Legume Research

  • Chief EditorJ. S. Sandhu

  • Print ISSN 0250-5371

  • Online ISSN 0976-0571

  • NAAS Rating 6.80

  • SJR 0.391

  • Impact Factor 0.8 (2024)

Frequency :
Monthly (January, February, March, April, May, June, July, August, September, October, November and December)
Indexing Services :
BIOSIS Preview, ISI Citation Index, Biological Abstracts, Elsevier (Scopus and Embase), AGRICOLA, Google Scholar, CrossRef, CAB Abstracting Journals, Chemical Abstracts, Indian Science Abstracts, EBSCO Indexing Services, Index Copernicus
Submit

Research Article

Legume Research, volume 44 issue 12 (december 2021) : 1512-1520

Isolation, Identification and Role of Novel Endosymbiotic Bacterium Rhizobium pusence in Root Nodule of Green Gram cv.OUM-11-15 (Vigna radiata L.) under Salinity Stress

R. Das1,*, M. Pradhan2, R.K. Sahoo3, S. Mohanty4, M. Kumar1
1Department of Soil Science, Dr. Rajendra Prasad Central Agricultural University, Pusa, Samastipur-848 125, Bihar, India.
2PG Department of Botany, Utkal University, Vani Vihar, Bhubaneswar- 751 004, Odisha, India.
3Department of Biotechnology, Centurion University of Technology and Management, R.Sitapur-761 211, Odisha, India.
4Department of Soil Science and Agricultural Chemistry, College of Agriculture, Odisha University of Agriculture and Technology, Bhubaneswar-751 003, Odisha, India.

  • Submitted18-09-2019|

  • Accepted09-04-2020|

  • First Online 15-05-2020|

  • doi 10.18805/LR-4239

Cite article:- Das R., Pradhan M., Sahoo R.K., Mohanty S., Kumar M. (2021). Isolation, Identification and Role of Novel Endosymbiotic Bacterium Rhizobium pusence in Root Nodule of Green Gram cv.OUM-11-15 (Vigna radiata L.) under Salinity Stress . Legume Research. 44(12): 1512-1520. doi: 10.18805/LR-4239.

ABSTRACT

In this study, most efficient salinity stress tolerant Rhizobium strain named Rhizobium pusence strain KHDEB5 was identified from root nodules of OUM-11-15 out of fifteen endophytic isolates from root nodules of four (PDM54, SML668, Pusa Baisakhi and OUM-11-15) green gram cultivars from five different locations of Khordha district of Odisha, India and after a series of evaluation. Its 16S rRNA sequence was provided with accession number KY679150 by NCBI. Nodulation behavior of R. pusense strain KHDEB5 was evaluated under different levels of salinity stress (NaCl concentrations) by bioinoculation with green gram (cv. OUM-11-15) seeds. In seed germination bioassay (green gram cv. OUM-11-15) with five nodulating rhizobium strain, R. pusense strain KHDEB5 recorded (31%) higher seedling dry weight with salinity stress upto 500 mM of NaCl when compared with the other strains. The strain R. pusense strain KHDEB5 was found to be most tolerant to salinity (up to 1000 mM NaCl) and also could tolerate up to pH 8.5. In pot culture study, with same seed, Rhizobium pusense strain could enhance N concentration in green gram with salinity stress upto 1000 mM of NaCl. Bioinoculation of most efficient endophyte R. pusense strain KHDEB5 could enhance 112% to 137% N concentration in green gram without salinity stress and 31% with salinity stress upto 1000 mM of NaCl in pot culture studies. R. pusence strain KHDEB5 could be considered most resistant native rhizobium to enhance root nodulation even at salinity stress. 

INTRODUCTION

Soil supports plant growth indefinitely when it is replenished with nitrogen (N) taken away by the crop plant year after year. Atmosphere contains more than 70% of N, but only about 0.1% of fixed nitrogen is present in soil. Electric discharges at the time of lightning, photochemical actions contribute very minute quantities of nitrogen, which do not account for even a small fraction of N which is utilized by the plant. Since, the development of industrial N fixation process by Haber-Bosch process the use of chemical fertilizers has been proliferated. Between 1960 and 2009 global fertilizer consumption increased more than tenfold: from 10.8 metric tons (Mt) per year to 113 million Mt per year (Crews and Peoples 2004). Nitrogenous fertilizers applied through inorganic sources results in increased yields but simultaneously promote sizable N loss, while addition of N through biological processes enhances more soil available N as well as crop yield (Crews and Peoples 2004).
        
Although chemical fertilizers have played a significant role in green revolution, inappropriate and imbalanced uses of chemical fertilizers are affecting gradually the soil fertility, crop quality and to environmental degradation. Therefore, bioinoculation with Rhizobium in leguminous plants contributed for crop growth stimulation, a substitute for costly nitrogenous fertilizers (Tairo and Ndakidemi 2013). One of the most abundant natural resources that are freely available in all cropping environment is atmospheric dinitrogen (N2). It is self-evident, that N fixation will play a central role in future agricultural system. The legume-rhizobium symbiosis is one of the best relationships to both ecological and economic importance.
        
