Published In
Legume Research
Article Metrics

108
Views
0
Citations
Reviewed By
In this Article
APC
APC cover the cost of turning a manuscript into a published manuscript through peer-review process, editorial work as well as the cost of hosting, distributing, indexing and promoting the manuscript.
Publish With US
Submit your manuscript through user friendly platform and acquire the maximum impact for your research by publishing with ARCC Journals.
Become a Reviewer/Member
Join our esteemed reviewers panel and become an editorial board member with international experts in the domain of numerous specializations.
Open Access
Filling the gap between research and communication ARCC provide Open Access of all journals which empower research community in all the ways which is accessible to all.
Products and Services
We provide prime quality of services to assist you select right product of your requirement.
Support and Policies
Finest policies are designed to ensure world class support to our authors, members and readers. Our efficient team provides best possible support for you.
Follow us
Research Article
Molecular Characterization of Fusarium oxysporum Causing Chickpea Wilt by Internal Transcribed Spacer (ITS) Marker
1Department of Plant Biotechnology, VDCABT, Latur, Vasantarao Naik Marathawada Krishi Vidyapeeth, Parbhani-431 401, Maharashtra, India.
2ICAR-National Institute of Abiotic Stress Management, Malegaon, Baramati-413 115, Maharashtra, India.
Submitted10-04-2019|
Accepted12-10-2019|
First Online 03-12-2019|
doi 10.18805/LR-4151
Cite article:- Jadhav Bharati, Bhalerao R. Sarika., George Priya (2021). Molecular Characterization of Fusarium oxysporum Causing Chickpea Wilt by Internal Transcribed Spacer (ITS) Marker
. Legume Research. 44(7): 842-848. doi: 10.18805/LR-4151.
ABSTRACT
Fusarium wilt caused by Fusarium oxysporum f. sp. ciceris is one of the serious disease causes tremendous loss to crop throughout the world and has assumed serious proportions in the recent years. Wilt affected chickpea plant roots samples were collected from forty eight different regions of Maharashtra. The collected samples were characterized by designed ITS primers. The Fusarium oxysporum f. sp. ciceris (Foc) showed about 302 bp amplicon when subjected to PCR with these primers. Further the amplified product was digested with five restriction enzymes viz. AluI, EcoRI, HaeIII, MboI and MspI and restriction fragment length polymorphism (RFLP) pattern were analysed. A dendrogram derived from ITS-RFLP analysis of the rDNA region divided the Foc isolates into four clusters. The maximum genetic distance 0.75 exhibited by five Foc isolates viz. Foc-30, Foc-36, Foc-24, Foc-25 and Foc-48 belonging to Shahartakli, Shelur, Nashik, Satara, Kolhapur regions respectively and found to be more diverse among the other Foc isolates. Whereas isolate no. Foc-20, Foc-21 and Foc-8 from Ambajogai, Karjat and Rahata shown minimum genetic distance (0.13). This showed the genetic variability among the Foc isolates collected from different regions of Maharashtra.
KEYWORDS
INTRODUCTION
Chickpea, (Cicer arietinum) is the third most important pulse crop in the world. India is having first rank in terms of chickpea production and consumption in the world (Kumar, 2017; Thakur and Sirohi, 2009). The chickpea growing states of India are Rajasthan, Madhya Pradesh, Uttar Pradesh, Maharashtra and Haryana with 50% of global chickpea production is from Rajasthan and Madhya Pradesh.
Chickpea cultivation is often subjected to several biotic stresses of which diseases like Ascochyta blight, Botrytis grey mould, Verticillium wilt, Sclerotinia stem rot, dry root rot and Fusarium wilt are important. The fungal attack has been a major problem associated with the crops and more predominant is the attack of Fusarium, which causes tremendous loss in Indian economy (Ingle et al., 2017). Fusarium wilt caused by Fusarium oxysporum f. sp. ciceris is one of the serious diseases causing 10-50% yield reduction in chickpea crop throughout the world and has assumed serious proportions in the recent years (Patra et al., 2017). The vascular wilt fungus Fusarium oxysporum is a soil borne facultative parasite that causes disease in more than 100 plant species, including important agricultural crops. It is a morphospecies that is divided into specialized groups i.e. formae speciales according to the hosts they attack and subdivided into races according to the susceptibility of specific host cultivars (Sutherland et al., 2012). The pathogen is facultative saprophytic and it can survive as mycelium and chlamydospores in seed, soil and also on infected crops residues, buried in the soil for up to five to six years (Haware et al.,1996). The pathogen can infect at all stages of plant growth with more incidences in flowering and pod filling stage. The wilt appeared in field within three to four week after sowing, if the variety is susceptible. Early wilting causes 77-94% losses, while late wilting causes 24-65% loss (Bhattacharjee et al., 2015). In India annual yield loss due to Fusarium wilt was estimated at 10% and under favorable condition, the wilt infection can damage the crop completely (Golakiya et al., 2018).
