volume 60 issue 5 (may 2026) : 807-815,   Doi: 10.18805/IJAR.BF-2009

Screening of Intestinal Cytokines Differentially Expressed microRNAs in Cryptosporidium parvum-infected Mice

1Department of Life Science, Tangshan Normal University, Tangshan Key Laboratory of Animal Nutrition and Feed Engineering, Tangshan 063000, Hebei, China.
2College of Veterinary Medicine, Agricultural University of Hebei, Baoding 071000, Hebei, China.
3Tangshan Agricultural Science Research Institute, Thangshan 063001, Hebei, China.
4Tangshan Animal Disease Prevention and Control Center, Thangshan 063001, Hebei, China.
Cite article:- Chang Liyun, Chen Yanli, Kang Qian, Dong Lixue, Liu Zhiyong, Li Ying, Qin Jianhua (2026). Screening of Intestinal Cytokines Differentially Expressed microRNAs in Cryptosporidium parvum-infected Mice . Indian Journal of Animal Research. 60(5): 807-815. doi: 10.18805/IJAR.BF-2009.

Background: Cryptosporidium (C. parvum) is a kind of the intestinal tract that can cause diarrhea in humans and calves, however, the molecular mechanisms of host-parasite interactions are still poorly understood. Recently, non-coding microRNAs (miRNAs) have been identified as key regulators of host infection with parasites. This study aims to identify MicroRNAs molecules involved in C. parvum infection and immunity and to reveal their molecular mechanisms at the RNA level. This will provide a new idea for revealing the molecular mechanism of the relationship between trace small molecules and pathogenic infections.

Methods: It used bioinformatics analysis, qPCR and dual luciferase reporter test to investigate the miRNA expression profile of the posterior intestinal epithelium of Cryptosporidium-infected mice.

Result: The present study found that 204 microRNAs had differential expression in mice after infection with C. parvum, with 126 of them up-regulated and 78 of them down-regulated and quantitative real-time PCR validated partially differentially expressed microRNA (mmu-mi R-10, mmu-mi R-196, mmu-miR-27, mmu-miR-146, mmu-miR-145, mmu-mi R-21, let-7i and mmu-mi R-101), which consistented with high-throughput sequencing results. Different microRNAs were implicated in the pathways for Ras signaling, microbial infection, cancer, receptor interaction and the interaction of chemokine and cytokine receptors. By means of dual luciferase, TLR 11 was the target gene identified for miR-196, which indicated that MiR-196 may be involved in the host immune response to C. parvum through regulation of TLR-11. These results provide new insights into the regulatory mechanisms of host miRNAs during C. parvum, which may provide potential targets for future C. parvum control stmiceegies.

C. parvum is a zoonotic parasite belonging to the phylum Apicomplexa. The parasite C. parvum has an genome, with eight chromosomes that range in size from 0.9 to 1.4 megabases (Rider et al., 2010). It can colonise  gastroin-testinal epithelial cells and in calves it causes diarrhoea, dehydmiceion and emaciation which in severe cases can be fatal (Zolova et al., 2022). C. parvum is transmitted via the faecal-oral route. When C. parvum oocysts infect a person or animal, they release infectious sporozoites that attach to the intestinal epithelial cells and cause the development of parasitic vacuoles where C. parvum lives (Dixit et al., 2019; Li et al., 2021). Unlike other apicomplexan parasites, it is shielded from the unfavorable intestinal environment by utilizing parasitic vacuoles and provided with energy and nutrients by the host cell through a feeder organelle (Bouzid et al., 2014). In the digestive tract, new oocysts are produced through asexual or sexual reproduction and they are then expelled from the body to infect new hosts (Gallego et al., 2022). Pre-weaning calves are mainly infected with C. parvum (Shaw et al., 2021). However, the precise molecular pathogenic processes of C. parvum infection remain poorly known despite extensive research over the past years.
               
