Molecular Characterization of Fusarium oxysporum Causing Chickpea Wilt by Internal Transcribed Spacer (ITS) Marker

Chickpea, (Cicer arietinum) is the third most important pulse crop in the world. India is having first rank in terms of chickpea production and consumption in the world (Kumar, 2017; Thakur and Sirohi, 2009). The chickpea growing states of India are Rajasthan, Madhya Pradesh, Uttar Pradesh, Maharashtra and Haryana with 50% of global chickpea production is from Rajasthan and Madhya Pradesh.
 
Chickpea cultivation is often subjected to several biotic stresses of which diseases like Ascochyta blight, Botrytis grey mould, Verticillium wilt, Sclerotinia stem rot, dry root rot and Fusarium wilt are important. The fungal attack has been a major problem associated with the crops and more predominant is the attack of Fusarium, which causes tremendous loss in Indian economy (Ingle et al., 2017). Fusarium wilt caused by Fusarium oxysporum f. sp. ciceris is one of the serious diseases causing 10-50% yield reduction in chickpea crop throughout the world and has assumed serious proportions in the recent years (Patra et al., 2017). The vascular wilt fungus Fusarium oxysporum is a soil borne facultative parasite that causes disease in more than 100 plant species, including important agricultural crops. It is a morphospecies that is divided into specialized groups i.e. formae speciales according to the hosts they attack and subdivided into races according to the susceptibility of specific host cultivars (Sutherland et al., 2012). The pathogen is facultative saprophytic and it can survive as mycelium and chlamydospores in seed, soil and also on infected crops residues, buried in the soil for up to five to six years (Haware et al.,1996). The pathogen can infect at all stages of plant growth with more incidences in flowering and pod filling stage. The wilt appeared in field within three to four week after sowing, if the variety is susceptible. Early wilting causes 77-94% losses, while late wilting causes 24-65% loss (Bhattacharjee et al., 2015). In India annual yield loss due to Fusarium wilt was estimated at 10% and under favorable condition, the wilt infection can damage the crop completely (Golakiya et al., 2018).
 
The regular monitoring of variation in new isolates collected from different cultivars and geographically distinct regions over the years is critical for successful resistance breeding programme. The conventional approaches to assess variation among the fungal isolates are morphological and virulence analysis. However, with the advent of DNA based molecular techniques it is now possible to assess the genetic variation among the isolates. Genotyping of F. oxysporum f. sp. ciceris isolates along with virulence analysis may yield some information relevant to breeding. It also provides some insight into distribution of geographically sub-structured pathogen population. Internal transcribed spacers (ITS) regions have been used successfully to generate specific primers capable of differentiating closely related fungal species (Bryan et al., 1995). Taxon selective ITS amplification has already been used for the detection of fungal pathogens such as Fusarium (O’Donnell, 1992) and Verticillium species (Nazzar et al., 1991). We have isolated and characterized the pathogenic F. oxysporum f. sp. ciceris isolates from different locations of Maharashtra and ITS-RFLP based genetic variation among Foc isolates was studied.

Sample collection
 
The chickpea growing areas in Maharashtra were surveyed and wilt affected chickpea plant root samples were collected from 48 different locations (Table 1).
 

 
Foc isolation and purification
 
The infected root samples were surface sterilized using 1% sodium hypochlorite for 2 m and washed 3-4 times with sterilized water. The pieces of surface sterilized root samples were then placed on potato dextrose agar (PDA) medium containing streptomycin (0.12 g/l) and incubated at 26±2°C for 5-6 days. All the isolates of the pathogen were purified by hyphal tip method (Dohroo and Sharma 1992).
 
Morphological characterization
 
Morphological characters of Foc viz., colony colour, growth, pigmentation and sporulation were recorded a week after inoculation. For characterization of macroconidia, microconidia and chlamydospore, 10-15 day old culture grown on PDA medium was stained with 0.1% Lactophenol cotton blue on slides were observed under compound microscope.
 
Identification and maintenance of the pathogen isolates
 
The fungal growth showing different coloration on PDA media plates depending on the morphological characteristics i.e. microconidia, macroconidia, chlamydospores mentioned by Booth, (1971) were identified. Microphotographs of the Foc isolates were taken to describe spore morphology. All the isolates were then maintained on PDA slants at 4°C and sub culturing was done in every three months. Pathogenicity of Foc isolates were tested to prove Koch’s postulates by soil inoculation method (Nene et al., 1981) on chickpea variety JG-62 susceptible to Fusarium wilt. 
 