The regular monitoring of variation in new isolates collected from different cultivars and geographically distinct regions over the years is critical for successful resistance breeding programme. The conventional approaches to assess variation among the fungal isolates are morphological and virulence analysis. However, with the advent of DNA based molecular techniques it is now possible to assess the genetic variation among the isolates. Genotyping of F. oxysporum f. sp. ciceris isolates along with virulence analysis may yield some information relevant to breeding. It also provides some insight into distribution of geographically sub-structured pathogen population. Internal transcribed spacers (ITS) regions have been used successfully to generate specific primers capable of differentiating closely related fungal species (Bryan et al., 1995). Taxon selective ITS amplification has already been used for the detection of fungal pathogens such as Fusarium (O’Donnell, 1992) and Verticillium species (Nazzar et al., 1991). We have isolated and characterized the pathogenic F. oxysporum f. sp. ciceris isolates from different locations of Maharashtra and ITS-RFLP based genetic variation among Foc isolates was studied.
Chickpea cultivation is often subjected to several biotic stresses of which diseases like Ascochyta blight, Botrytis grey mould, Verticillium wilt, Sclerotinia stem rot, dry root rot and Fusarium wilt are important. The fungal attack has been a major problem associated with the crops and more predominant is the attack of Fusarium, which causes tremendous loss in Indian economy (Ingle et al., 2017). Fusarium wilt caused by Fusarium oxysporum f. sp. ciceris is one of the serious diseases causing 10-50% yield reduction in chickpea crop throughout the world and has assumed serious proportions in the recent years (Patra et al., 2017). The vascular wilt fungus Fusarium oxysporum is a soil borne facultative parasite that causes disease in more than 100 plant species, including important agricultural crops. It is a morphospecies that is divided into specialized groups i.e. formae speciales according to the hosts they attack and subdivided into races according to the susceptibility of specific host cultivars (Sutherland et al., 2012). The pathogen is facultative saprophytic and it can survive as mycelium and chlamydospores in seed, soil and also on infected crops residues, buried in the soil for up to five to six years (Haware et al.,1996). The pathogen can infect at all stages of plant growth with more incidences in flowering and pod filling stage. The wilt appeared in field within three to four week after sowing, if the variety is susceptible. Early wilting causes 77-94% losses, while late wilting causes 24-65% loss (Bhattacharjee et al., 2015). In India annual yield loss due to Fusarium wilt was estimated at 10% and under favorable condition, the wilt infection can damage the crop completely (Golakiya et al., 2018).
The regular monitoring of variation in new isolates collected from different cultivars and geographically distinct regions over the years is critical for successful resistance breeding programme. The conventional approaches to assess variation among the fungal isolates are morphological and virulence analysis. However, with the advent of DNA based molecular techniques it is now possible to assess the genetic variation among the isolates. Genotyping of F. oxysporum f. sp. ciceris isolates along with virulence analysis may yield some information relevant to breeding. It also provides some insight into distribution of geographically sub-structured pathogen population. Internal transcribed spacers (ITS) regions have been used successfully to generate specific primers capable of differentiating closely related fungal species (Bryan et al., 1995). Taxon selective ITS amplification has already been used for the detection of fungal pathogens such as Fusarium (O’Donnell, 1992) and Verticillium species (Nazzar et al., 1991). We have isolated and characterized the pathogenic F. oxysporum f. sp. ciceris isolates from different locations of Maharashtra and ITS-RFLP based genetic variation among Foc isolates was studied.
MATERIALS AND METHODS
Sample collection
The chickpea growing areas in Maharashtra were surveyed and wilt affected chickpea plant root samples were collected from 48 different locations (Table 1).
