acetic acid, Gibberellic acid, cytokinin, exopolysaccharides (EPS), nutrient solubilisation, iron chelation, ACC deaminase (ACCD), production of hydrolytic enzymes, antagonistic action against potential phytopathogens (Nimsi et al., 2023; Ruspi et al., 2025; Ruspi et al., 2024) and stimulation of mycorrhizal-root colonisation (Sarabia et al., 2018). Moreover, according to Ruspi et al. (2025), the main yeast genera that display PGP features and have the ability to improve plant development and stress resilience include Rhodotorula spp., Candida spp., Saccharomyces and Cryptococcus. Nevertheless, there is a lack of study on the use of PGPY as bioinoculants and the exact method by which PGPY may affect plant growth remains unclear. Research has shown that certain bacterial and fungal biofertilizers can be used to support sustainable rice production. These include Azospirillum, Pseudomonas, Bacillus, Phosphobacteria, Methylobacterium, Burkholderia, Azotobacter, Trichoderma spp., Gliocladium virens and Arbuscular mycorrhizal fungi (Adedayo and Babalola, 2023; Nimsi et al., 2023) to name a few. Despite yeasts’ reputation for safety and their many useful PGP features, research and development into bioinoculants derived from yeasts for rice is limited. With this background, it is postulated that the multifunctional PGP features exhibited by native yeast strains associated with rice plants could improve plant health and fitness when exposed to harsh climatic conditions. So far, this study has cleared the way for the creation of new yeast-based bio-stimulants for environmentally friendly rice cultivation by identifying and characterising native yeast species in the rice plant’s phyllosphere and rhizosphere and by testing their PGP traits.
Survey details and sample collection
 
We chose three sites in Tamil Nadu to collect soil and crop samples from because their soil types, cropping patterns, fertilizer management and crop durations were different. The fields of Dindigul (S1), Virudhunagar-Narikudi (S2) and Kundukulam (S3) were sampled for rice rhizosphere soil, roots and leaves at 10o25'18.48" N, 78o05'32.64"E, 9o35'06.32" N and 77o57'28.33" E, respectively. Samples were taken following the 25th day of crop establishment in all districts that used organic nutrient management. While S1 and S3 grew RNR rice, S2 included white ponni. In S1 and S2, the crop sequence is rice followed by vegetables, whereas in S3, the crop sequence is rice monocropping. The soil and roots of healthy rice plants were extracted from a depth of 10-20 cm, which is known as the rhizosphere. At 4oC, soil samples were collected from five separate plots, combined and sent in a polypropylene sample box for further examination.
 
Isolation and characterization of yeast from rice
 
Using the conventional serial dilution technique, yeast was isolated from the rice plant samples (rhizosphere soil, stem, root and leaves). The root and leaf segments were immersed in 70% ethanol for 1 minute, then in 5% sodium hypochlorite for 3 minutes. After that, they were treated with 70% ethanol for 30 seconds and finally, they were rinsed three times with sterile distilled water, in order to isolate endophytic yeast. Following the sterilisation of the root and leaf samples, they were ground in a phosphate buffer (Mahaffee  and Kloepper, 1997). The resulting homogenate was further diluted in a series of steps up to a concentration of 10-8. Soil samples were placed in yeast peptone dextrose (YPD) plates after being serially diluted and then incubated at 28oC. The YPD agar plates allowed for the observation and purification of yeast colonies with different morphologies. For long-term maintenance, the cultures were kept in 30% glycerol stocks and stored at -80oC (Robinson and Erasmus, 2016).
 
Functional characterization of yeast isolates for their PGP attributes
 
IAA production
       
Yeast isolates at log phase growth were inoculated into 100 mL of YPD broth containing 1.0 mM L-tryptophan and incubated at room temperature for 7 days. A parallel culture without tryptophan supplementation was maintained as a control. Following incubation, 1.5 mL of yeast culture was centrifuged at 8000 rpm for 10 min and the supernatant was collected separately. Accurately 4 mL of Salkowski reagent comprising 0.5 M ferric chloride (FeCl3) and 35% perchloric acid (HClO4) was added to the supernatant as described (Mohite, 2013). The reaction mixture was incubated for 30 min at room temperature in a darkened environment and the absorbance was measured at 520 nm and expressed as µg mL-1.
 
