The experiment was conducted in the year 2019-21 at the Department of Plant Pathology, Anand Agricultural University, Anand.
Sample collection
Green gram seeds were harvested from the BCMV infected plant showing symptoms like reduction and downward rolling of leaf lamina, necrosis of veins, leaf deformation and discolorations of interveinal area of leaf in the summer sown crop from plants grown in research fields at Anand Agricultural University, Anand. Seeds were harvested from infected green gram plants (variety GAM 5), labeled and stored. The seeds harvested from infected plants appeared darker in colour and shriveled (Fig 1).
Serological characterization
The detection of BCMV from different parts of infected seeds was done by performing the double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using a Bean common mosaic virus antibody (provided by LOEWE® company) as per the manufacturer’s protocol. Symptomatic samples (whole seed, seed coat, cotyledons and embryo) of mungbean variety GAM 5 and asymptomatic sample of
variety GM 4 were assayed for the presence of BCMV by DAS-ELISA as described by
Clark and Adams (1977) using polyclonal antibodies against BCMV. The absorbance of each well was measured at 405 nm (OD405) by ELISA-reader.
Molecular characterization
Isolation of RNA
Molecular detection was carried out for detection of the BCMV in GAM-5 variety of mungbean. The virus RNA was isolated through LiCl method from whole seed, seed coat, cotyledons as well as embryo of discoloured seeds of GAM-5 variety of mungbean.
RNA prurity check
Purity of isolated RNA was checked by electrophoresis. 3 μl of RNA was mixed with 2μl of gel loading dye and loaded on 1 per cent agarose gel containing Ethidium Bromide (0.5 mg/ml) and electrophoresed in 0.5X TAE buffer at 80 volts for 2 hours. Then the gel was viewed under Gel Documentation System using UV transilluminator. High quality and purity RNA was then used for cDNA synthesis.
CDNA synthesis
First strand cDNA synthesis was initiated at the polyadenylated 3’ terminus of the RNA with oligodT18 primer by reverse transcription performed in a 25 μl reaction mixture containing 1-2 μg of total RNA mixed with 5 μl of 5X reverse transcription buffer, 5 μl of 20 mMdNTP mix (Fermentas, USA), 10 μM of oligodT primer, 20 units of RNase inhibitor (0.5 μl) (Biogene), 200 units of reverse transcriptase (1 μl) and RNase free water added to make final volume. The reaction mixture was incubated at 37°C for 75 minutes and then heated for 5 minutes at 70°C to inactivate reverse transcriptase. RT-PCR was carried out using BCMV coat protein (CP) gene specific primers.
Detection of BCMV through polymerase chain reaction (PCR) using specific primers
The RNA extracted from different parts of a single seed and was reverse-transcribed and amplified using BCMV-CP virus specific primers
viz., BCMV-CP-F (TGGCTGCTT GAGAGA GATGA) and BCMV-CP-R (ATCACTCTGCATGTCCTCAC). The amplified product was analyzed by gel electrophoresis. RT-PCR reaction was performed as one step of initial denaturation at 94°C for 3 minutes, followed by 35 cycles of denaturation at 94°C for 50 seconds, annealing at 59°C for 1 minute, extension at 72°C for 1 minute. The last cycle of final extension was ended at 72°C for 30 minutes. The amplicons were analyzed on 1.8% agarose gel at 60 V in TAE (40.0 M Tris/acetate, 1.0 mM EDTA and pH 8.0) and stained with ethidium bromide.
Virus specific bands obtained in PCR amplification were eluted and sequenced by Eurofins Pvt. Ltd and results were analyzed in NCBI nucleotide BLAST to find out similarity of newly sequenced sample with previously available virus sequences.
Grow out test
Grow out test was conducted in insect proof cage under protected condition using BCMV infected seeds of mung bean (Var. GAM 5) and seeds of variety GM 4 were also sown under the protected condition in separate pot. The observations were taken periodically for symptom appearance. Symptoms of BCMV appeared under protected condition in GAM 5 seedlings. Further, the confirmation was done using the DAS-ELISA test.