Foc isolation and purification
The infected root samples were surface sterilized using 1% sodium hypochlorite for 2 m and washed 3-4 times with sterilized water. The pieces of surface sterilized root samples were then placed on potato dextrose agar (PDA) medium containing streptomycin (0.12 g/l) and incubated at 26±2°C for 5-6 days. All the isolates of the pathogen were purified by hyphal tip method (Dohroo and Sharma 1992).
Morphological characterization
Morphological characters of Foc viz., colony colour, growth, pigmentation and sporulation were recorded a week after inoculation. For characterization of macroconidia, microconidia and chlamydospore, 10-15 day old culture grown on PDA medium was stained with 0.1% Lactophenol cotton blue on slides were observed under compound microscope.
Identification and maintenance of the pathogen isolates
The fungal growth showing different coloration on PDA media plates depending on the morphological characteristics i.e. microconidia, macroconidia, chlamydospores mentioned by Booth, (1971) were identified. Microphotographs of the Foc isolates were taken to describe spore morphology. All the isolates were then maintained on PDA slants at 4°C and sub culturing was done in every three months. Pathogenicity of Foc isolates were tested to prove Koch’s postulates by soil inoculation method (Nene et al., 1981) on chickpea variety JG-62 susceptible to Fusarium wilt.
DNA extraction
Standard protocols were followed for the isolation of DNA from all the Foc isolates (Cenis, 1992). Briefly, fungal strains were grown for 7 days in Potato Dextrose Broth (PDB) at 26±2°C under static conditions. Mycelia were harvested and lyophilized. Later 100 mg of the finely powdered mycelium was used for DNA extraction using Hi PurATM Fungal DNA Mini Kit (HiMedia, India), according to the manufacturer’s instructions. The concentration and purity of extracted DNA was determined using NanoDrop-ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, USA) and the DNA samples were stored at -80°C for further use.
ITS amplification of Foc isolates
ITS amplification of rDNA was carried out by polymerase chain reaction (Das and Shende, 2015) using designed primers ITS-Fu-F-5'CAACTCCCAAACCCCTGTGA3' and ITS-Fu-R- 5'GCGACGATTACCAGTAACGA3' which are specific for ITS region of Fusarium oxysporum f. sp. ciceri. The reactions were performed in thermo cycler with one cycle of initial denaturation 94°C for 4 min, followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 1.5 min and with a final extension at 72°C for 6 min. Amplified products together with marker were resolved by gel electrophoresis (60 V) on 1.2% agarose gels in 1X TAE buffer containing 10 mg / ml ethidium bromide (EB). The amplified product was digitized in Gel Documentation system (Alpha-Innotech, USA).
Restriction digestion and analysis of genetic diversity of rDNA ITS region of Foc isolates
PCR amplified ITS product (50µl) of Foc isolates were subjected for restriction digestion with restriction enzymes viz., AluI, EcoRI, HaeIII, MboI and MspI.Restriction digestion was carried out at 37°C for 4 hours in water bath. The digested product was separated on 4% agarose gel in 1X TAE buffer at 60V for 1:30 h and gel images were taken in Gel Documentation System. The molecular size of each fragments were estimated by running in parallel a 50 bp ladder (Genei, Banglore). The amplicons (302 bp) which distinguishes Fusarium isolates were observed and scored. The image was scored for amplicon either presence (1) or absence (0) and missing or doubtful case scored as 9. Band size was determined by using software Alpha Ease FC 4.0 with reference to 100 bp and 50 bp DNA ladder respectively for ITS and RFLP products. Data analysis was performed using NTSYS-pc Numerical Taxonomy system, version 2.02i (Rohlf, 1998). The SIMQUAL programme was used to calculate the Jaccard’s coefficient. Dendrogram was constructed using unweighted paired group method for Arithmetic Mean (UPGMA) based on Jaccard’s similarity coefficient.
The chickpea growing areas in Maharashtra were surveyed and wilt affected chickpea plant root samples were collected from 48 different locations (Table 1).
Foc isolation and purification
The infected root samples were surface sterilized using 1% sodium hypochlorite for 2 m and washed 3-4 times with sterilized water. The pieces of surface sterilized root samples were then placed on potato dextrose agar (PDA) medium containing streptomycin (0.12 g/l) and incubated at 26±2°C for 5-6 days. All the isolates of the pathogen were purified by hyphal tip method (Dohroo and Sharma 1992).