MicroRNAs (miRNAs) are highly conserved single-stranded non-coding RNAs of 21-23 nucleotides that play important gene regulatory roles in animals (Xie et al., 2021; Khandelwal et al., 2024), including regulating immune cells, affecting the integrity of the intestinal epithelial barrier, participating in epithelial cell development and influencing the intestinal flor (Xiao et al., 2022). For example, Some microRNAs have been demonstmiceed to participate in C. parvum infection and to control the epithelial cells’ immunological response to C. parvum in a particular way. Through the use of TLR2/TLR4/NF-B channels, C.parvum -infected organisms enhanced the expression of miR-942-5 p in HCT-8 cells (Xie et al., 2022); Let-7 can contribute to the epithelial cell defense mechanism brought on by C. parvum infection by triggering TLR4 signaling and increasing SNAP23 expression (Hu et al., 2013). Currently, although some studies have revealed changes in miRNA expression profiles after sporozoite infection of intestinal epithelial cells, there are no well-established reports on changes in microRNA expression profiles in in vivo models of C. parvum infection. Recently, to determine the interactions between microRNAs and their target genes, single or dual-luciferase reporter systems are frequently used (Deng et al., 2022). High-throughput sequencing methods and bioinformatics are also widely used for microRNA identification and differential expression analysis (Jeseninik et al., 2022).
Parasites strain and test animals
 
The C. parvum oocysts were kept by the Labomiceory of Preventive Veterinary Parasitology, College of Animal Medicine, Hebei Agricultural University; 48 three-week-old SPF-grade female Balb/c mice were purchased from Vitalriver, Beijing, China.
 
Establishment of BALB/c mice model infected with C. parvum
 
The animal and environment were disinfected thoroughly before the experiment. The setting in which mice are housed is sterile and drinking water is sanitized by boiling. Forty-eight female BALB/c mice (weigh: 11 g-14 g) aged 3 weeks, after 3 days of feeding adaptation, microscopic examination of mice feces confirmed no parasitic infection were randomly divided into four groups, namely two infection groups with 12 mice in each group, two control groups with 12 mice in each group, One of the groups for intestinal tissue extraction and another group for collection of mice feces, weighing and dissection.
       
Oral drinking water with the 15 mg/mL of dexamet-hasone acetate and 40 mg/L of gentamicin were used for immunosuppression for 7d. We use gastric lavage needles to administer orally. Artificial gavage of C.parvum 1.0 × 105/mL oocyst suspension was administered twice at 500 μL each on an empty stomach. Mice feces were collected daily after infection, starting on the first day and were detected under a microscope and with acid-fast staining.
       
The present study was researched in agreement with the institutional and national guidelines and was supported by the Animal Use and Ethics Committee of the Agricultural University of Hebei (University Identifi-cation Number: HB/2023/03).
 
MicroRNA sequencing and differential expression analysis
 
Small intestine tissue was taken from mice infected with C. parvum one week after infection and total RNA was extracted. The purity of RNA was detected by formaldehyde denatured agarose gel and Nanodrop. Then, Qubit and Agilent 2100 were used to detect the concentration and integrity of RNA. After pooling the different libraries according to the effective concentration and the amount of target offline data, they were sent to Beijing Nuohe Source Sequencing Company for HiSeq sequencing and analysis. concentration.
 
Differential microRNA target gene enrichment analysis
 
Prediction of microRNA target genes by intersection of miRanda, PITA and RNAhybrid, Gene Ontology and KEGG enrichment analysis were performed on the set of different microRNA-expressing target genes according to the correspondence between microRNA and its target genes. The most important biochemical metabolic pathway and signal transduction pathway in which the candidate gene is involved can be determined by significant enrichment analysis.
 
Validation of differentially expressed microRNAs
 
MicroRNAs that were differentially expressed were confirmed using real-time quantitative PCR. The volume of reaction mixtures was 20 μL, containing 2 μL cDNA, 10 μL trans start tip green qPCR super mix (Trans gen biotech, China), 0.4 μL forward primer (0.2 μM), 0.4 μL reverse primer (0.2 μM) and 7.2 μL dd H2O. MicroRNA primers are shown in Table 1. The following amplification program was used: pre-denatumiceion at 95oC for 10 min, followed by a total of 45 cycles, consisting of denatumiceion at 95oC for 30 s, annealing at 60oC for 20 s and extension at 72oC for 20 s. The expression level was calculated using 2-ΔΔCt method and normalized by the reference gene.

Table 1: Design and synthesis of primers for microRNAs.


 
Verification of miR-196 regulating TLR-11 gene
 
Prediction of microRNA target genes
 
By combining the functions of the programs microRNAmi Randa, PITA and RNAhybrid, the microRNA target genes were predicted. The primary biochemical metabolic pathways and signal transduction pathways involved in potential target genes were identified using Gene Ontology and KEGG enrichment analysis in conjunction with the correlation between microRNA and its target genes.
 