Green gram is one of the major pulse crops in India. The growth and yield of pulses is greatly influenced by the application of nutrient elements and biofertilizers. Rhizobia is one of the dominant symbiotic nitrogen fixing bacteria in leguminous crops but most often lower count of rhizobacteria in soil lead to poor nodulation and nitrogen fixation in legumes. There is a great possibility to increase production in legume plants by exploiting better colonization around  the root zone through rhizobial inoculation. The Rhizobium-legume symbiosis is superior to other N-fixing systems due to its high potential (Sanaa and Fawziah 2005). The terrestrial flux of N from biological N fixation has been estimated to range from 139-170 Mt per year (Russeile 2008). Thus emphasis should be given for establishment of efficient symbiotic N2-fixing systems in legumes. These rhizobia colonize near roots of leguminous plants and infect them for fixation of atmospheric N through symbiotic processes (Mohammadi and Sohrabi 2012).
        
The utilization of native rhizobia as inoculants promote ecologically sustainable management of agricultural ecosystems and enhance legume production due to their growth promoting traits and adaptability to soil and environmental stress (Mwangi et al., 2011). Furthermore, crop production using inoculants could be cheaper and more affordable to the resource-poor smallholder farmers (Singh et al., 2016). The ability of native strains to interact positively with the resident soil micro biota and their adaptability to the local agroecological climatic conditions often elucidates their superior performance over the exotic commercial strains (Meghvansi et al., 2010). In order to achieve maximum legume productivity, screening of native isolates for their N fixation efficiencies is vital (Anglade et al., 2015). The present study is to isolate and characterize endosymbiotic bacteria from root nodule of green gram cv. OUM-11-15 (Vigna radiata L.). In this study, we report the discovery of novel potential strains of R. pusense KHDEB5. The 16S rRNA sequence revealed novelty of native R. pusense KHDEB5 (KY679150) in the NCBI database. This strain notably increased crop growth and nodulation via their N-fixing and salt tolerant activity in green gram (cv. OUM-11-15) fields of Odisha, India.

MATERIALS AND METHODS

The present study entitled “Isolation, identification and role of novel endosymbiotic bacterium Rhizobium pusence in root nodule of green gram cv.OUM-11-15 (Vigna radiata L.) under salinity stress” was carried out in Dept. of Soil Science and Agril. Chemistry during the year 2015-2017. Green gram nodule samples and rhizospheric soil samples were collected at 45 days after sowing (DAS) from four green gram cultivars viz; PDM54, SML668, Pusa Baisakhi and OUM-11-15 from four villages (Jagiribadi, Routpada, Katakpatna and Chhima) of Khordha district of Odisha, India and stored at 4°C.
 
Isolation and biochemical characterization of the nodule endophytic bacterial isolates
 
Detached green gram nodules after washing were sterilized with 0.1% sodium hypochloride (NaOCl) solution for 30 s and were washed thoroughly with distilled water (Vincent 1970). Surface sterilized nodules were crushed and obtained milky suspension was streaked against yeast mannitol agar (YMA) medium containing congo red and incubated (30± 2°C, 48 h). White, translucent, elevated and mucilaginous colonies were streaked on YMA tubes and stored at 4°C for further characterization. Morphological characteristics, viz. shape, size, motility and gram’s stain of the endophytic isolates were examined under phase contrast light microscope (×100 objective). Various physiological and biochemical tests such as triple sugar iron, mannitol, motility, methyl red, voges-proskauer (acetoin production), citrate utilization (Simmon’s citrate agar), anaerobic growth, amino acid decarboxylase, indole production, nitrate reduction, carbohydrate oxidation and fermentation and enzyme activities, i.e. urease, oxidase, catalase, cellulose, amylase, chitinase, lipase (Tributyrin), caseinase, DNAase, nitrate reductase, nitrite reductase, gelatinase were tested following standard methods (Bergey’s manual 1994) (Patel et al., 2013). The isolates were further screened for antibiotic resistance by disc diffusion method on Mueller-Hinton agar plate (Bauer et al., 1966).
 
Confirmatory Tests
 
Five different confirmatory tests viz. growth on YMA with Congo red ,growth on glucose peptone agar (GPA) medium (Vincent, 1970), Keto-lactase Test (Holt, 1994), growth on hoffer’s alkaline media (Hofer, 1935) and growth on 8% KNO3 (Subba Rao, 2006) medium were performed to confirm the isolate as Rhizobia and to differentiate them from other contaminating microbes.
 