Morphological characterization
Morphological characters of Foc viz., colony colour, growth, pigmentation and sporulation were recorded a week after inoculation. For characterization of macroconidia, microconidia and chlamydospore, 10-15 day old culture grown on PDA medium was stained with 0.1% Lactophenol cotton blue on slides were observed under compound microscope.
Identification and maintenance of the pathogen isolates
The fungal growth showing different coloration on PDA media plates depending on the morphological characteristics i.e. microconidia, macroconidia, chlamydospores mentioned by Booth, (1971) were identified. Microphotographs of the Foc isolates were taken to describe spore morphology. All the isolates were then maintained on PDA slants at 4°C and sub culturing was done in every three months. Pathogenicity of Foc isolates were tested to prove Koch’s postulates by soil inoculation method (Nene et al., 1981) on chickpea variety JG-62 susceptible to Fusarium wilt.
DNA extraction
Standard protocols were followed for the isolation of DNA from all the Foc isolates (Cenis, 1992). Briefly, fungal strains were grown for 7 days in Potato Dextrose Broth (PDB) at 26±2°C under static conditions. Mycelia were harvested and lyophilized. Later 100 mg of the finely powdered mycelium was used for DNA extraction using Hi PurATM Fungal DNA Mini Kit (HiMedia, India), according to the manufacturer’s instructions. The concentration and purity of extracted DNA was determined using NanoDrop-ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, USA) and the DNA samples were stored at -80°C for further use.
ITS amplification of Foc isolates
ITS amplification of rDNA was carried out by polymerase chain reaction (Das and Shende, 2015) using designed primers ITS-Fu-F-5'CAACTCCCAAACCCCTGTGA3' and ITS-Fu-R- 5'GCGACGATTACCAGTAACGA3' which are specific for ITS region of Fusarium oxysporum f. sp. ciceri. The reactions were performed in thermo cycler with one cycle of initial denaturation 94°C for 4 min, followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 1.5 min and with a final extension at 72°C for 6 min. Amplified products together with marker were resolved by gel electrophoresis (60 V) on 1.2% agarose gels in 1X TAE buffer containing 10 mg / ml ethidium bromide (EB). The amplified product was digitized in Gel Documentation system (Alpha-Innotech, USA).
Restriction digestion and analysis of genetic diversity of rDNA ITS region of Foc isolates
PCR amplified ITS product (50µl) of Foc isolates were subjected for restriction digestion with restriction enzymes viz., AluI, EcoRI, HaeIII, MboI and MspI.Restriction digestion was carried out at 37°C for 4 hours in water bath. The digested product was separated on 4% agarose gel in 1X TAE buffer at 60V for 1:30 h and gel images were taken in Gel Documentation System. The molecular size of each fragments were estimated by running in parallel a 50 bp ladder (Genei, Banglore). The amplicons (302 bp) which distinguishes Fusarium isolates were observed and scored. The image was scored for amplicon either presence (1) or absence (0) and missing or doubtful case scored as 9. Band size was determined by using software Alpha Ease FC 4.0 with reference to 100 bp and 50 bp DNA ladder respectively for ITS and RFLP products. Data analysis was performed using NTSYS-pc Numerical Taxonomy system, version 2.02i (Rohlf, 1998). The SIMQUAL programme was used to calculate the Jaccard’s coefficient. Dendrogram was constructed using unweighted paired group method for Arithmetic Mean (UPGMA) based on Jaccard’s similarity coefficient.
RESULTS AND DISCUSSION
Isolation, characterization and identification of Foc isolates
A survey was conducted to obtain information on the natural incidence of Fusarium wilt disease on chickpea during the rabi season (2017-18) in the aforementioned locations. A total of forty eight strains of Fusarium oxysporum f. sp. ciceri belonging to different locations were collected from the roots of infected chickpea plants. All the isolates were identified based on its morphological characteristics (Booth, 1971; Barhate et al., 2006). These isolates exhibited variations in growth, colony characteristics such as colour, shape, margin and texture (Table 2). They also exhibited variation in conidia structures. The maximum number of isolates (30 nos.) exhibited microconidia that were ellipsoidal and have no septa or one septum. Macroconidia produced by 14 isolates were falcate with three or four septa and 4 of the Foc isolates showed round shaped chlamydospores. Morphological variations in the Foc strains have been reported earlier by many researchers (Saxena and Singh, 1987; Dubey et al., 2010). These asexual spores play important roles in the disease cycle exist in the soil and infect the plants under favorable conditions.