ACC deaminase activity
 
Quantitative estimation of ACC deaminase (ACCd) activity was conducted following the protocol outlined (Honma and Shimomura, 1978). The yeast isolates were cultured in 5 mL of tryptic soy broth (TSB) at room temperature for 24 h. Following cultivation, the cells were harvested by centrifugation at 3000 rpm for 5 min, then resuspended and washed twice with 0.1 M Tris-HCl (pH 7.5). The resulting cell pellet was resuspended in 2 mL of modified dworkin and foster (DF) minimal medium supplemented with 3 mM ACC as the sole nitrogen source. Cultures were incubated at 37oC for 2-3 days under agitation on an orbital shaker. ACC deaminase activity was quantified by measuring the concentration of a-ketobutyrate produced and the enzymatic activity was expressed as nanomoles of a-ketobutyrate released per milligram of protein per hour (nmol a-ketobutyrate mg-1 protein h-1).
 
Siderophore production
 
Quantitative estimation of siderophore was carried out by growing yeast cultures [~108 colony-forming units (cfu) mL-1] in Fiss Glucose medium (Vellore, 2001) at 37±2°C in a rotary shaker set at 180 rpm. After 72 h of incubation, the cultures were centrifuged at 14000 rpm for 20 min at 4oC. Subsequently, 2 mL of the culture supernatant was mixed with 4 mL of CAS solution and incubated in the dark for 10 min. The uninoculated broth with CAS reagent served as a reference. The colour change from blue to yellow was observed by measuring the absorbance at 600 nm, using uninoculated broth without reagent as the blank and siderophore desferrioxamine (up to 50 µM) as the standard (Henderson and Payne, 1994).
 
Nutrient solubilisation
 
Phosphorus solubilization
 
The selected isolates were screened for the quantitative estimation of phosphorus solubilization. Exactly 24 h old cultures of yeast isolates (~108 cfu mL-1) were inoculated into 50 mL of Pikovskaya’s broth containing 0.5% of TCP and incubated in a rotary shaker at 180 rpm for 10 days at 37±2oC (Nautiyal et al., 2000). A blank without inoculation was run simultaneously. Following incubation, the cultures were centrifuged at 12,000 g for 15 min and the supernatant was collected to quantify P solubilisation by the molybdenum blue method (Watanabe and Olsen, 1965). Then, 1 mL of the supernatant was taken for quantification and the pellet was stored at -20oC for protein estimation. To the supernatant (1 mL), 10 mL of ammonium molybdate solution was added and the volume was made up to 45 mL. Furthermore, 5 drops of Chlorostannous acid were added and the final volume was maintained at 50 mL. The mixture was then mixed well and the optical density at 600 nm was determined using a UV-Vis Spectrophotometer. The amount of phosphate solubilized was calculated from the standard curve and expressed as µg mg protein-1.
 
Zinc solubilization
 
Zinc solubilization was assessed in culture medium fortified with 0.1% insoluble zinc compound (ZnO) as described (Bunt and Rovira, 1955). Flasks were inoculated with 1% of metabolically active yeast culture containing a population of 8 x 105 cells. Cultures were incubated under aerobic conditions at 30oC with continuous shaking at 100 rpm for 5 days. Following incubation, the samples were centrifuged at 5000 x g for 15 min and the supernatant was analyzed for pH and soluble zinc content.
 
Production of ammonia and hydrogen cyanide (HCN)
 
Ammonia production by yeast isolates was assessed (Hakim et al., 2021). The isolates were cultured in 10 mL of peptone broth overnight and incubated at 30oC for 48 h in a shaker cum incubator. Following incubation, Nessler’s reagent (0.5 mL) was added to each culture. A colour transition from yellow to dark brown was indicative of a positive reaction for ammonia production. The absorbance was recorded at 450 nm using a spectrophotometer.
       
Hydrogen cyanide (HCN) production by yeast cultures was assessed following the method (Ahmad et al., 2008). The isolates were streaked onto nutrient agar medium fortified with 4.4 g/L glycine. Filter paper discs soaked in a 0.5% picric acid solution were placed on the lids of the Petri dishes, which were then sealed to prevent gas exchange. The sealed plates were incubated at 28oC for 4 days. A colour change from yellow to orange in the filter paper is a positive indicator for HCN production by the yeast isolates.
 