DNA extraction
 
Standard protocols were followed for the isolation of DNA from all the Foc isolates (Cenis, 1992). Briefly, fungal strains were grown for 7 days in Potato Dextrose Broth (PDB) at 26±2°C under static conditions. Mycelia were harvested and lyophilized. Later 100 mg of the finely powdered mycelium was used for DNA extraction using Hi PurATM Fungal DNA Mini Kit (HiMedia, India), according to the manufacturer’s instructions. The concentration and purity of extracted DNA was determined using NanoDrop-ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, USA) and the DNA samples were stored at -80°C for further use.
 
ITS amplification of Foc isolates
 
ITS amplification of rDNA was carried out by polymerase chain reaction (Das and Shende, 2015) using designed primers ITS-Fu-F-5'CAACTCCCAAACCCCTGTGA3' and ITS-Fu-R- 5'GCGACGATTACCAGTAACGA3' which are specific for ITS region of Fusarium oxysporum f. sp. ciceri. The reactions were performed  in thermo cycler with  one  cycle  of initial  denaturation 94°C for 4  min, followed by  35 cycles of denaturation at 94°C for 1 min,  annealing  at  56°C for  1 min,  extension at  72°C for  1.5 min  and   with  a  final extension  at  72°C  for  6  min.  Amplified  products  together  with  marker were  resolved  by gel electrophoresis  (60  V)  on 1.2% agarose  gels  in  1X  TAE  buffer containing 10  mg / ml  ethidium bromide  (EB). The amplified product was digitized in Gel Documentation system (Alpha-Innotech, USA).
 
Restriction digestion and analysis of genetic diversity of rDNA ITS region of Foc isolates
 
PCR amplified ITS product (50µl) of Foc isolates were subjected for restriction digestion with restriction enzymes viz., AluI, EcoRI, HaeIII, MboI and MspI.Restriction digestion was carried out at 37°C for 4 hours in water bath. The digested product was separated on 4% agarose gel in 1X TAE buffer at 60V for 1:30 h and gel images were taken in Gel Documentation System. The molecular size of each fragments were estimated by running in parallel a 50 bp ladder (Genei, Banglore). The amplicons (302 bp) which distinguishes Fusarium isolates were observed and scored. The image was scored for amplicon either presence (1) or absence (0) and missing or doubtful case scored as 9. Band size was determined by using software Alpha Ease FC 4.0 with reference to 100 bp and 50 bp DNA ladder respectively for ITS and RFLP products. Data analysis was performed using NTSYS-pc Numerical Taxonomy system, version 2.02i (Rohlf, 1998). The SIMQUAL programme was used to calculate the Jaccard’s coefficient. Dendrogram was constructed using unweighted paired group method for Arithmetic Mean (UPGMA) based on Jaccard’s similarity coefficient.

Isolation, characterization and identification of Foc isolates
 
A survey was conducted to obtain information on the natural incidence of Fusarium wilt disease on chickpea during the rabi season (2017-18) in the aforementioned locations. A total of forty eight strains of Fusarium oxysporum f. sp. ciceri belonging to different locations were collected from the roots of infected chickpea plants. All the isolates were identified based on its morphological characteristics (Booth, 1971; Barhate et al., 2006). These isolates exhibited variations in growth, colony characteristics such as colour, shape, margin and texture (Table 2). They also exhibited variation in conidia structures. The maximum number of isolates (30 nos.) exhibited microconidia that were ellipsoidal and have no septa or one septum. Macroconidia produced by 14 isolates were falcate with three or four septa and 4 of the Foc isolates showed round shaped chlamydospores. Morphological variations in the Foc strains have been reported earlier by many researchers (Saxena and Singh, 1987; Dubey et al., 2010). These asexual spores play important roles in the disease cycle exist in the soil and infect the plants under favorable conditions.
 