ITS rDNA amplification of Foc isolates
DNA of forty eight Foc isolates was extracted from their mycelial mat grown on PDB and yielded 350-400 ng/μl quantity of DNA which was amenable to PCR amplification. The ITS primer pair ITS-Fu- F and ITS-Fu-R designed in the laboratory from ITS region sequenced data of Fusarium species and after in silico analysis, was used in PCR to amplify the rDNA ITS regions of 48 Foc isolates. ITS-Fu-F and ITS-Fu-R invariably amplified the 302 bp rDNA ITS region of Foc isolates (Fig 1). Similarly, ITS-Fu-f and ITS-Fu-r was designed by Kamel et al., (2003) compared the aligned sequences of internal transcribed spacer regions (ITS) of a range of Fusarium species infecting cotton and showed amplification of 389 bp product.
Analysis of genetic diversity among Foc isolates
ITS-PCR products of 302 bp generated by primers ITS-Fu-F and ITS-Fu-R was digested using five restriction enzymes viz., EcoRI, HaeIII, MboI, MspI and AluI to assess the molecular variability among the Foc isolates. Out of these only three enzymes viz., EcoRI, HaeIII, MboI enabled to digest amplified PCR product of ITS region. These generated two fragments of 220bp and 82bp (Fig 2), 240bp and 52bp (Fig 3), 152bp and150bp (Fig 4) respectively in all isolates except Foc-30, Foc-36 isolates which have not digested by EcoRI and Foc-8, Foc-20, Foc-21, Foc-24 and Foc-25 isolates did not digest by HaeIII. The results obtained from restriction digestion of ITS region were in concordance with earlier studies with different restriction enzymes (Alymanesh et al., 2009; Datta et al., 2011). Two of the restriction enzymes (MspI and AluI) were not digested the ITS region in this study. ITS-RFLP and other molecular markers are used as common method to identify or distinguish mycopathogenic isolates on different crops (Diguta et al., 2011; Prashanthi et al., 2009).
Clustering of Foc isolates on the basis of RFLP analysis
The similarity matrix was generated by using scored data of RFLP fingerprint by NTSYS-pc Version 2.02i. The genetic similarity was retrieved from RFLP data using Jaccard’s coefficient. All the 48 Foc isolates divided into four major clusters, I, II, III and IV at 75% similarity value (Fig 5). The similarity index can be used to measure the relatedness of samples (Nybom and Hall 1991; Welsh et al., 1991). Maximum isolates (40 nos.) regardless of their location are clustered in a single group with 100% similarity. Cluster II and III each contains two Foc isolates viz., Foc-30, Foc-36 and Foc-20, Foc -21 respectively. Cluster IV divided into two sub clusters viz., IV-A and IV-B at 87% similarity value. The sub cluster IV-B contains three Foc isolates viz., Foc-24, Foc-25, Foc-48 and whereas only one Foc-8, isolate grouped in subcluster IV-A. The maximum genetic distance (0.75) exhibited by five Foc isolates viz., Foc-30, Foc-36, Foc-24, Foc-25 and Foc-48 belonging to Shahartakli, Shelur, Nashik, Satara, Kolhapur respectively and more diverse among the Foc isolates whereas isolate no. Foc 20, Foc 21 and Foc-8 from Ambajogai, Karjat and Rahata shown minimum genetic distance (0.13). Datta et al., (2011) used digested fragments obtained with EcoRI, MspI, PstI, BamHI, XhoI, NstI and HindIII restriction enzymes to determine genetic distances between the pathogenic F. oxysporum isolates of various legumes and clustered them into three main groups. Dubey et al., (2010) obtained six different kinds of ITS-RFLP patterns from 11 representative isolates of Fusarium oxysporum f. sp. ciceris causing chickpea wilt through internal transcribed spacer (ITS) region of the ribosomal DNA-restriction fragment length polymorphism (ITS-RFLP). In this study ITS-RFLP analysis could clearly distinguish five of the isolates among the other strains.