Molecular characterization and identification of selected yeast isolates
 
The genomic DNA of yeast isolates was obtained using the cetyl-trimethyl ammonium bromide (CTAB) method for two isolates (VIR1 and VIR3), which were segregated based on morphological and biochemical characteristics. Yeast species were amplified using primers of NL1 (5' GCATATCAATAAGCGGAGGAAAAG 3') and NL4 (5' GGTCCGTGTTTCAAGACGG 3'). Using NCBI Blast, similarity between the sequences was identified. The phylogenetic tree was constructed using MEGA 11.0 to determine the close and distant relationships between sequences.
Isolation of yeasts
 
A total of three morphologically distinct yeast isolates (VIR1, DIN2 and VIR3) were isolated only from rice rhizosphere soil collected from Virudhunagar (S1 and S3) and Dindigul (S2).  Notably, no isolates were recovered from other niches investigated, viz., root, stem and leaves. The colour of the yeast isolates VIR1 and VIR3 was observed to be creamy white and DIN 2 was light yellowish. The margin and elevation of the respective colonies were smooth and raised.
 
Quantitative assay for IAA production
 
IAA concentrations of the 3 yeast isolates ranged from 6.21 to 12.55 µg mL-1. VIR1 exhibited the highest IAA production (12.55 µg mL-1), followed by DIN2 (8.68 µg mL-1). The lowest IAA production was recorded in VIR3 (6.21 µg mL-1). However, all values were lower than those of the positive control, Bacillus altitudinus FD48, which exhibited a highest IAA concentration of 16.42 µg mL-1 (Fig 1).

Fig 1: Quantitative assay for IAA and siderophore production by yeast isolates VIR1, DIN2 and VIR3 from rice rhizosphere.


 
Quantitative assay for siderophore production
 
Quantitative estimation of siderophore production was performed using the CAS liquid assay. The results revealed that siderophore production ranged from 14.85% to 36.86% siderophore units (% SU). Among the isolates, VIR1 demonstrated the highest siderophore production at 36.86% SU, followed by VIR3 at 23.42% SU and DIN2 at 14.85% SU (Fig 1).
 
Screening for PGP traits
 
Quantitative estimation of nutrient solubilization
 
Quantitative estimation of P and Zn solubilization was carried out in liquid culture under standardized incubation conditions. Phosphorus solubilization was highest in isolate VIR1, with a concentration of 86.78 µg mL-1 of soluble phosphate released into the medium. This was followed by VIR3 and DIN2, which recorded 45.78 µg mL-1 and 23.42 µg mL-1, respectively. Zinc solubilization followed a similar trend. VIR1 exhibited the highest solubilized Zn content (11.92 µg mL-1), followed by VIR3 (7.21 µg mL-1) and DIN2 (4.92 µg mL-1) (Fig 2).

Fig 2: Quantitative assessment of P and Zn solubilization by yeast strains-VIR1.


 
Ammonia and HCN production
 
Among the selected yeast isolates, ammonia production was detected in VIR1 and VIR3. The presence of ammonia was confirmed by the development of a brown to yellow coloration upon the addition of Nessler’s reagent to the culture supernatant, indicating positive ammonia synthesis. In contrast, none of the three isolates demonstrated hydrogen cyanide (HCN) production, as evidenced by the absence of colour change in the picrate assay. 
 
ACC deaminase activity
 
Among the three yeast isolates tested, VIR1 exhibited the highest ACC deaminase activity, recording 112.58 nmol a-ketobutyrate mg-1 protein h-1, followed by VIR3 with 91.94 nmol a-ketobutyrate mg-1 protein h-1. The lowest activity was observed in DIN2, which recorded 71.38 nmol a-ketobutyrate mg-1 protein h-1. In comparison, the positive control, B. altitudinus FD48, showed a significantly higher activity of 173.45 nmol a-ketobutyrate mg-1 protein h-1, indicating a strong ACC deaminase potential (Fig 3).

Fig 3: Quantitative assay for ACCd production (n moles a-ketobutyrate mg-1 protein h-1) by rice yeast isolates, where VIR1, DIN2 and VIR3 are yeast morphotypes.


 
Molecular identification
 
Using sequencing of the internal transcribed spacer (ITS) region, the chosen yeast isolates VIR1 and VIR3 were molecularly characterised. Virtually every amino acid in VIR1 was identical to C. tropicalis, according to phylogenetic analysis, multiple sequence alignment and BLASTn. Fig 4 shows that VIR3 was quite similar to S. cerevisiae, with a similarity score of 99%. Under the accession numbers PQ455181 for C. tropicalis and PQ455185 for S. cerevisiae, the validated sequences were uploaded to the NCBI GenBank database.