 
ITS rDNA amplification of Foc isolates
 
DNA of forty eight Foc isolates was extracted from their mycelial mat grown on PDB and yielded 350-400 ng/μl quantity of DNA which was amenable to PCR amplification. The ITS primer pair ITS-Fu- F and ITS-Fu-R designed in the laboratory from ITS region sequenced data of Fusarium species and after in silico analysis, was used in PCR to amplify the rDNA ITS regions of 48 Foc isolates. ITS-Fu-F and ITS-Fu-R invariably amplified the 302 bp rDNA ITS region of Foc isolates (Fig 1). Similarly, ITS-Fu-f and ITS-Fu-r was designed by Kamel et al., (2003) compared the aligned sequences of internal transcribed spacer regions (ITS) of a range of Fusarium species infecting cotton and showed amplification of  389 bp product.
 

 
Analysis of genetic diversity among Foc isolates
 
ITS-PCR products of 302 bp generated by primers ITS-Fu-F and ITS-Fu-R was digested using five restriction enzymes viz., EcoRI, HaeIII, MboI, MspI and AluI to assess the molecular variability among the Foc isolates. Out of these only three enzymes viz., EcoRI, HaeIII, MboI enabled to digest amplified PCR product of ITS region. These generated two fragments of 220bp and 82bp (Fig 2), 240bp and 52bp (Fig 3), 152bp and150bp (Fig 4) respectively in all isolates except Foc-30, Foc-36 isolates which have not digested by EcoRI and Foc-8, Foc-20, Foc-21, Foc-24 and Foc-25 isolates did not digest by HaeIII. The results obtained from restriction digestion of ITS region were in concordance with earlier studies with different restriction enzymes (Alymanesh et al., 2009; Datta et al., 2011). Two of the restriction enzymes (MspI and AluI) were not digested the ITS region in this study. ITS-RFLP and other molecular markers are used as common method to identify or distinguish mycopathogenic isolates on different crops (Diguta et al., 2011; Prashanthi et al., 2009).
 

 

 

 
Clustering of Foc isolates on the basis of RFLP analysis
 
The similarity matrix was generated by using scored data of RFLP fingerprint by NTSYS-pc Version 2.02i. The genetic similarity was retrieved from RFLP data using Jaccard’s coefficient. All the 48 Foc isolates divided into four major clusters, I, II, III and IV at 75% similarity value (Fig 5). The similarity index can be used to measure the relatedness of samples (Nybom and Hall 1991; Welsh et al., 1991). Maximum isolates (40 nos.) regardless of their location are clustered in a single group with 100% similarity. Cluster II and III each contains two Foc isolates viz., Foc-30, Foc-36 and Foc-20, Foc -21 respectively. Cluster IV divided into two sub clusters viz., IV-A and IV-B at 87% similarity value. The sub cluster IV-B contains three Foc isolates viz., Foc-24, Foc-25, Foc-48 and whereas only one Foc-8, isolate grouped in subcluster IV-A. The maximum genetic distance (0.75) exhibited by five Foc isolates viz., Foc-30, Foc-36, Foc-24, Foc-25 and Foc-48 belonging  to Shahartakli, Shelur, Nashik, Satara, Kolhapur respectively and more diverse among the Foc isolates whereas isolate no. Foc 20, Foc 21 and Foc-8 from Ambajogai, Karjat and Rahata shown minimum genetic distance (0.13). Datta et al., (2011) used digested fragments obtained with EcoRI, MspI, PstI, BamHI, XhoI, NstI and HindIII restriction enzymes to determine genetic distances between the pathogenic F. oxysporum isolates of various legumes and clustered them into three main groups. Dubey et al., (2010) obtained six different kinds of ITS-RFLP patterns from 11 representative isolates of Fusarium oxysporum f. sp. ciceris causing chickpea wilt through internal transcribed spacer (ITS) region of the ribosomal DNA-restriction fragment length polymorphism (ITS-RFLP). In this study ITS-RFLP analysis could clearly distinguish five of the isolates among the other strains.
 

The present investigation on the genetic variability analysis by using ITS-RFLP revealed the genetic variability among Foc isolates from different regions of Maharashtra. The marker developed from the conserved sequence of ITS region can be used as diagnostic tool for identification of Fusarium wilt at early stages of disease development and thus loss in the chickpea production can be minimized. 

Authors are thankful to Vilasrao Deshmukh College of Agricultural Biotechnology, Latur for giving better platform to this research work and also thankful to the university Vasantrao Naik Marathwada Krishi Vidyapeeth, Parbhani for financial support.