A survey was conducted to obtain information on the natural incidence of Fusarium wilt disease on chickpea during the rabi season (2017-18) in the aforementioned locations. A total of forty eight strains of Fusarium oxysporum f. sp. ciceri belonging to different locations were collected from the roots of infected chickpea plants. All the isolates were identified based on its morphological characteristics (Booth, 1971; Barhate et al., 2006). These isolates exhibited variations in growth, colony characteristics such as colour, shape, margin and texture (Table 2). They also exhibited variation in conidia structures. The maximum number of isolates (30 nos.) exhibited microconidia that were ellipsoidal and have no septa or one septum. Macroconidia produced by 14 isolates were falcate with three or four septa and 4 of the Foc isolates showed round shaped chlamydospores. Morphological variations in the Foc strains have been reported earlier by many researchers (Saxena and Singh, 1987; Dubey et al., 2010). These asexual spores play important roles in the disease cycle exist in the soil and infect the plants under favorable conditions.
ITS rDNA amplification of Foc isolates
DNA of forty eight Foc isolates was extracted from their mycelial mat grown on PDB and yielded 350-400 ng/μl quantity of DNA which was amenable to PCR amplification. The ITS primer pair ITS-Fu- F and ITS-Fu-R designed in the laboratory from ITS region sequenced data of Fusarium species and after in silico analysis, was used in PCR to amplify the rDNA ITS regions of 48 Foc isolates. ITS-Fu-F and ITS-Fu-R invariably amplified the 302 bp rDNA ITS region of Foc isolates (Fig 1). Similarly, ITS-Fu-f and ITS-Fu-r was designed by Kamel et al., (2003) compared the aligned sequences of internal transcribed spacer regions (ITS) of a range of Fusarium species infecting cotton and showed amplification of 389 bp product.
Analysis of genetic diversity among Foc isolates
ITS-PCR products of 302 bp generated by primers ITS-Fu-F and ITS-Fu-R was digested using five restriction enzymes viz., EcoRI, HaeIII, MboI, MspI and AluI to assess the molecular variability among the Foc isolates. Out of these only three enzymes viz., EcoRI, HaeIII, MboI enabled to digest amplified PCR product of ITS region. These generated two fragments of 220bp and 82bp (Fig 2), 240bp and 52bp (Fig 3), 152bp and150bp (Fig 4) respectively in all isolates except Foc-30, Foc-36 isolates which have not digested by EcoRI and Foc-8, Foc-20, Foc-21, Foc-24 and Foc-25 isolates did not digest by HaeIII. The results obtained from restriction digestion of ITS region were in concordance with earlier studies with different restriction enzymes (Alymanesh et al., 2009; Datta et al., 2011). Two of the restriction enzymes (MspI and AluI) were not digested the ITS region in this study. ITS-RFLP and other molecular markers are used as common method to identify or distinguish mycopathogenic isolates on different crops (Diguta et al., 2011; Prashanthi et al., 2009).
Clustering of Foc isolates on the basis of RFLP analysis
The similarity matrix was generated by using scored data of RFLP fingerprint by NTSYS-pc Version 2.02i. The genetic similarity was retrieved from RFLP data using Jaccard’s coefficient. All the 48 Foc isolates divided into four major clusters, I, II, III and IV at 75% similarity value (Fig 5). The similarity index can be used to measure the relatedness of samples (Nybom and Hall 1991; Welsh et al., 1991). Maximum isolates (40 nos.) regardless of their location are clustered in a single group with 100% similarity. Cluster II and III each contains two Foc isolates viz., Foc-30, Foc-36 and Foc-20, Foc -21 respectively. Cluster IV divided into two sub clusters viz., IV-A and IV-B at 87% similarity value. The sub cluster IV-B contains three Foc isolates viz., Foc-24, Foc-25, Foc-48 and whereas only one Foc-8, isolate grouped in subcluster IV-A. The maximum genetic distance (0.75) exhibited by five Foc isolates viz., Foc-30, Foc-36, Foc-24, Foc-25 and Foc-48 belonging to Shahartakli, Shelur, Nashik, Satara, Kolhapur respectively and more diverse among the Foc isolates whereas isolate no. Foc 20, Foc 21 and Foc-8 from Ambajogai, Karjat and Rahata shown minimum genetic distance (0.13). Datta et al., (2011) used digested fragments obtained with EcoRI, MspI, PstI, BamHI, XhoI, NstI and HindIII restriction enzymes to determine genetic distances between the pathogenic F. oxysporum isolates of various legumes and clustered them into three main groups. Dubey et al., (2010) obtained six different kinds of ITS-RFLP patterns from 11 representative isolates of Fusarium oxysporum f. sp. ciceris causing chickpea wilt through internal transcribed spacer (ITS) region of the ribosomal DNA-restriction fragment length polymorphism (ITS-RFLP). In this study ITS-RFLP analysis could clearly distinguish five of the isolates among the other strains.