Fig 4: Phylogenetic analysis of 18S rRNA of yeast isolates VIR1 and VIR3 from rice rhizosphere constructed using Neighbour Joining Method in MEGA 11.0.


       
Plant growth and health can be enhanced by microbial communities culled from a variety of soil types and biological niches. Because of their capacity to generate enzymes, antioxidants, phytohormones and amino acids, all of which contribute to plant health and biomass accumulation, PGPYs have lately gained a lot of interest as potential bio-stimulants (Koza et al., 2022). Despite the diversity and abundance of yeasts in natural ecosystems, very little is known regarding their presence in agricultural soil (Sarabia et al., 2018). This study set out to identify yeasts in three different places in Tamil Nadu-Sengulathupatti (Dindigul), Kundukulam and Narikudi by isolating them from soil in the rhizosphere as well as stem, root and leaf samples taken from rice plants. Surprisingly, no yeast isolates were obtained from any other plant niche; the three morphologically different isolates, VIR1, DIN2 and VIR3, were all obtained from the soil of the rice rhizosphere. This finding lends credence to the idea that diverse microbial populations in the rhizosphere promote plant health by way of different PGP properties (Sarabia et al., 2018).
       
The ability of the yeast isolates to produce ACC deaminase, which helps plants extend their roots and remain vigorous in the face of abiotic stress, further demonstrated their drought tolerance (Yim et al., 2010). According to Sessitsch et al. (2005), yeast isolates with higher ACC deaminase activity lower ethylene levels and aid plants in surviving abiotic stress. VIR1 had the highest ACCD activity in this investigation, measuring 112.58 n moles a-ketobutyrate mg protein-1 h-1. The results were consistent with those of Hussein’s previous research, which found that the ACCD gene was expressed by Cyberlindnera subhashii YEAST-17, which in turn boosted salinity tolerance in Triticum aestivum (Hussein et al., 2022). Likewise, under stress, pea seedlings (Pisum sativum) were able to grow better when exposed to the ACCd-producing yeast strain DH16 (Kaur and Manhas, 2022).
       
For plants to develop and grow better, they must be able to solubilise nutrients, produce growth-promoting chemicals such IAA, hydrogen cyanide and siderophore and synthesise these substances (Ma et al., 2009). Yeast isolates VIR1 and VIR3 exhibited the highest P and Zn solubilisation in mineral medium supplemented with insoluble sources, according to the present study’s PGP trait screening. By lowering the pH and producing organic acids, phosphorus is more easily soluble and made available to plants (Fankem et al., 2006). Zinc, in contrast to phosphorus, is essential for plants in very little amounts; however, it is an essential element for many plant metabolic and enzymatic processes. This agrees with earlier results, for example, that Cryptococcus laurentii JYC370 successfully dissolved zinc oxide (ZO) and dicalcium phosphate (DCP) with SE units of 1.25 and 1.86, respectively (Fu et al., 2016).
       
It is proposed that auxin production by the isolates is an important strategy for promoting growth. Initiation of root development, regulation of fruit ripening and leaf fall and overall plant growth and development are all impacted by it (Trotsenko et al., 2001). There has been a lot of buzz about the possibility of using microbes that produce IAA as biofertilizers recently (Saharan and Nehra, 2011). The VIR1 strain produced the most IAA (12.55 µg mL¹) out of all the isolates. A range of IAA concentrations, from 38.6±1.7 to 103.9±21.2 µg/mL, has been found in Cryptococcus flavus strains, according to Sun et al. (2014).
       
In order to promote plant growth and minimise plant diseases, several microbes release tiny molecular molecules called siderophores. These chemicals have a strong affinity for ferric iron. The isolates that were part of this study produced siderophores in different ways. Our results corroborated those of Nutaratat and colleagues, who found that the yeast R. paludigenum DMKU-RP301 produced the highest amount of IAA (29.3 mg g-1 DCW) together with NH3 and siderophore (Nutaratat et al., 2014).
       
