Quantitative Detection of Aflatoxin and Species Identification of Aspergillus section Flavi Isolates from Peanuts using Molecular Approaches 

Aspergillus spp. particularly, Aspergillus flavus and Aspergillus parasiticus produced aflatoxins (Lavkor, 2019). The identification of A. flavus and A. parasiticus as morphologically closely related is based on morphological characters, therefore the fungi isolates may have been incorrectly identified. The morphology-based method is reported to be insufficient for determining the aflatoxigenic Aspergillus to distinguish between aflatoxigenic and non-aflatoxigenic isolate of Aspergillus species, which have been focused on molecular methods based on aflatoxin biosynthesis genes (Khoury et al., 2011). Moreover, PCR-based methods are used on aflatoxin biosynthetic genes to identify aflatoxigenic fungi (Gonzalez-Salgado et al., 2008). PCR-RFLP is widely used to characterise the aflatoxin biosynthetic genes in Aspergillus species (Khoury et al., 2011). A. section Flavi have more than 20 genes involved in aflatoxin biosynthesis (Heperkan et al., 2012). The aflR and aflS (aflJ) are regulatory genes in aflatoxin biosynthesis (Georgianna and Payne, 2009).
       
Different molecular techniques are used to identify Aspergillus species that have aflatoxin biosynthesis genes (Ehrlich et al., 2007). Kesmen et al., (2014) reported that 66 A. flavus isolated from different products were detected using specific primer pairs for structural (pks 1) genes by PCR and they reported that this pair of primers could be used successfully in detecting aflatoxigenic A. flavus. In a study conducted in India, A. flavus isolated in peanut was performed by PCR targeting the aflR1 and aflR2 genes. As a result of the analysis, positive results were obtained from the PCR products (Manonmani et al., 2005). Midorikawa et al. (2014) reported that identification of 137 A. section Flavi isolates from nutshell material in the Amazon region of Brazil were amplified with rDNA ITS, β-tubulin and calmodulin gene regions by PCR. After the amplification, PCR product digested with DraI enzyme and A. section Flavi was defined as A. flavus, A. tamarii and A. nomius by PCR-RFLP. This result indicated that PCR-RFLP was defined as A. flavus, A. nomius and A. tamarii having aflatoxin biosynthesis genes.
       
In this study, modify molecular method approach was used for the first time for identification of Aspergillus section Flavi isolated from peanut samples during harvest and storage periods in Adana and Osmaniye. An investigation examined DNA sequence data to characterize 50 different fungal isolates and describe the species. The aim of this study was to to detect aflatoxigenic A. flavus and A. parasiticus isolates.

Aspergillus section Flavi isolates and culture conditions
 
A total of 50 Aspergillus section Flavi were isolated from peanut samples during harvest and storage periods in Adana and Osmaniye, Turkey. A. section Flavi fungal cultures were maintained on patato dextrose agar (PDA) and incubated at 25°C for 5 days. In order to obtain young mycelium for DNA extraction, fungal isolates were transferred in petri dishes containing 20 ml of modified PDA (For 200 ml: 8 g glicose, 75 g patato, 3 g agar) and incubated at 25°C overnight.
 
DNA extractions
 
DNA extractions were performed using some modifications according to the method described by Doyle and Doyle (1987). According to method, the young fungi mycelium was crushed using mortar and pestle with liquid nitrogen solution. The powder mycelium was collected in a 2 ml centrifuge tubes and incubated with 1 ml extraction buffer [2% (w/v) CTAB, 1.4 M NaCl, 0.2% (v/v) β-mercaptoethanol, 0.1 M Tris/HCl, 20 mM EDTA] for 60 min at 65°C on a thermomixer.
 
Then 1000 µl chloroform/isoamyl alcohol (24:1) added to tubes and centrifuged at 13000 rpm for 15 min 600 μl of the supernatant was transferred into 1.5 ml centrifuge tube, adding 600 μl of cold 2-propanol. Samples were then incubated for 2 h at -20°C and centrifuged for 10 min at 10000 rpm and then the supernatant was discarded. The pellet was washed with 1 ml of 70% ethanol and centrifuged for 10 min at 11000 rpm. Then supernatant discarded. Pellet was air dried for 1-2 hours then dissolved in 100 μl of sterile H₂O. Quantify the DNA samples by measuring the absorbance of the sample using a Nanodrop.
 