Infectivity test
 
The nodulation experiment was conducted with fine graded sterilized river sand (20 lb pressure per inch square for 2 hrs) and sterilized soil (2:1 ratio) in disposable cups of 250 g capacity to study nodulating activity of the organism. Seeds of green gram inoculated with Rhizobium isolates (those passed the confirmatory test) were placed at a depth of 2-3 cm. After 4-6 days of sowing 2 healthy plants were maintained by thinning out extra seedlings. The cups were properly labeled and control set was kept with uninoculated seeds. Timely and uniform irrigation was provided to all the cups by N free McKnight’s (McKnight, 1949) seedling nutrient solution as and when required. The plant of the nodulation experiment was harvested in 35 DAS (early flowering stage).
 
Germination bioassay of green gram (cv. OUM-11-15) inoculated with nodulating rhizobial strains in different NaCl concentration
 
As per the method developed by Warham (1990) germination of the seeds was determined in the laboratory at room temperature of (30±2°C). 200 seeds were randomly taken from each treatment and 50 seeds were placed between a pair of rolled moist paper towels and were replicated four times. Five treatments (S1, S2, S3, S4 and S5) from each i.e. uninnoculated and inoculated with nodulating Rhizobium isolates (KHDK1, KHDR1, KHDEB5, KHDEB2, KHDEB3) having one control each given different concentration of salt solutions as NaCl i.e. 200 mM, 500 mM, 1000 mM and 1200 mM respectively, each with four replication were taken. An amount of 200 seeds of green gram (cv. OUM-11-15), each treatment was kept on wet paper towels (as per ISTA) and was wrapped thereafter with another paper towel. Water level with and without above mentioned salt concentrations were maintained for 8 days to prevent desiccation of seedlings. After 8 days germination %, seedling length and dry weight of 10 randomly selected seedlings from each treatment were taken.
 
Molecular characterization (16s rRNA)
 
The genomic DNA of the efficient bacterial isolate was isolated by using (Pure Link Genomic DNA kit, Invitrogen) genomic DNA isolation kit. Amplicon was electrophoresed in a 1% Agarose gel and visualized under UV-VIS gel doc system. The 16S rDNA was PCR amplified using the forward primer (5'AGAAAGGAGGTGATCCAGCC3') and reverse primer (5'AGAGTTTGATCMTGGCTCAG3') at 94°C for 4 min, 94°C for 1 min, 58°C for 1 min, 72°C for 1.30 s for 30 cycles and then 72°C for 8 min. The PCR reaction mixture consisted of template DNA (150 ng), enzyme: Taq polymerase (1.5 U/µl), 10 X Taq polymerase buffer (100 mM Tris (pH 9), 500 Mm KCl, 15 mM MgCl2, 0.1% gelatin), dNTP mix (10 mM), 10 µm each primer. The amplified full length products (1.4 kb) were sequenced using ABI 3130xl analyzer following Sanger’sdideoxy termination method. The sequences were BLAST at ncbi.nlm.nih.gov and the Phylogenetic tree was constructed after multiple sequence alignment in MEGA4 software. The Phylogenetic tree was constructed after multiple sequence alignment using cluster algorithm (Yushmanov and Chumakov 1988). The phylogenetic tree was built on the matrix of pair distances between sequences. In the boot strap a multiple alignment was resembled 100 times.
 
Abiotic stress tolerance and pot culture experiment with green gram (cv. OUM-11-15) treated with different levels of salinity stress
 
The identified isolate was inoculated to yeast mannitol broth (YMB) medium maintained with salinity level of 1%, 2.5%, 5% and 7.5% NaCl respectively and to YMB maintained at pH 4.0, 5.0, 7.0, 8.5 and 10 respectively and incubated (30°C,72 hr) for salt stress tolerance and pH tolerance. The turbidity of the medium was measured at an interval of 24 hrs for 3 days at 660nm wavelength using visible spectrophotometer.
        
In order to confirm the degree of effectiveness of isolated strains to tolerate salinity stress, a separate pot experiment was conducted with green gram (cv. OUM-11-15) in Department of Soil Science and Agricultural Chemistry, College of Agriculture OUAT, Bhubaneswar during kharif 2017 with total 24 pots i.e. 8 treatments with 3 replications each in RCBD with recommended dose of 20:60:40 of N2, P2O5 and K2O.The salt source NaCl was given to the treatments in solution form with different concentrations (200 mM, 500 mM and 1000 mM)following the treatment schedule. The experiment was carried out with green gram (OUM-11-15) with eight treatments and three replications in pots.
 
Selected strain was grown in nutrient broth at 28°C and 120 rpm for 72 h. The culture was grown to achieve optical density of 0.9 (108 to 109 CFU ml-1) at 620 nm wavelength. The broth was then centrifuged at 12000 rpm, the pellets obtained were washed thrice with 0.1 M phosphate buffer (pH- 7.0) and then dissolved in phosphate buffer (cell count - 3.0 × 108 CFU ml-1). Green gram (Vigna radiata L. cv. OUM-11-15) seeds were surface sterilized with 1% NaOCl for  30 sec and then repeatedly (6 times) rinsed with sterile distilled water for 15 – 20 min. Sterilized seeds were then placed in glass petridishes and soaked in phosphate buffer for 2 h (Dey et al., 2004; Fernandez et al., 2007). For each seed 5 ml of phosphate buffer was used. Five inoculated seeds were sown in each of earthen pots (size - 103 ) filled with 10 kg soil. The treatment details were mentioned in Table 1.
 