Additionally, all of the yeast isolates tested here produced ammonia. The generation of ammonia by microbes is a promising PGP activity that could greatly benefit plant growth promotion by increasing nitrogen availability (Mpanga et al., 2019). Two possible PGPYs, VIR1 and VIR3, were isolated from soil in the rice rhizosphere. Using 18S rRNA analysis, they were able to be identified to the species level; VIR1 showed sequence resemblance to C. tropicalis, while VIR3 showed sequence closeness to S. cerevisiae. Our research showed that when these isolates are under stress, they exhibit more PGP traits. This jibes with prior research suggesting that prevalent yeast species such Rhodotorula mucilaginosa, Moesziomyces aphidis, C. tropicalis and Aureobasidium pullulans can stimulate plant development (Fu et al., 2016). In addition, commercial biofertilizer formulations have acknowledged and utilised yeasts including Candida, Geotrichum, Rhodotorula, Saccharomyces and Williopsis for their different advantageous qualities (Nimsi et al., 2023). This study’s findings suggest that C. tropicalis VIR1 and S. cerevisiae VIR3, two yeasts found in the rice rhizosphere, may have PGP properties that could be useful in rice farming. This method encourages ecologically sound, climate-resilient rice cultivation when integrated into the agro-ecosystem. Future research into yeast-based biostimulants in various agro-ecosystems should help with the creation of more productive and environmentally friendly rice cultivation methods.
This research set out to isolate and describe yeast strains from soil in the rice rhizosphere throughout several parts of Tamil Nadu. We obtained three isolates VIR1, DIN2 and VIR3 and tested them for PGP characteristics. The C. tropicalis VIR1 strain had the greatest potential for PGP features, such as IAA (12.5±1.0 mg/ mL-1), ACCd (112.5±0.8 n moles a-ketobutyrate mg protein-1h-1) and siderophore synthesis (36.8±2.3% units). Supporting sustainable rice agriculture, these findings lead to the creation of newer yeast-based bio-stimulants employing C. tropicalis VIR1. These bio-stimulants can boost plant growth in demanding situations. With the help of system biology methods, future research should investigate the signalling pathways linked to yeast-rice interactions. Furthermore, next-generation biostimulants for climate-resilient, sustainable crop production will open new possibilities with large-scale adoption across varied ecosystems and the development of appropriate yeast-based formulations and delivery modalities.
The authors are grateful to Indo-Japan Project for funding Research Assistantship on “Development of AMF -based microbial inoculant package for semi dry rice: Understanding the mechanism of action by metabolomic and gene expression analyses” for financial support to SU.
 
Declarations
 
Ethical approval
 
Not applicable.
 
Author’s contribution
 
Geethanjali Muthuramalingam: Conceptualization, Methodology, Investigation, Software, Writing- original draft. Shobana Narayanasamy: Data curation, Formal analysis, Software, Writing-review and editing. Akihiko Kamoshita: Supervised the workflow, Reviewing, Editing and assisted in manuscript preparation. Sivakumar Uthandi: Conceptualized the workflow, Experimental designing, Investigation, Project supervision. All authors read and approved the final manuscript.
 
Availability of data and materials
 
All data of this manuscript are included. No separate external data source is required. Any additional information required will be provided by communicating with the corresponding author via the official mail: usiva@tnau.ac.in.
The authors declare that they have no competing interests.

  1. Abdel-Kareem, M.M., Zohri, A.-N.A. and Nasr, S.A.E.E. (2021). Novel marine yeast strains as plant growth-promoting agents improve defense in wheat (Triticum aestivum) against Fusarium oxysporum. Journal of Plant Diseases and Protection. 128(4): 973-988.

  2. Adedayo, A.A. and Babalola, O.O. (2023). Genomic mechanisms of plant growth-promoting bacteria in the production of leguminous crops. Frontiers in Genetics. 14: 1276003.

  3. Ahmad, F., Ahmad, I. and Khan, M. (2008). Screening of free-living rhizospheric bacteria for their multiple plant growth promoting activities. Microbiological Research. 163(2): 173-181.

  4. Bright, J.P., Karunanadham, K., Maheshwari, H.S., Karuppiah, E.A.A., Thankappan, S., Nataraj, R., Pandian, D., Ameen, F., Poczai, P. and Sayyed, R.Z. (2022). Seed-borne probiotic yeasts foster plant growth and elicit health protection in black gram (Vigna mungo L.). Sustainability. 14(8): 4618.

  5. Bunt, J. and Rovira, A. (1955). Microbiological studies of some subantarctic soils. Journal of Soil Science. 6(1): 119-128.