Construction of TLR-11 3'  -UTR target gene vector
 
According to microRNA target gene prediction results, the correspondence between microRNA and target gene was analyzed.
       
miR-196 was increased by 135.85 times and it was related to the toll-like receptor signaling pathway by simultaneous association analysis. Bioinformatics analysis predicts that there may be a site that is not completely complementary to miR-196 at the 2932-2954 base position of the 3'-UTR of TLR-11 mRNA gene, as shown in Fig 1. According to the prediction results, a 162-base sequence that may contain a complementary binding site with miR-196 was designed and synthesized. At the same time, a 3' -UTR base mutation chain gene sequence of the TLR-11 mRNA gene that may contain a complementary binding site with miR-196 was designed and synthesized. The Xho I restriction endonuclease site was added to the 5' end and 3' end of the target fragment. The designed and synthesized gene sequence is as follows.

Fig 1: Binding site of miR-196 and TLR-11 mRNA gene.



TLR-11 3'-UTR base normal strand (176 bp)                                               

5'CCTCGAGAGCTGGACAAGAAAGAGATTAAG GACTGCAGGAATGCTGTTGTGCAGAAGATCCTTTCAG CAGCAGAGGGAATGTGCTCTCATCACTAAAGCATGG GCTCACCAAGGGGGCAAAATGATATATTAAATTCC ACTGGGAGAGAAGTCTTTTAAAACACTGAAACTCGAGT3' TLR-11 3'-UTR base mutation strand (176 bp)

5'CCTCGAGAGCTGGACAAGAAAGAGATTAA GGACTGCAGGAATGCTGTTGTGCAGAAGATCCTTAG TCGTCGTGAGGGAATGTGCTCTCATCACTAAAGCA TGGGCTCACCAAGGGGG CAAAATGATAT ATTAAATTCCAC TGGGAGAGAAGTCTTTT AAAACACTGAAACTCGAGT3'
       
The 3'-UTR sequence of the target gene TLR-11 of miR-196 was inserted into the MCS downstream of the firefly luciferase reporter vector gene and part of the 3' non-coding region of TLR-11 was ligated to the pmir-GLO vector. Renilla luciferase gene was used as internal reference gene.
 
Identification of target gene vector by enzyme digestion
 
The pmir-GLO vector was transferred into the receptor cell Mch1T1 strain and incubated at 37oC for 12-15 h. After incubation on medium containing AMP, monoclonal colonies were picked and incubated for 12 h-15 h. The plasmids were extracted using the Plasmid Extraction Kit. The successful ligation was verified with Xho I restriction endonuclease and operate according to the Thermo Fisher (USA) enzyme digestion kit instructions. The reaction solution after enzyme digestion was examined by agarose gel electrophoresis.
 
Culture and transfection of 293T cells
 
The experiments were divided into 4 groups: TLR-11 3'-UTR+miR-196mimic group; TLR-11 3'-UTR+miR-196 NC group, TLR-11 mut-3'-UTR+miR-196mimic group, TLR-11 mut-3'-UTR+miR-196 NC group. The assay was conducted in a 24 well plate. Firstly, 293T cells were cultured in 37oC, 5% carbon dioxide and satumiceed humidity and the culture medium was removed when they grew to 80%. Then 500 μL of Opti-MEM reduced serum medium was added to each well and incubate for 2 h. The TLR-11 3'-UTR+miR-196mimic group was loaded with 0.25 ug miR-196mimic and TLR-11 3'-UTR, TLR-11 3'-UTR+miR-196 NC group was loaded with 0.25 ug miR-196 NC and TLR-11 3'-UTR, the TLR-11 mut-3'-UTR+miR-196mimic group was loaded with 0.25 ug TLR-11 mut-3'-UTR and miR-196mimic, TLR-11 mut-3'-UTR+miR-196NC group was loaded with 0.25 ug TLR-11 mut-3'-UTR and miR-196NC and each well was added 1.5 μL liposome 2000, 548.5 uL Opti-MEM reduced serum medium, Mix up all components. The cells were inspected under a microscope after incubated for 24 and 48 h.
 