Table 1: Treatment details of pot culture experiment with green gram (cv. OUM-11-15) treated with different levels of salinity stress and R. pusence strain KHDEB5.


        
The height of plants from each pot was recorded at fortnightly interval to get the mean plant height. The number of effective nodules were calculated from the uprooted plant at 40 DAS and averaged to get the nodule number and weight per plant. Root volume was measured using water displacement technique as suggested by Mistra and Ahmed (1987) at 30 and 50 DAS and expressed in cc plant-1. Nitrogen in the processed plant sample was determined by Kjeldahl digestion method as described by Wright and Wilkinson (1993).
 
Statistical analysis
 
The growth and nodular parameters from the pots were taken in to account for estimation. The values of parameters obtained with presence and absence of salt stress were subjected to Fisher’s method of analysis of variance (ANOVA) as outlined by Gomez and Gomez (1984) and data were compared with critical differences with Pearson’s coefficient (P≤0.05).

RESULTS AND DISCUSSION

Isolation and biochemical characterization of the endophytic bacterial isolates
 
A total of 15 different endophytic bacterial colonies were isolated on YMA medium from the root nodule of green gram (cv OUM-11-15). Out of 15 isolates 13 were rod except two which were cocci. Cells also appeared gummy to non-gummy, flat to raised, rough to smooth, colony size varied from small to very large and have different colors-brownish cream, pinkish white, milky white and dirty yellow. Out of 15 isolates from roots, two were gram positive, while thirteen were gram negative. Total 13 isolates with gram’s negative reaction, rod shape smooth edged raised colonies with pinkish white to milky white translucent colonies were selected for biochemical characterization and confirmatory tests. All were motile except two (2) while except three (3) all were found to produce indole. Out of all the isolates five isolates have shown luxuriant growth in 10% NaCl (KHDR1, KHDK1, KHDEB2, KHDEB3 and KHDEB5). All the thirteen (13) isolates utilized lactose and fructose in both oxidative and fermentative path ways whereas none of the isolates utilized inulin in any of the pathways. Only three (3) utilized galactose in both pathways. All the thirteen (13) were found positive for urease, catalase, oxidase and caseinnase activity at the same found negative for DNAase, gelatinase and lipase activity. Only five (5) were found positive for nitrate reductase. All were found resistant to Amphotericin-B (AP50) but sensitive to Ciproflaxin (CP5). Isolate (KHDEB5) was highly resistant to the antibiotics among all endophytic isolates.
        
In the present context, fifteen (15) endophytic isolates from four different green gram cultivars (PDM54, SML668, Pusa Baisakhi and OUM-11-15) were isolated on yeast extract mannitol agar (YMA) medium as nitrogen fixing bacteria can be isolated directly from the root nodules of host plants using YMA selective media (Castro et al., 2003; Kukuc et al., 2006). Out of the fifteen (15) isolates thirteen (13) were found gram negative and rest two (2) were gram positive. All were rod shaped bacteria. These findings corroborate with the results of Michael (2006), Singh (2008) and Erum (2008) who also reported isolation and characterization of root endophytes. Thirteen (13) gram negative motile rods with white to pink in colour convex, translucent or opaque colonies were suspected morphologically for Rhizobium. All the thirteen isolates were characterized for their biochemical, enzymatic, sugar utilization and antibiotic sensitivity patterns. These findings are synonymous with Hussain et al., (2002) and Sobti et al., (2015).
 
Confirmatory tests for Rhizobium
 
All thirteen isolates were further characterized to differentiate them from Agrobacterium by performing few confirmatory tests viz; growth on hoffer’s alkaline media, glucose peptone agar (GPA) media and 8% KNO3 media; production of keto-lactase enzyme and absorption of congo red in Yeast extract Mannitol agar with congo red media. Study revealed that 10 isolates showed negative results in all the above mentioned confirmatory tests.
        
All the thirteen rhizobial isolates were passed through different confirmatory tests to be distinguished from Agrobacterium as Rhizobium since Agrobacterium are highly related and their species are interwoven (Kerr 1992) and amalgamation of these two genera has often been suggested. Ten (10) isolates (except KHDJ1, KHDK2 and KHDEB1) couldn’t grow on hoffer’s alkaline media, glucose peptone agar (GPA) and NA medium with 8% KNO3. Seven (KHDJ1, KHDR1, KHDK1, KHDC1, KHDEB3, KHDEB4 and KHDEB5) of the isolates showed absence of keto lactase enzyme. None of the isolates absorbed Congo red  (Subba Rao 2006). Except KHDJ1, KHDK2 and KHDEB1 all the isolates were suspected to be Rhizobium strain.
 
