Legume Research

  • Chief EditorJ. S. Sandhu

  • Print ISSN 0250-5371

  • Online ISSN 0976-0571

  • NAAS Rating 6.80

  • SJR 0.391

  • Impact Factor 0.8 (2023)

Frequency :
Monthly (January, February, March, April, May, June, July, August, September, October, November and December)
Indexing Services :
BIOSIS Preview, ISI Citation Index, Biological Abstracts, Elsevier (Scopus and Embase), AGRICOLA, Google Scholar, CrossRef, CAB Abstracting Journals, Chemical Abstracts, Indian Science Abstracts, EBSCO Indexing Services, Index Copernicus
Legume Research, volume 45 issue 11 (november 2022) : 1459-1462

Identification and Characterization of Sclerotinia sclerotiorum (Lib.) de Bary Associated with Rhynchosia bracteata Benth. Ex Bak. of Wild Derivatives of Pigeonpea from India

R.K. Mishra1,*, Naimuddin1, Monika Mishra1, Abhishek Bohra1, S.J. Satheesh Naik1
1ICAR-Indian Institute of Pulses Research, Kanpur-208 024, Uttar Pradesh, India.
  • Submitted21-01-2020|

  • Accepted21-07-2020|

  • First Online 09-11-2020|

  • doi 10.18805/LR-4328

Cite article:- Mishra R.K., Naimuddin, Mishra Monika, Bohra Abhishek, Naik Satheesh S.J. (2022). Identification and Characterization of Sclerotinia sclerotiorum (Lib.) de Bary Associated with Rhynchosia bracteata Benth. Ex Bak. of Wild Derivatives of Pigeonpea from India . Legume Research. 45(11): 1459-1462. doi: 10.18805/LR-4328.
Background: Pigeonpea [Cajanus cajan (L.) Millsp.], an important grain legume crop that is predominantly cultivated in tropical and sub-tropical regions of the world (Nene and Sheila, 1990).  Crop wild relatives (CWR) are valuable source of novel alleles for economic traits which when transferred to cultivated species adapt well to changing biotic stresses, farming practices, market demands and climatic conditions. Under proposed study the detailed symptomatology, cultural, morphological and pathogenic characteristics of the causal agent and molecular identification of the pathogen were identified.

Methods: Of the total 79 accession of wild relatives of pigeonpea (Cjanus cajan) planted in the experimental fields of ICAR- Indian Institute of Pulses Research (IIPR), Kanpur during 2017-18, one accession (ICP-817) of Rhynchosia bracteata was found to be affected by a disease characterized by leaf and stem blight symptoms. Disease symptoms appeared in January–February, 2017 and 2018. Presence of water soaked lesions on the leaves and stem which later turned chalky in appearance, cottony white mycelium on the affected plant parts along with black coloured irregularly circular sclerotia resembled those of white mold fungus Sclerotinia sclerotiorum (Lib) de Bary were  observed.

Result: Pathogenicity of the fungus was proved using detached leaf/twig inoculation techniques. Morphological characters and the sequences of internal transcribed spacer (ITS) region of the fungus confirmed the causal agent of the disease to be Sclerotinia sclerotiorum (Lib) de Bary. This is the first report of the Sclerotinia sclerotiorum on Rhynchosia bracteata not only in India but also in the world.  
Wild relatives of crop plants beyond crop’s primary gene pool offer an opportunity to introduce novel traits into the elite agronomic bases (Hannes et al., 2017). These wild relatives are exploited for increasing the adaptive capacity of agricultural crops world-wide. These wild relatives are also exploited to expand the genetic base of cultivated types. Last few decades, there has been significant progress in introducing traits from wild species into cultivated crops (Prescott-Allen and Prescott-Allen 1986; Kilian et al., 2010). Rhynchosia species are wild relatives of pigeonpea (Cajanus cajan Millsp.), a popular legume crop of India and are being exploited for widening the genetic base of cultivated Cajanus cajan (Sharma, 2017). Sclerotinia sclerotiorum (Lib.) de Bary, a ubiquitous and necrotrophic pathogen with a broad host range is known to occur worldwide (Mehta, 2009, Steadman et al., 1994). It is a major disease of several leguminous crops in different parts of the world (Boland and Hall, 1994; Nene et al., 1996; Kim et al., 2000; Mishra et al., 2015; Delclos et al., 1997). During January-February of 2017 and also of 2018, stem rot was observed in wild relative of pigeonpea i.e. Rhyncosia bracteata at Indian Institute of Pulses Research (IIPR), Research Farm, Kalyanpur, Kanpur, India. Review of literatures revealed that in India no such disease of Rhyncosia bracteata has been reported till date. Therefore, the present investigation was undertaken to study the detailed symptomatology, cultural, morphological and pathogenic characteristics of the causal agent and molecular identification of the pathogen.
Isolation and identification of the pathogen
 