BiLuciferase reports experimental validation of target gene activity
 
The sea kidney fluorescence luminescence value and the firefly fluorescence luminescence value were detected by a multifunctional microplate reader in accordance with the dual luciferase reporter gene detection system kit’s instructions. The following formula was used to compute the relative fluorescence activity:

 
Institutional review board statement
 
All the experiments were approved by the appropriate ethics committees of Hebei Agricultural University. 
Observation results of BALB/c Mice After Infection with C. parvum
 
Poor mental functioning, lack of appetite, decreased activity, piloerection and decreased skin elasticity were all observed in the mice. As shown in Fig 2, The mice in the experimental group gained weight more slowly than these in the control group. Four mice perished two weeks after infection. All of the dead mice experienced dyspnea, generalized shaking, dehydmiceion and body emaciation prior to passing away. The small intestine’s intestinal chyme was yellow and fluid, the stomach was swollen and the intestinal wall was thin and inflated, according to the autopsy. As shown in Fig 3, red arrows in the figures point to C. parvum after acid fast staining under a microscope and without acid fast staining.

Fig 2: Mouse body weight changes.



Fig 3: The images were obtained microscopically for C. parvum.


       
After intragastric administration of C.parvum oocysts, fresh mouse feces were collected every day. Fecal samples were filtered and centrifuged and the oocyst output was observed by Maxwell’s counting method. The overall change was in a wave shape as shown in Fig 4. On 1st day, oocysts were detected from feces and the output of oocysts was relatively large, due to part of the oocysts being excreted with feces after gavage infection; the number of oocysts increased significantly on the 3rd day. The peak of output was 7-11 dpi and reached the top on the 9th day. After that, oocysts were continuously discharged until the 14th day.

Fig 4: Changes in the discharge of oocysts.


 
HiSeq sequencing and analysis results
 
MicroRNA sequencing results
 
A total of 656 microRNA precursors and 812 microRNA matures were found and 15 new matures and 15 new precursors were predicted. And the details are shown in Table 2. What’s more, the results showed that there were 204 differentially expressed microRNAs, of which 126 were up-regulated and 78 were down-regulated (Table 3).

Table 2: The number of microRNA mature bodies and precursors.



Table 3: Number of differential microRNAs.



Results of microRNA differential expression analysis
 
The results of microRNA differential expression analysis based on sequencing and analysis are shown in Table 4. The expression of microRNA of let-7 family, mmu-miR-10, mmu-miR-196, mmu-miR-146 and mmu-miR-145 in the experimental group were significantly higher than those in the control group. When compared to the control group, the expression was significantly lower in mmu-miR-21, mmu-miR-27and mmu-miR-101. The results indicated that the expression of microRNA changed after C. parvum infection.

Table 4: Partial results of microRNA differential expression analysis.


 
Screening of differential microRNAs
 
According to the microRNA difference fold and q.value in the sequencing results, the evaluation was performed. The overall distribution of small differential RNAs is shown in Fig 5. The horizontal and vertical axes indicate the expression and statistical significance of microRNAs in different experimental groups, respectively. The microRNAs with no significant difference were expressed in blue and the differentially up-regulated microRNAs were expressed in red, with 126; down-regulated significantly differential microRNAs were expressed in green, with 78.

Fig 5: Overall distribution of differential microRNAs.



Differential microRNA target gene enrichment analysis
 
The results of Geneontology (GO) enrichment analysis and KEGG Pathways enrichment analysis of differential microRNA target genes are shown in Fig 6, According to the enrichment analysis of microRNA target genes, indicating that differential microRNAs are involved in Ras signaling pathway, microbial infection, cancer pathway, receptor interaction pathway and chemokine and cytokine receptor interaction.

Fig 6: Differential microRNA target gene enrichment analysis results.


 
Verification of differentially expressed microRNAs
 
Using miR-16 as the internal parameter, real-time fluore-scence quantitative RT-qPCR detection was performed and the differential expression microRNA ( mmu-miR-10, mmu-miR-196, mmu-miR-27, mmu-miR-146, mmu-miR-145, mmu-miR-21, let-7i and mmu-miR-101) in sequencing results were randomly selected for verification. These results were consistent with the results of high-throughput sequencing, as shown in Fig 7. Let-7i can regulate NF-κB activation by modifying SIRT1 protein expression and participate in NF-κB-mediated epithelial innate immunity (Xie et al., 2014; Yin et al., 2021). Furthermore, the production of TLR4 in bile duct cells, which let-7i can control, can help the epithelial immune system respond to the C.parvum infection. Therefore, let-7i may be associated with antigen presentation and T cell activation. The expression of let-7 family was significantly higher in the test group compared to the control group in this experiment (P<0.01) and it is speculated that let-7 may be involved in the innate and cellular immune responses of C. parvum.

