Isolation and identification of the pathogen
During the field observations in the month of January-February, 2017-18 one accession (ICP-817) of
R. bracteata grown at ICAR-Indian Institute of Pulses Research (IIPR), Kanpur was found to be affected by a disease with symptoms resembling those reported for stem rot in many crops. The diseased plant parts
viz., leaves, petioles and stem were collected from field and examined in the laboratory. Small pieces (2 mm) of diseased samples were cut, surface sterilized with sodium hypochlorite (1.0%) for 2 minutes, rinsed thoroughly in sterile distilled water (SDW), blotter dried, inoculated on potato dextrose agar (PDA) amended with 100 μg/mL streptomycin sulphate in petridishes (90 mm) and incubated at 25±1°C and observed regularly. Data on mycelium growth (mm), number and size (mm) of sclerotia were measured after 24, 48, 72 and 96hrs of incubation. The pathogen was identified based on morphological, pathological and molecular characteristics.
Pathogenicity of the pathogen
Pathogenicity of the causal organism was confirmed by detached leaf method
(Steadman et al., 1997) under laboratory condition. Healthy wild pigeonpea leaves of
Rhyncosia bracteata placed in a petridishes with moist filter paper were inoculated by placing 2 mm mycelial bit from a five days old culture and incubated at 27°C. The inoculated leaves were periodically observed for appearance of disease symptoms, if any.
Molecular characterization
The pure culture of
S. sclerotiorum was grown on potato dextrose broth (PDB) for 7 days at 22±1°C in a BOD incubator. Mycelia were filtered through Whatman No. 1 filter paper and genomic DNA was extracted through modified CTAB method (
Murray and Thompson 1980). The internal transcribed spacer (ITS) regions 1 and 2, including the 5.8S ribosomal DNA (rDNA) region, were amplified by polymerase chain reaction (PCR) using universal primers ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGC TTATTGATATGC)
(White et al., 1990) synthesized by Xcelris Genomics PrimeX. PCR was performed in a Bio-Rad thermal cycler (Model iCycler) programmed for 35 cycles with one step of initial denaturation at 94°C for 3 min and denaturation for 1min at 94°C, annealing at 52°C for 1 min and extension at 72°C for 1 min. followed by one step final extension at 72°C for 5 minutes. PCR tests were conducted with PCR master mix (Gene mark)in a reaction mixture volume of 30 μL that contained 6 μL of PCR MasterMix (Gene Mark), 0.8 μl of each primer, 1 μl template DNA and 21.4 μl nuclease free water (Himedia). The PCR products were analyzed by electrophoresis in 2% agarose gel and staining with 0.1% ethidium bromide. The gel was visualized under UV light and photographed with a gel documentation unit (Syngene Inc., Cambridge, UK). PCR products of the target DNA were excised from agarose gels, purified using the QIAquick gel extraction kit (Qiagen) and sequenced through service provider, M/S Chromus Biotech, Banglaore, India. The sequences of the PCR product were subjected to blast using NCBI data base and multiple alignments using CLUSTAL W
(Thompson et al., 1994).
Phylogenetic analysis
Phylogenetic analysis was performed with the ITS region sequence of
S. sclerotiorum of
Rhynchosia bracheata and other sequences of
S. sclerotiorum associated with other pulse crops available at NCBI database (Fig 2). Sequences were aligned with Cluster followed by construction of phylogenetic tree using maximum likelihood method with the software MEGA 5.01
(Tamura et al., 2011). All positions containing gaps and missing data were eliminated. The bootstrap analysis was implemented using 1000 replicates of heuristic searches to determine the confidence levels of the inferred phylogenies.