During the field observations in the month of January-February, 2017-18 one accession (ICP-817) of R. bracteata grown at ICAR-Indian Institute of Pulses Research (IIPR), Kanpur was found to be affected by a disease with symptoms resembling those reported for stem rot in many crops. The diseased plant parts viz., leaves, petioles and stem were collected from field and examined in the laboratory. Small pieces (2 mm) of diseased samples were cut, surface sterilized with sodium hypochlorite (1.0%) for 2 minutes, rinsed thoroughly in sterile distilled water (SDW), blotter dried, inoculated on potato dextrose agar (PDA) amended with 100 μg/mL streptomycin sulphate in petridishes (90 mm) and incubated at 25±1°C and observed regularly. Data on mycelium growth (mm), number and size (mm) of sclerotia were measured after 24, 48, 72 and 96hrs of incubation. The pathogen was identified based on morphological, pathological and molecular characteristics.
 
Pathogenicity of the pathogen
 
Pathogenicity of the causal organism was confirmed by detached leaf method (Steadman et al., 1997) under laboratory condition. Healthy wild pigeonpea leaves of Rhyncosia bracteata placed in a petridishes with moist filter paper were inoculated by placing 2 mm mycelial bit from a five days old culture and incubated at 27°C. The inoculated leaves were periodically observed for appearance of disease symptoms, if any.
 
Molecular characterization
 
The pure culture of S. sclerotiorum was grown on potato dextrose broth (PDB) for 7 days at 22±1°C in a BOD incubator. Mycelia were filtered through Whatman No. 1 filter paper and genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The internal transcribed spacer (ITS) regions 1 and 2, including the 5.8S ribosomal DNA (rDNA) region, were amplified by polymerase chain reaction (PCR) using universal primers ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGC TTATTGATATGC) (White et al., 1990) synthesized by Xcelris Genomics PrimeX. PCR was performed in a Bio-Rad thermal cycler (Model iCycler) programmed for 35 cycles with one step of initial denaturation at 94°C for 3 min and denaturation for 1min at 94°C, annealing at 52°C for 1 min and extension at 72°C for 1 min. followed by one step final extension at 72°C for 5 minutes. PCR tests were conducted with PCR master mix (Gene mark)in a reaction mixture volume of 30 μL that contained 6 μL of PCR MasterMix (Gene Mark), 0.8 μl of each primer, 1 μl template DNA and 21.4 μl nuclease free water (Himedia). The PCR products were analyzed by electrophoresis in 2% agarose gel and staining with 0.1% ethidium bromide. The gel was visualized under UV light and photographed with a gel documentation unit (Syngene Inc., Cambridge, UK). PCR products of the target DNA were excised from agarose gels, purified using the QIAquick gel extraction kit (Qiagen) and sequenced through service provider, M/S Chromus Biotech, Banglaore, India. The sequences of the PCR product were subjected to blast using NCBI data base and multiple alignments using CLUSTAL W (Thompson et al., 1994).
 
Phylogenetic analysis
 
Phylogenetic analysis was performed with the ITS region sequence of S. sclerotiorum of Rhynchosia bracheata and other sequences of S. sclerotiorum associated with other pulse crops available at NCBI database (Fig 2). Sequences were aligned with Cluster followed by construction of phylogenetic tree using maximum likelihood method with the software MEGA 5.01 (Tamura et al., 2011). All positions containing gaps and missing data were eliminated. The bootstrap analysis was implemented using 1000 replicates of heuristic searches to determine the confidence levels of the inferred phylogenies.
 

Fig 2: Phylogenetic tree constructed with sequence of the internal transcribed spacer ribosomal DNA (rDNA) region of new isolates of S. sclerotiorum (Highlighted) with closely related strains retrieved from GenBank database.

Symptomatology of the disease
 
Symptoms observed on the affected plant parts of Rhynchosia bracheata included water soaked lesions on the leaflets and the petioles and rotting of the stem (Fig 1a). Dried lesions on leaflets and stem turned straw coloured (Fig 1b). White fluffy mycelium was observed on the affected stems (Fig 1c) and in some cases a few black sclerotia were seen (Fig 1d). The symptoms were indicative of infection of white mold (Sclerotinia sclerotiorum) on R. bracheata plants.
 

Fig 1: (a) Water soaked lesions on the leaflets and rotting of stem (b) leaf and stem dried (c and d) White fluffy mycelium on affected stems (e) sclerotia were formed on stem/leaf (f) hard black sclerotia formed on PDA containing petriplate (g) Pathogenicity studies on leaves and stem.


 
Isolation, morphological and cultural identification of the pathogen
 
White cottony mycelium coming out of diseased plant samples was observed on the third day after inoculation on PDA. Fungal growth covered the whole plate (90 mm diam.) within 4-5 days. Further incubation of the plates resulted in the aggregation of mycelium in a roughly circular manner mostly on the periphery of the colony and these aggregates started turning in to black coloured irregular sclerotia after 7-10 days (Fig 1e). Sclerotia produced on PDA measured around 5-10mm after 7 days of incubation. Microscopic observation revealed hyphae to be hyaline, branched and multinucleate. Based on cultural characteristics and microscopic observations, the fungus was identified as Sclerotinia scletiorum (Lib.) de Bary.
 