PCR amplification
 
According to Khoury et al., (2011), primer pair IGS-F/R was designed to target the intergenic spacer (IGS) for aflatoxin biosynthesis genes, aflR-aflJ (Ehrlich et al., 2003, 2007); that corresponded to PCR product of 674 bp. The primers’ sequences were as follows: IGS-F, 5' -AAGGAATTCAGGAATTCTCAATTG-3'; IGS-R, 5' -TCCACCGGCAAATCGCC GTGCG-3'. The β-tubulin gene was amplified to a 340 bp fragment on genomic DNA with primers Tub-F (CTCGAGCGTATGAACGTCTAC) and Tub-R (AAACCCTGGAGGCAGTCGC). The amplification was performed in 25 μL reaction volume containing: 12.5 μl buffer (10X Dream Taq Green Buffer), 1 μl genomic DNA, 1 μl of each primer, 9.5 μl ddH₂O. The PCR reaction were modified according to Khoury et al., 2011). The β-tubulin reaction conditions were modified: 95°C for 3 min, 40 cycles of 95°C for 30 s, 60°C for 30 s, 72°C for 1 min and extension of 10 min at 72°C. IGS reaction conditions were modified: 94°C for 4 min, 35 cycles of 94°C for 60 s, 57°C for 40 s, 72°C for 1 min and extension of 10 min at 72°C. The PCR amplified products were examined by electrophoresis on 1% w/v agarose gel.
 
RFLP analysis
 
The IGS PCR products were digested with restriction enzyme BglII. The reaction contained an equal volume (2 μl) of enzyme, 10X buffer 0, 10 μl of PCR product and purified water up to 32 μl and incubated for 1-16 hours at 37°C. 2 μl of 6X DNA Loading Blue for every 10 μl PCR product were mixed before 2% agarose gel loading. Then the fragments were separated by electrophoresis on 2% agarose gel for 3 h at 70 V.
 
DNA sequencing and phylogenetic tree
 
All sequence data were done by Medsantek. Alignment of the partial β-tubulin gene sequence data were performed using the software package MEGA sequence analysis software version 6.0 (Kumar et al., 2012). Multialignment was performed by Clustal W (Thompson et al., 1994) alignment program. Phylogenetic tree was conducted using MEGA version 6.0 (Kumar et al., 2012). The neighbour-joining method was constructed phylogenetic tree (Saito and Nei, 1987). The sequence similarities were performed using BLAST searches programs in the National Center for Biotechnology Information (NCBI).
 
Aflatoxin production
 
The Aspergillus cultures were grown in potato dextrose agar at 28°C for 7 days. The fungal spore suspension within Tween 20 (0.2%) was collected using filter paper into an erlenmeyer. Spores concentration was supplied of 5x10⁶ spores/ml into vials (Abbas et al., 2011). The flow rate was 1 ml/min and the injection volume was 100 ml. The Agilent 1100 HPLC system was used. The detection was performed at ex:360 nm and em:440 nm. The mobile phase was a mixture of water: acetonitrile: methanol (600:200:300, v/v/v) with addition of 132 mg KBr and 385 ml HNO₃ (AOAC, 2002).

Agarose gel electrophoresis separated the PCR products from amplification as shown in Fig 1 and Fig 2. PCR conditions for 50 DNA isolates by β-tubulin gene and IGS were amplified the size of 340 bp and 674 bp, respectively. A total of 50 DNA isolates were observed to have positive result in β-tubulin genes and IGS, respectively.
 

 

       
Molecular techniques have also been widely applied in an attempt to differentiate aflatoxigenic and non-aflatoxigenic isolates of Aspergillus species. Similar to our study, three (ver-1, omt-1 and apa-2) genes, coding for key enzymes and a regulatory factor in aflatoxin biosynthesis, have been used to detect A. flavus and A. parasiticus species in peanut, corn and grains. Positive DNA amplification have been obtained only aflatoxigenic A. flavus and A. parasiticus (Shapira et al., 1996). Four different regions in India have been examined to isolate aflatoxin-producing fungi in 80 peanut by targeting the aflR nor1 and ver1 aflatoxin biosynthesis genes. As a result of the study, positive correlation was remained between three genes and reference A. flavus isolates in 24 out of 80 samples (Hussain et al., 2015). Hence, this finding of the present study concurs with the literatures.
       