Nodulation test with green gram (cv. OUM-11-15)
 
A test was performed in aseptic condition with sterilized sand and soil (2:1 ratio) with Mc Knight’s nitrogen free solution to observe the effect of inoculation of the isolates on nodulation of green gram (cv. OUM-11-15). Nodulation, root length and shoot length were studied at 7 and 15 DAS (Table 2A and  2B). All the isolates showed enhancement in root and shoot length as compared to uninoculated seeds at 7DAS and 15DAS. Seed inoculation with KHDEB5 was found to have highest root length (3.5 cm and 10.2 cm) at 7DAS and 15DAS respectively. Seed inoculation with KHDK1, KHDR, KHDEB5, KHDEB2 and KHDEB3 showed nodulation both at 7 DAS and 15 DAS interval which were selected or further germination bioassay at different levels of salt stress. Maximum nodules were observed in seedling inoculated with KHDEB5 both at 7 DAS and 15 DAS i.e. 6 and 15 respectively (Fig 1).
 

Fig 1: Green gram (cv.OUM-11-15) seedlings showing nodulation behavior withN free Mc knight’sseedling nutrient solution at 15 DAS


 

Table 2A: Nodulation test with green gram (cv. OUM-11-15) at 7 DAS.



Table 2B: Nodulation test with green gram (cv. OUM-11-15) at 15 DAS.


        
Nodulation is result of successful symbiotic interaction between Rhizobium and host plant, which is the basis for symbiotic nitrogen fixation (Lee et al., 2014). Nodulation test was carried out with the ten (10) rhizobial isolates, inoculated to green gram seeds as there is a great possibility to increase production of legume plants by exploiting better colonization of their root and rhizosphere through rhizobial inoculation. After seven and fifteen days of incubation seeds inoculated with KHDEB5 recorded significantly higher root and shoot length compared to other isolates. Except five (KHDK1, KHDR1, KHDEB2, KHDEB3 and KHDEB5) of the isolates, no other isolates could produce nodules due to lack of infectivity.
 
Germination bioassay with different salt concentration
 
Data on seed germination bioassay of green gram revealed that, all the bio inoculated seeds with salt stress germination percentage, seedling length and seedling dry weight compared uninoculated seeds with salt stress (Fig 2). Result revealed that seedling length was enhanced by inoculation with KHDR1, KHDEB5, KHDEB2 and almost all isolates enhanced seedling length upto 200 mM of salt stress. Bioinoculation of KHDEB5 and KHDEB2 enhanced germination per cent upto 500 mM of salt stress i.e. KHDEB5 enhanced 24%, 19% followed by KHDEB2 which enhanced 21%, 12% at 200 mM and 500 mM concentration respectively. KHDR1 and KHDEB5 enhanced seedling dry weight upto 25% and 41% respectively whereas only KHDEB5 enhanced it upto 500 mM of salinity stress  i.e. 31% at 200 mM and 21% at 500 mM.Result indicated that green gram seeds inoculated with strain KHDEB5 showed 79% germination under 200 mM NaCl which is equal with the seed germination of green gram without NaCl stress (control). Among the five isolates KHDEB5 was found most efficient under different levels of salt stress and was selected for molecular characterisaton of 16s RNA for its identification.
 

Fig 2: Comparision of seed germination parameters (seedling length, germination percentage and seedling dry weight)


        
As cooperative interaction between rhizobia and other plant root colonizing bacteria is of relevance in improvement of nodulation and N2 fixation in legume plants all the five nodulating isolates were subjected to seed germination bioassay test with presence and absence of different levels of salinity stress. The green gram seeds inoculated with isolate KHDEB5 recorded highest seedling length, dry weight and germination % even under salinity stress upto a wide range of salt concentration (upto 500 mM NaCl). It has been revealed that rhizobium  inoculation drastically enhanced the mobilization efficiency which resulted in vigorous seedlings.
 
16S rRNA gene sequencing and analysis of phylogeny for the novel Rhizobium pusense strain KHDEB5
 
16S rRNA sequencing of the most efficient salinity tolerant strain R. pusense strain KHDEB5 isolated from field was performed. The amplified fragment of 16SrRNA of R. pusense strain KHDEB5 was sequenced and boot strap analysis revealed that the sequences matched 100 % with the16S rRNA sequence of R. pusense. NCBI results showed that R. pusense (KHDEB5) from green gram field is novel. The 16S rRNA sequence of R. pusense was submitted to NCBI gene bank and catalogued the accession number as KY679150 (Fig 3).
 

Fig 3: Phylo Phylogram based on 16S rRNA sequence of different species of Rhizobium. NCBI phylogram showed the identity (100%) of 16S rRNA gene of our native Rhizobium pusense strain KHDEB5 with the different strain of Rhizobium pusense.