Pathogenicity of the pathogen
 
Inoculated leaves developed water soaked lesions with white mycelial growth on leaves after 72 hrs of inoculation and resembled those observed in the fields (Fig 1g). Un-inoculated leaves did not develop any symptoms (Fig 1g). The fungus was re-isolated from infected leaves and stems, fulfilling Koch’s postulates.
 
Molecular identification
 
Identity of the fungus was further confirmed by sequence homology of ITS region. Sequencing of PCR amplified product revealed it to be of 558 bp size (NCBI accession no. MK828202), showed 99-100% query coverage and >99-100% identity with isolates of S. sclerotiorum from different hosts. S. sclerotiorum is known to infect more than 500 plant species world-wide and has been reported on variety of plants from different states of India (Saharan and Mehta, 2008). Present report adds Rhynchosia bracteata as a new host of S. sclerotiorum (Lib.) de Bary. To the best of our knowledge, this is the first report of S. sclerotiorum infection in R. bracteata not only from India but also across world.
The authors are highly thankful to the Director, ICAR-Indian Institute of Pulses Research, Kanpur for providing necessary facilities to conduct the research.
The authors declare that they have no conflict of interest to this research work.

  1. Boland G. J. and Hall R. (1994). Index of plant hosts of Sclerotinia sclerotiorum. Cana. J. Plant Pathol. 16: 93-108.

  2. Delclos B, Mousset-Declas C and Raynal G. (1997). A simple method for the evaluation of red clover (Trifolium pratense L.) resistance to Sclerotinia trifoliorum. Euphytica. 93: 173-179.

  3. Hannes, Dempewolf, Gregory Baute, Justin Anderson, Benjamin Kilian, Chelsea Smith and Luigi Guarino (2017). Past and Future Use of Wild Relatives in Crop Breeding. Crop Sci. 57: 1070-1082. doi: 10.2135/cropsci2016.10.0885.

  4. Kilian, B., W. Martin and F. Salamini. (2010). Genetic diversity, evolution and domestication of wheat and barley in the fer­tile Crescent. In: Evolution in action. [M. Glaubrecht, (editor)], Springer Berlin Heidelberg, Berlin, Heidelberg. p. 137-166.

  5. Kim H.S., Hartman G.L., Manandhar J.B., Graef G.L., Steadman, J.R. and Diers B.W. (2000). Reaction of soybean cultivars to sclerotinia stem rot in field, greenhouse and laboratory evaluations. Crop Sci. 40: 665-669.

  6. Mehta N. (2009). Sclerotinia stem rot-An emerging threat in mustard. Plant Dis Res. 24: 72-73.

  7. Mishra, R.K., Naimuddin, Akram and P.R. Saabale (2015). First report of Stem rot disease on Pigeonpea caused by Sclerotinia sclerotiorum (Lib.) de. Bary from India. Vegetos. 28(3): 8-11.

  8. Murray M.G., Thompson W.F. (1980). Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8: 4321-4326.

  9. Nene Y.L., Sheila Y.K. and Sharma S.B. (1996). A world list of chickpea and pigeonpea pathogens. Information Bulletin No.9. ICRISAT, India.

  10. Nene Y.L. and Sheila V.K. (1990) Pigeonpea: geography and importance. In: Nene YL, Hall SD and Sheila VK (eds) The Pigeonpea. Wallingford, Oxon: CAB International, pp. 1-14

  11. Prescott-Allen, C. and R. Prescott-Allen. (1986). The first resource: Wild species in the North American economy. Yale Univ. Press, New Haven, CT.

  12. Saharan G.S., Mehta N. (2008). Sclerotinia Diseases of Crop Plants: Biology, Ecology and Disease Management. Springer, 485 pp.

  13. Sharma, Shivali (2017). Pre-breeding Using Wild Species for Genetic Enhancement of Grain Legumes at ICRISAT. Crop Sci. 57: 1132-1144.

  14. Thompson J.D., Higgins D.G., Gibson T.J. (1994). Clustal W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673-4680.

  15. Tamura, K., Peterson, D., Peterson, N., Stecher, G. and Nei, K.S. (2011): MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance and maximum parsimony methods. Mol. Biol. Evol. 28: 2731-2739.

  16. White T.J., Bruns T., Lee S., Taylor J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols. A Guide to Methods and Applications. [Innis MA, Gelfand DH, Sninsky JJ, White TJ, (eds)]. San Diego, Academic Press, 315-322.

  17. Stevens, R.B. (1974). Mycology Guidebook Committee, Mycology Society of America. pp. 703. University of Washington Press, Seattle and London.

Editorial Board

View all (0)