CONCLUSION
The present investigation on the genetic variability analysis by using ITS-RFLP revealed the genetic variability among Foc isolates from different regions of Maharashtra. The marker developed from the conserved sequence of ITS region can be used as diagnostic tool for identification of Fusarium wilt at early stages of disease development and thus loss in the chickpea production can be minimized.
ACKNOWLEDGEMENT
Authors are thankful to Vilasrao Deshmukh College of Agricultural Biotechnology, Latur for giving better platform to this research work and also thankful to the university Vasantrao Naik Marathwada Krishi Vidyapeeth, Parbhani for financial support.
REFERENCES
- Alymanesh, M.R., Falahatirastegar, M., Jafarpour, B., Mahdikhanimoghadam, E., (2009). Genetic diversity in the fungus Fusarium solani f. sp. cucurbitae race 1, the casual agent of root and crown rot of cucurbits in Iran, using molecular markers. Pakistan Journal of Biological Sciences. 12: 836–843.
- Barhate, B.G., Dake, G.N., Game, B.C. and Padule, D.N. (2006). Variability for virulence in Fusarium oxysporum f. sp. ciceri causing wilt of chickpea. Legume Research. 29(4): 308-310.
- Bhattacharjee, D., Mane, S. S. and Bhattacharjee, J. (2015). Molecular characterization of Fusarium oxysporum f. sp. ciceri using scar markers. An International Quarterly Journal of Life Sciences. 10(4): 2089-2097.
- Booth, C. (1971). Fusarium nomenclature in the genus of Fusarium. Commonwealth Mycological Institute, Kew, Surrey. Pp. 27-35.
- Bryan, G. T. and Daniels, M. J. (1995). Comparison of Fungi within the Gaeumannomyces-Phialophora complex by analysis of ribosomal DNA sequence. Applied Environmental Microbiology. 61:681-689.
- Cenis, J. L. (1992). Rapid extraction of fungal DNA for PCR amplification. Nucleic Acids Research. 20 (9):2380.
- Das,S. and Shende, S.S. (2015). ITS marker for detection of Fuarium oxysporum causing safflower wilt. Thesis. VNMKV, Parbhani, Maharashtra.
- Datta, S., Chaudhari, R. G., Shamim, M. D. and Vishwa, D., (2011). Polymorphism in the internal transcribed spacer (ITS) region of the ribosomal DNA among different Fusarium species. Archives of Phytopathology and Plant Protection. 44: (6)558556.
- Diguta, C.F., Vincent, B., Guilloux-Benatier, M., Alexandre, H. and Rousseaux, S. (2011). PCR ITS-RFLP: a useful method for identifying filamentous fungi isolates on grapes. Food Microbiology. 28(6):1145-1154.
- Dohroo, P. and Sharma, S. K. (1992). Variability in Fusarium oxysporum f. sp. zingiberi. Mycosciences. 3: 176-180.
- Dubey, S. C., Singh, S. R. and Singh, B. (2010). Morphological and pathogenic variability of Indian isolates of Fusarium oxysporum f. sp. ciceris causing chickpea wilt. Archives of Phytopathology and Plant Protection. 43:174-90.
- Dubey, S. C., Suresh, M., Singh, B. (2007). Evaluation of Trichoderma species against Fusarium oxysporum f.sp ciceris for integrated management of chickpea wilt. Biological Control. 40: 118-127.
- Golakiya, B. B., Bhimani, M. D. and Akbari, L. F. (2018). Efficacy of different fungicides for the management of chickpea wilt (Fusarium oxysporum f. sp. ciceri). International Journal of Chemical Studies. 6 (2): 199-205.