  6. Fankem, H., Nwaga, D., Deubel, A., Dieng, L., Merbach, W. and Etoa,  F.X. (2006). Occurrence and functioning of phosphate solubilizing microorganisms from oil palm tree (Elaeis guineensis) rhizosphere in Cameroon. African Journal of Biotechnology. 5(24): 2450-2460.

  7. Fu, S.-F., Sun, P.-F., Lu, H.-Y., Wei, J.-Y., Xiao, H.-S., Fang, W.-T., Cheng, B.-Y. and Chou, J.-Y. (2016). Plant growth-promoting traits of yeasts isolated from the phyllosphere and rhizosphere of Drosera spatulata Lab. Fungal Biology. 120(3): 433-448.

  8. Ghosh, A., Agrawal, M. and Agrawal, S.B. (2020). Effect of water deficit stress on an Indian wheat cultivar [Triticum aestivum  (L.) HD 2967] under ambient and elevated level of ozone. Science of The Total Environment. 714: 136837.

  9. Gouda, S., Kerry, R.G., Das, G., Paramithiotis, S., Shin, H.-S. and Patra, J.K. (2018). Revitalization of plant growth promoting rhizobacteria for sustainable development in agriculture. Microbiological Research. 206: 131-140.

  10. Hakim, S., Naqqash, T., Nawaz, M.S., Laraib, I., Siddique, M.J., Zia,  R., Mirza, M.S. and Imran, A. (2021). Rhizosphere engineering with plant growth-promoting microorganisms for agriculture and ecological sustainability. Frontiers in Sustainable Food Systems. 5: 617157.

  11. Henderson, D.P. and Payne, S.M. (1994). Vibrio cholerae iron transport systems: Roles of heme and siderophore iron transport in virulence and identification of a gene associated with multiple iron transport systems. Infection and Immunity.  62(11): 5120-5125.

  12. Honma, M. and Shimomura, T. (1978). Metabolism of 1-aminocy- clopropane-1-carboxylic acid. Agricultural and Biological Chemistry. 42(10): 1825-1831.

  13. Hussein, K.A., Tohamy, T.A. and El-Maraghy, S.S. (2022). Amino- cyclopropane-1-carboxylate deaminase (ACCD) producing yeasts improved salinity tolerance of Triticum aestivum L. Rhizosphere. 23: 100548.

  14. Kaur, T. and Manhas, R.K. (2022). Evaluation of ACC deaminase and indole acetic acid production by Streptomyces hydrogenans DH16 and its effect on plant growth promotion. Biocatalysis and Agricultural Biotechnology. 42: 102321.

  15. Koza, N.A., Adedayo, A.A., Babalola, O.O. and Kappo, A.P. (2022). Microorganisms in plant growth and development: Roles in abiotic stress tolerance and secondary metabolites secretion. Microorganisms. 10(8): 1528.

  16. Ma, Y., Rajkumar, M. and Freitas, H. (2009). Improvement of plant growth and nickel uptake by nickel resistant-plant-growth promoting bacteria. Journal of Hazardous Materials. 166(2-3): 1154-1161.

  17. Mahaffee, W. and Kloepper, J. (1997). Temporal changes in the bacterial communities of soil, rhizosphere and endorhiza associated with field-grown cucumber (Cucumis sativus L.). Microbial Ecology. 34: 210-223.

  18. Mohite, B. (2013). Isolation and characterization of indole acetic acid (IAA) producing bacteria from rhizospheric soil and its effect on plant growth. Journal of Soil Science and Plant Nutrition. 13(3): 638-649.

  19. Mpanga, I.K., Nkebiwe, P.M., Kuhlmann, M., Cozzolino, V., Piccolo, A., Geistlinger, J., Berger, N., Ludewig, U. and Neumann, G. (2019). The form of N supply determines plant growth promotion by P-solubilizing microorganisms in maize. Microorganisms. 7(2): 38.

  20. Muthukrishanan, G., Munisamy, J., Gopalasubramaniam, S.K., Subramanian, K.S., Dharmaraj, R., Nath, D.J., Dutta, P. and Devarajan, A.K. (2024). Impact of foliar application of phyllosphere yeast strains combined with soil fertilizer application on rice growth and yield. Environmental Microbiome. 19(1): 102.

  21. Narayanasamy, S. and Uthandi, S. (2024). Plant growth promoting signatory volatiles emitted by a drought-tolerant bacterium Bacillus altitudinis FD48 and its role in moisture stress alleviation in rice (Oryza sativa L.). Plant Stress. 14: 100621.