 
Abiotic stress tolerance
 
R. pusense strain KHDEB5 was further tested for abiotic stress tolerance with wide range of pH (4.0, 5.0, 7.0, 8.5 and 10.0) (Fig 4b) and different concentrations of NaCl (0, 1.0, 2.5, 5.0 and 7.5% NaCl) (Fig 4a). Results were recorded through optical density reading with spectrophotometer (at 660 nm) at 24, 48 and 72 hrs of incubation. As per the observations with different pH ranges KHDEB5 strain has recorded maximum growth at pH 7.0 where as the strains has recorded minimum growth at pH 10 at 24, 48 and 72 hrs of incubation. At pH 10 both the strains recorded lowest growth followed by pH 4.0. The strain KHDEB5 showed highest growth in 0% NaCl medium and followed by 1% NaCl medium at 24, 48 and 72 hrs incubation period. Minimum growth was recorded at 7.5% NaCl medium at 24, 48 and 72 hrs of incubation.
 

Fig 4: Growth behaviour in different pH values (a) growth behaviour in different salt concentrations (b) of R. pusence grown in yeast mannitol broth (YMB) medium up to 72 h.


        
Most efficient strain to enhance different germination parameters by tolerating salinity stress was identified as R. pusense strain KHDEB5 by amplification and sequencing of 16S rRNA and was found 100 per cent similar with the 16S rRNA sequence of R. pusensea vailable in NCBI data base (Fig 3.) after generating phylograms using the 16S rRNA sequences of other Rhizobium spp., then was catalogued as KY679150 by NCBI. The results ascertained the identity of the phenotype of the organisms (Martin-Didonet et al., 2000; Baldani et al., 2005; Kennedy et al., 2005). However, the 16S rRNA gene phylogeny has been widely used for differentiation of diverse diazotrophic microorganisms (Zehr et al., 2003).
 
Effects of R. pusense (KHDEB5) formulations on growth and nodulation parameters under different NaCl concentrations
 
To validate the effects of the R. pusense (KHDEB5) formulations under control and salt stress conditions, the pot experiments were conducted in green gram (cv. OUM-11-15) at OUAT. The observation of nodulation parameters plants were recorded after 40 days for each treatment. The plant height, number of shoots, root volume, number of nodules, nodule fresh weight and nodule dry weights were recorded higher in pots inoculated with KHDEB5 strain in control as well as under different salt stress conditions (Table 3A and Table 3B). Plant height and number of nodules was enhanced significantly due to innoculation with R. pusense (KHDEB5) i.e. 63% and 83% respectively in absence of salinity stress also performed well in salinity stress i.e. 56% enhancement in plant height even at 500mM of salt concentration (T6) as well as 75% enhancement in nodule numbers at 200 mM salt concentration (T4). Shoot nitrogen was enhanced by 30% up to T6 (500mM NaCl). There was a significant enhancement of 17% of root volume uptoT6. 23% enhancement of nodule dry weight was recorded up to T4 (200 mM NaCl).
 

Table 3A: Effect of bio-inoculation on plant height (cm), root volume (cc plant-1) and shoot N (%) in green gram with presence and absence of different levels of salt stress at 40 DAS.



Table 3B: Effect of bio-inoculation on different nodular parameters viz. nodule number, nodule FW (mg) and nodule DW (mg) with presence and absence of different levels of salt stress.


        
Sobti et al., (2015) evaluated rhizobial isolates with salt tolerance activity. Salt stress not only inhibits the process of nodulation and nitrogen fixation but it also induces premature senescence of already formed nodules (Swaraj and Bishnoi 1999). The strain R. pusense strain KHDEB5 was found to be tolerant up to1000 mM NaCl concentration (Fig 2b). However, the strains could tolerate pH within the range of 5.0 to 8.5 (Fig 2a). Effects of the R. pusense strain KHDEB5 formulations on growth of green gram (cv. OUM-11-15) under control and salt stress in pot culture were elucidated in Table 3A. and 3B. The organisms had differential effects on growth but it had better growth compared to control conditions (Table 3A and 3B). The results indicated that salt stress reduces the growth of plants as well as yield, but the tolerance of strain under NaCl stress up to 1000 mM was comparable and significant. Furthermore, the yield of plant in the form of nodule numbers, nodule fresh weight and nodule dry weight states that, there was a significant difference in yield ranges from 112-137% were found in the pot inoculated with R. pusense strain KHDEB5 in control as well as in stress conditions as supported the study made by El-Akhal et al., (2013).

CONCLUSION

Salinization is one of the most crucial factors threatening agricultural land throughout the world. However, our results indicate that at increasing salt concentrations, biological N fixation may be competitive and R. pusense strain KHDEB5 will be a more economic and sustainable alternative to chemical fertilisation. The findings of present investigation suggest that R. pusense strain KHDEB5 potentially contribute to green gram plants to maintain higher level of compatible solute and macronutrients, leading to better growth of root and shoots and thereby improved tolerance to salinity.

REFERENCES


  1. Anglade, J., Billen, G. and Garnier J. (2015). Relationships for estimating N2 fixation in legumes: incidence for N balance of legume-based cropping systems in Europe. Ecosphere. 6: 1-24. 