PCR-RFLP-based method was used to identify aflJ-aflR intergenic region of A. flavus and A. parasiticus isolates using aflatoxin biosynthetic genes (Khoury et al., 2011; Raphaël et al., 2013). PCR products of aflJ-aflR intergenic region were cleaved into three fragments of 362, 210, 102 bp and 363, 311 bp, respectively, using BglII restriction enzyme by PCR-RFLP (Fig 3). Similar results were achieved in another study, nine different regions in Serbia have been studied to isolate 10 Aspergillus spp. from post-harvest wheat. IGS-F/R primer pairs were targeted by PCR-RFLP analysis method of aflR-aflJ intergenic spacer and Aspergillus species were determined. All IGS-PCR products were digested with BglII enzyme. A. flavus and A. parasiticus having aflatoxin biosynthesis genes were separated fragments 362, 210, 102 bp and 363, 311 bp, respectively (Nikolic et al., 2018).
 

           
A total of 50 isolates obtained during harvest and storage period were described using sequence analysis of β-tubulin genes (Fig 4). As can be seen on phylogenetic tree, A. flavus and A. parasiticus have been identified in different groups. Analysis of the phylogenetic tree showed that isolate 20 found to be in a different branches. In addition, isolate 28 and isolate 51 were seen dramatically to be different in the group of 31 isolates. Nevertheless, 31 A. flavus isolates were high similarity in their group. Similar results were achieved in another study performed the dendrogram, which showed the genetic related within A. section Flavi isolated from soil and peanut samples from Cordoba region in Argentina, were divided into two groups as A and B. The isolates of 48 A. flavus and 34 A. parasiticus were included in group A and B, respectively (Barros et al., 2006).
 

       
In this study, 33 (66%) A. flavus and 17 (34%) A. parasiticus isolates are indicated aflatoxigenic properties. Aflatoxigenic 33 A. flavus isolates are produced AFB₁ and AFB₂ (Table 1). All the A. parasiticus isolates are produced B and G group of aflatoxins. In a similar study, total of 70 A. section Flavi isolated from maize in Italy was analyzed by HPLC. While A. flavus was representing 93%, 70% of A. section Flavi produced aflatoxins. A total of 23% isolates produced <10 ng/g, 10% isolates produced 10-100 ng/g, 12.8% isolates produced 100-1000 ng/g and 24.3% isolates produced >1000 ng/g of medium conditions (Giorni et al., 2007). In another similar study, total of 19 A. flavus isolated from maize samples were examined the aflatoxin production in liquid medium (8 days at 28°C) using TLC. 12 A. flavus (%63) produced aflatoxin B₁ and B2 between 10 and 700 µg g^-1 (Lee and Hagler, 1991). Variability in production of aflatoxins, especially among A. flavus isolates, has often been reported and discussed (Clevstrom and Ljunggren, 1985).
  

       
As many researchers reported aflatoxigenic A. parasiticus are widely detected in peanut (Vaamonde et al., 2003), peanut and sugarcane (Kumeda et al., 2003) growing fields. Totally, 37 A. parasiticus (94.6%) isolated from peanut, wheat and soybean was analyzed by HPLC, it produced AFB and AFG. So, describing an aflatoxigenic potential of A. parasiticus isolates would be appropriate (Vaamonde et al., 2003). In another similar study, it was reported that 18 A. parasiticus isolated from almonds in Portugal and all A. parasiticus isolated from soil of cornfields in Iran have high aflatoxigenic potential producing both B and G aflatoxins (Razzaghi-Abyaneh et al., 2006; Rodrigues et al., 2009).

In conclusion, 33 (66%) A. flavus and 17 (34%) A. parasiticus isolates are identified, respectively, as aflJ-aflR intergenic spacer for aflatoxin biosynthesis genes. This is the first study that modified molecular method of toxigenic A. flavus and A. parasiticus isolates from peanut in our country. This approach of differentiating A. flavus and A. parasiticus species are very rapid, specific and sensitive compared to traditional methods. All A. flavus and A. parasiticus isolates are aflatoxigenic Aspergillus species from peanut samples. Aflatoxigenic fungi may contaminate peanuts throughout several stages. This study will be provided for the determination of targeting genes that play a role in toxin production in our country. Prevention of preharvest contamination of peanut by aflatoxigenic Aspergillus species should be a critical focal point to prevent aflatoxin contamination and exposure.