- Haware, M. P., Nene, Y. L. and Natarajan, M. (1996). Survival of Fusarium oxysporum f. sp. ciceri. Plant Diseases. 66:809-10.
- Ingle, A. P. (2017). Diversity and identity of Fusarium species occurring on fruits, vegetables and food grains. Nusantra Bioscience. 1(1):44-51.
- Kamel, A. Ibrahim, N. A., Mohmed, A. Abdel, S. Mohamed, S. and Joseph, A. (2003). PCR identification of Fusarium genus based on nucler ribosomal-DNA sequence data. African Journal of Biotechnology. 2 (4): 82-85.
- Kumar, U. (2017). Integrated wilt disease management in chickpea. International Journal of Pure and Applied Biosciences. 5 (6): 981-984.
- Nazar, R.N., Hu, X., Schmidt, J., Culham, D. and Robb, J. (1991). Potential use of PCR-amplified ribosomal intergenic sequences in the detection and differentiation of Verticillium wilt pathogens. Physiological and Molecular Plant Pathology. 39(1): 1-11.
- Nene, Y. L., Haware, M. P. and Reddi, M. V. (1981). Chickpea diseases, resistance screening techniques. International Crop Research Institute for the Semi-Arid Ttropics, Patancheru, India. 21:65-71.
- Nybom, H. and Hall H.K., (1991). Minisatellite DNA fingerprints can distinguish Rubus cultivars and estimate their degree of relatedness. Euphytica. 53: 107-114.
- O´Donnell, K. (1992). Ribosomal DNA internal transcribed spacers are highly divergent in the phytopathogenic ascomycete Fusarium sambucinum (Gibberella pulicaris). Current Genetics. 22: 213-220.
- Padwick, G. W. (1941). Report of the Imperial Mycologist Rep. Imperial Agricultural Research Institute, New Delhi. pp 94-101.
- Patra, S., Kumar, M., Biswas and Mahato, A. (2017). Sustainable management of chickpea wilt caused by Fusarium oxysporum f.sp. ciceri. International Journal of Pure and Applied Biosciences. 5 (1): 526-529.
- Prasanthi, L., Reddy, B.B., Rani, K.R. and Naidu, P.H. (2009). Molecular marker for screening fusarium wilt resistance in pigeonpea [Cajanus cajan (L.) Millspaugh]. Legume Research. 32(1): 19-24.
- Rohlf, M. (1998). NTSYS-pc. Numerical taxonomy and multivariate analysis system, version 2.02i. Department of Ecology and Evolution. State University of New York, Setauket, USA
- Saxena, M. C. and Singh, K. B. (1987). The Chickpea C.A.B. Int. ICARDA. pp 250-252
- Sutherland, R., Altus, V., Alexander, A. and Berg, N. (2012). Pathogenicity associated genes in Fusarium oxysporum f. sp. cubense race 4. South African Journal of Science. 8: 109-112.
- Thakur, S.K. and Sirohi, A. (2009). Correlation and path coefficient analysis in chickpea (Cicer arietinum L.) under different seasons. Legume Research. 32(1):1-6.
- Welsh, J., Honeycut R.J., McClelland M. and Sorbral B.W.S., (1991). Parentage determination in maize hybrids using the arbitrarily primed polymerase chain reaction (AP-PCR). Theoretical and Applied Genetics. 82: 473-476.
Disclaimer :
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.
Copyright :
This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
In this Article
APC
APC cover the cost of turning a manuscript into a published manuscript through peer-review process, editorial work as well as the cost of hosting, distributing, indexing and promoting the manuscript.
Publish With US
Submit your manuscript through user friendly platform and acquire the maximum impact for your research by publishing with ARCC Journals.
Become a Reviewer/Member
Join our esteemed reviewers panel and become an editorial board member with international experts in the domain of numerous specializations.
Open Access
Filling the gap between research and communication ARCC provide Open Access of all journals which empower research community in all the ways which is accessible to all.
Products and Services
We provide prime quality of services to assist you select right product of your requirement.
Support and Policies
Finest policies are designed to ensure world class support to our authors, members and readers. Our efficient team provides best possible support for you.
Follow us
Published In
Legume Research