  2. Baldani, J.I., Krieg, N.R., Baldani, V.L.D., Hartmann, A. and Dobereiner J. (2005). Genus II. Azospirillum. In: Bergey’s Manual of Systematic Bacteriology, [Brenner DJ, Krieg NR, Staley JT (eds)] vol 2C. Springer, New York, USA: 7–26pp.

  3. Bauer, A.W., Kirby, W.M., Sherris, J.C. and Turck, M. (1966). Antibiotic susceptibility testing by a standardized single disk method. American Journal of Clinical Pathology. 45: 493-496.

  4. Bergey, D.H., Holt, J.G., Krieg, N.R. and Sneath, P.H.A. (1994). Bergey’s Manual of Determinative Bacteriology (9th edition). Lippincott Williams and Wilkins. ISBNO-683-00603-7.

  5. Castro, I.V., Ferreira, E.M. and McGrat, S.P. (2003). Survival and plasmid stability of rhizobia introduced into a contaminated soil. Soil Biology and Biochemistry. 35: 49-54.

  6. Crews, T.E. and Peoples, M.B. (2004). Legume versus fertilizer sources of nitrogen: ecological tradeoffs and human needs. Agriculture, Ecosystem and Environment. 102: 279-297.

  7. Dey, R., Pal, K.K., Bhatt, D.M. and Chauhan, S.M. (2004). Growth promotion and yield enhancement of peanut (Arachis hypogaea L.) by application of plant growth-promoting rhizobacteria. Microbiological Research. 159: 371-394.

  8. El-Akhal, M. R., Rincón, A., Coba De La Peña, T., Lucas, M. M., El Mourabit, N. and Barrijal, S. (2013). Effects of salt stress and rhizobial inoculation on growth and nitrogen fixation of three peanut cultivars. Plant Biology. 15: 415-421. 

  9. Erum, S. and Asghari, B. (2008). Variation in phytohormone production in Rhizobium strains at different altitudes of northern areas of Pakistan. Pakisthan International Journal of Agricultural Biology. 10: 536-40.

  10. Fernández, L.A., Zalba, P., Gómez, M.A. and Sagardoy, M.A. (2007). Phosphate-solubilization activity of bacterial strains in soil and their effect on soybean growth under greenhouse condition. Biology and Fertility of Soils. 43: 805-809.

  11. Franche, C., Lindstrom, K. and Elmerich, C. (2009). Nitrogen fixing bacteria associated with leguminous and non-leguminous plants. Plant and Soil. 321: 35-59.

  12. Gomez, K. A. and Gomez, A. A. (1984). Statistical Procedures for Agricultural Research. John Wiley and sons, New Delhi, 680 p. 

  13. Hofer, AW. (1935). Methods for distinguishing between legume bacteria and their most common contaminants, Journal of American Society of Agronomy. 27: 228-230.

  14. Holt, G.J., Bergey, D., Krieg, H., Peter, N.R. and Sneath, H.A, (1994). Bergey’s Manual of Determinative Bacteriology (9th edition). Lippincott Williams and Wilkins. ISBNO-683-00603-7.

  15. Hussain, M., Ashraf, M., Saleem, M. and Hafeez, F.Y. (2002). Isolation and characterization of Rhizobial strains from alfalfa. Pakisthan Journal of Agricultural Science. 39: 32-34.

  16. Jackson, M. L. (1973). Soil Chemical Analysis, Prentice Hall of India Pvt. Ltd., New Delhi.

  17. Kennedy, C., Rudnick, P., MacDonald, M.L. and Melton, T. (2005). Genus III. Azotobacter. In: Brenner Bergey’s Manual of Systematic Bacteriology, [DJ, Krieg NR, Staley JT (eds)] vol 2B. Springer, New York, USA: 384-402pp.

  18. Kerr, A. (1992). The genus Agrobacterium. In The Prokaryotes – a Handbook on the Biology of Bacteria, 2nd edn, [Edited by Balows A., Truper H.G., Dworkin M., Harder W., Schleifer K. H.,] Springer-Verlag. Heidelberg:pp. 2214-2235.

  19. Kucuk, C. M., Kivanç, M. and Kinaci, E. (2006). Characterization of Rhizobium Sp. Isolated from Bean. Turkish Journal of Biology. 30: 127-132.

  20. Lee, S. G., Krishnan, H. B. and Jez, J. M. (2014). Structural basis for regulation of rhizobial nodulation and symbiosis gene expression by the regulatory protein NolR. Proceeding of National Academy of Sciences of the United States of America. 111: 6509-6514. 

  21. Martin-Didonet, C.C.G., Chubatsu, L.S., Souza, E.M., Kleina, M., Rego, F.G.M., Rigo, L.U., Yates, M.G. and Pedrosa, F.O. (2000). Genome structure of the genus Azospirillum. Journal of Bacteriology. 182: 4113-4116.