  22. Nautiyal, C. S., Bhadauria, S., Kumar, P., Lal, H., Mondal, R. and Verma, D. (2000). Stress induced phosphate solubilization in bacteria isolated from alkaline soils. FEMS Microbiology Letters. 182(2): 291-296.

  23. Nimsi, K., Manjusha, K., Kathiresan, K. and Arya, H. (2023). Plant growth-promoting yeasts (PGPY), the latest entrant for use in sustainable agriculture: A review. Journal of Applied Microbiology. 134(2): lxac088.

  24. Nutaratat, P., Srisuk, N., Arunrattiyakorn, P. and Limtong, S. (2014). Plant growth-promoting traits of epiphytic and endophytic yeasts isolated from rice and sugar cane leaves in Thailand. Fungal Biology. 118(8): 683-694.

  25. Robinson, P. and Erasmus, L. (2016). Effects of two yeast based direct fed microbials on performance of high producing dairy cows. Animal Feed Science and Technology. 215: 58-72.

  26. Ruspi, C., Casagrande Pierantoni, D., Conti, A., Scarponi, R., Corte, L. and Cardinali, G. (2025). Plant growth-promoting yeasts (PGPYs) as a sustainable solution to mitigate salt-induced stress on zucchini plant growth. Biology and Fertility of Soils. 61(2): 293-309.

  27. Ruspi, C., Pierantoni, D.C., Conti, A., Favaro, L., Antinori, M.E., Puglisi, E., Corte, L. and Cardinali, G. (2024). Beneficial effects of plant growth-promoting yeasts (PGPYs) on the early stage of growth of zucchini plants. Current Plant Biology. 39: 100357.

  28. Saharan, B. and Nehra, V. (2011). Plant growth promoting rhizobacteria:  A critical review. Life Sci Med Res. 21(1): 30.

  29. Sarabia, M., Jakobsen, I., Grønlund, M., Carreon-Abud, Y. and Larsen, J. (2018). Rhizosphere yeasts improve P uptake of a maize arbuscular mycorrhizal association. Applied Soil Ecology. 125: 18-25.

  30. Sessitsch, A., Coenye, T., Sturz, A., Vandamme, P., Barka, E.A., Salles, J.F., Van Elsas, J., Faure, D., Reiter, B. and Glick, B. (2005). Burkholderia phytofirmans sp. nov., a novel plant-associated bacterium with plant-beneficial properties. International Journal of Systematic and Evolutionary Microbiology. 55(3): 1187-1192.

  31. Singh, N. and Gaur, S. (2021). GRAS fungi: A new horizon in safer food product. Fungi in Sustainable Food Production. pp: 27-37.

  32. Sun, P.-F., Fang, W.-T., Shin, L.-Y., Wei, J.-Y., Fu, S.-F. and Chou, J.-Y. (2014). Indole-3-acetic acid-producing yeasts in the phyllosphere of the carnivorous plant Drosera indica (L.). Plos One. 9(12): e114196.

  33. Trotsenko, Y.A., Ivanova, E. and Doronina, N. (2001). Aerobic methylotrophic bacteria as phytosymbionts. Microbiology. 70: 623-632.

  34. Vellore, J.M. (2001). Iron acquisition in Rhodococcus erythrolpolis: The isolation of mutant (s) that do not produce a siderophore.  East Tennessee State University.

  35. Watanabe, F. and Olsen, S. (1965). Test of an ascorbic acid method for determining phosphorus in water and NaHCO3 extracts from soil. Soil Science Society of America Journal. 29(6): 677-678.

  36. Yang, Y., Guo, M., Sun, S., Zou, Y., Yin, S., Liu, Y., Tang, S., Gu, M., Yang, Z. and Yan, C. (2019). Natural variation of OsGluA2 is involved in grain protein content regulation in rice. Nature Communications. 10(1): 1949.

  37. Yim, W.-J., Chauhan, P., Madhaiyan, M., Tipayno, S. and Sa, T. (2010). Plant Growth Promontory Attributes by 1-aminocyclopropane -1-carboxylate (ACC) Deaminase Producing Methylobacterium  Oryzae Strains Isolated from rice. 19th World Congress of Soil Science, Soil Solutions for a Changing World. Brisbane, Australia: International Union of Soil Sciences.
In this Article
Published In
Indian Journal of Agricultural Research

Editorial Board

View all (0)