  22. McKnight, T. (1949). Efficiency of isolates of Rhizobium in the cow pea group, with proposed additions to this group. Queensland Journal of Agricultural Science. 6: 61-76.

  23. Meghvansi, M.K., Prasad, K. and Mahna, S.K. (2010). Symbiotic potential, competitiveness and compatibility of native Bradyrhizobiumjaponicumisolates to three soybean genotypes of two distinct agro-climatic regions of Rajasthan, India. Saudi Journal of Biological Science. 17: 303-310.

  24. Michael, J.S. and Graham, P.H. (2006). Root and stemnodule bacteria of legumes. Prokaryotes. 2: 818-841.

  25. Mistra, R.D. and Ahmed, M., (1987). Root parameters and their measurement, In: Manual of Irrigation Agronomy. 319-326pp.

  26. Mohammadi, K. and Sohrabi, Y. (2012). Bacterial Biofertilizers for sustainable crop production: A Review. Journal of Agricultural and Biological Science. 7: 307-316.

  27. Mwangi, S.N., Karanja, N.K., Boga, H., Kahindi, J.H.P., Muigai, A. and Dee, D. (2011). Genetic diversity and symbiotic efficiency of legume nodulating bacteria from different and use systems in TaitaTaveta, Kenya. Tropical and Subtropical Agroecosystems. 13: 109-118.

  28. Page, A.L., Miller, R.H. and Keeny, D.R. (1982). Methods of Soil and Plant Analysis, part-2,2nd Edn. No (9) Part in the series, American Society of Agronomy, Inc. Soil Science Society of American Journal. Madison, Wisconsin, U.S.A.

  29. Patel, P.H., Patel, J.P. and Bhatt, S.A. (2013). Characterization and phylogenetic relatedness of Azotobacter salinestris. Journal of Microbiology and Biotechnology Research. 3: 65-70.

  30. Russeille, M.P. (2008). Biological Dinitrogen Fixation in Agriculture: Nitrogen in Agricultural Systems. 49: 281-359.

  31. Sanaa, M.E.D. and Fawziah, S.AS. (2005). Role of some chemical compounds on the detoxification of Rhizobium leguminosarum biovtirvicia by some Heavy Metals. Pakisthan Journal of Biolical Science. 8: 1693-1698.

  32. Singh, B., Ravneet, K. and Kashmir, S. (2008). Characterization of Rhizobium strain isolated from the roots of Trigonella foenumgraecum (fenugreek). African Journal of Biotechnology. 7: 3671-3676.

  33. Singh, J.S., Koushal, S., Kumar, A., Vimal, S.R. and Gupta, V.K. (2016). Book review: microbial inoculants in sustainable agricultural productivity-Vol. II: functional application. Frontier Microbiology. 7: 2105.

  34. Sobti, S., Belhadj, H.A. and Djaghoubi, A. (2015). Isolation and characterization of the native rhizobia under hyper-salt edaphic conditions in Ouargla. Science direct. 74: 1434-1439.

  35. Subba Rao, N.S. (2006). “Soil Microbiology” 4th edition, Oxford and IBH publishing Co. Pvt, New Delhi.

  36. Subbaiah, B.V. and Asija, G.L. (1956). A rapid procedure for the estimation of available nitrogen in soil. Current Science. 25: 259-260.

  37. Swaraj, K.and Bishnoi, N.R. (1999). Effect of salt stress on nodulation and nitrogen fixation in legumes. Indian Journal of Experimental Biology. 9: 843-848.

  38. Tairo, E.V. and Ndakidemi, P.A. (2013). Possible benefits of rhizobial inoculation and phosphorus supplementation on nutrition, growth and economic sustainability in grain legumes. American Journal of Research and Communication. 1: 532-556.

  39. Vincent, J.M. (1970). A manual for the practical study of root nodule Bacteria. In I.B.P. Hand Book No. 15, Blackwell scientific publications. Oxford. England: 73-97pp.

  40. Vitousek, P.M. (1997). Human alteration of the global nitrogen cycle: sources and consequences. Ecological Applications. 7: 737-750.

  41. Warham, E.J. (1990). Effect of Tilletia indica infection on viability, germination and vigour of wheat seed. Plant Disease. 74: 130-132.

  42. Wright, W.D. and Wilkinson, D.R. (1993). Automated Micro-Kjeldahl Nitrogen Determination: A method. American Environmental Laboratory. 93: 30-33.

  43. Yushmanov, S.V. and Chumakov, K.M. (1988). Algorithms for building maximum topological similarity phylogenetic trees. Molekularnaya Genetics Mikrobiologiyai Virusologiya. 3: 9-l 5 (in Russian).

  44. Zehr, J. P., Jenkins, B.D., Short, S. M. and Steward, G. F. (2003). Nitrogenase gene diversity and microbial community structure: a cross-system comparison. Environmental Microbiology. 7: 539-554.
Reviewed By

Download Article
In this Article
    Contact us
    Follow us

    Editorial Board

    View all (0)