Fig 7: Validation of differential expression microRNA.


       
The expression of miR-146 was significantly decreased in this experiment, which may further cause the positive regulation of toll-like receptors, while TLR2 and TLR4 are involved in the recognition of microscopic C. parvum by the intestinal mucosa, which may be one of the mechanisms of host resistance to C. parvum infection. Recently, a study found that Knockdown of miR-21 inhibits NLRP3 inflammasome-mediated caspase-1 activation and IL-1β secretion in macrophages (Nahand et al., 2021). C. parvum can evade clearance by the host immune system by inhibiting host cell apoptosis (Crawford et al., 2021). In this study, the expression of miR-21 was reduced. The occurrence of this change may be due to the fact that after host infection with C. parvum, the organism regulates the low expression of miR-21 to promote apoptosis, attenuate the oxidative stress caused by NLRP3, alleviate tissue damage and further promote the parasite clearance effect. This may be one of the mechanisms of action for host clearance of immune parasite infections.
 
Verification results of miR-196 on TLR-11 gene regulation
 
Target gene prediction results
 
The correspondence of known microRNA target gene was obtained by miRanda, PITA and RNAhybrid analysis and bioinformatics analysis predicted. In the 2932-2954 base position of TLR-11 mRNA gene 3'-UTR, there may be a site that is not completely complementary to miR-196. The known microRNA target gene prediction results show that the target gene of miR-196 may be TLR-11 and the up-regulation of miR-196 may affect TLR-11 expression.
 
Results of enzyme digestion identification of target gene vector
 
The plasmid digested by Xho I restriction endonuclease was detected by 1.5% agarose gel electrophoresis and the strips of 7350 bp and 176 bp sizes can be seen as shown in Fig 8. This proves that the pmir-GLO vector has been joined to both the normal TLR-11 mRNA gene 3'-UTR chain and the TLR-11 mRNA gene 3'-UTR mutant chain.

Fig 8: 1.5% agarose gel electrophoresis results.


 
Dual luciferase reporter assay verified the prediction results of miR-196 target genes
 
Statistical analysis was conducted on all data using SPSS 22.0 software and t-test analysis was used to analyze the data. P≤0.05 was considered significant.The target gene of miR-196 was predicted by RNAhybrid and Targetscan and it was found that the target gene was TLR-11. In the comparison test of transfection of recombinant plasmid TLR-11 3’-UTR+miR-196 mimic and TLR-11 3’-UTR+miR-196 NC, the luciferase activity of TLR-11 3’-UTR+miR-196 mimic group decreased significantly (P<0.05) and the difference was significant. There was no significant difference in the activity expression of each group of  fluorinase (P>0.05) in the comparison of plasmid TLR-11 mut-3’-UTR+miR-196 mimic and TLR-11 mut 3’-UTR+miR-196 NC of transfected recombinant vector as shown in Fig 9. It was proved that miR-196 could bind specifically to 3’UTR region of TLR-11 gene, which affected the expression of firefly fluorinase in plasmid, resulting in a significant decrease in the luminescence value of firefly in the test group. In turn, it is concluded that TLR-11 is the target gene of miR-196.

Fig 9: Expression of the TLR-11-3 ‘- UTR gene. *means P<0.05.

This study was conducted by using cutting-edge techniques like fluorescence quantitative PCR and high-throughput sequencing to analyze and identify MicroRNAs involved in C. parvum infection, to reveal their molecular mechanism at the RNA level and investigate the variation of microRNA in the body after C. parvum infection. Therefore, studying changes in intestinal epithelial miRNAs following C.parvum infection of the host will help us understand the mechanisms of host- C. parvum interactions.
The present study was supported by Scientific Research Fund of Tangshan Normal University (20255129066); Tangshan Livestock and Poultry Intestinal Health Regulation Basic In Novation Team (23130234E); Special Fund for the Construction of Modern Agricultural Industry Technology System in Hebei Province (HBCT2024230201); Tangshan Experimental Station of the Innovation Team for Milk and Beef Cattle in the Modern Agricultural Industry Technology System of Hebei Province (HBCT2023180403).
 
Disclaimers
 
The views and conclusions expressed in this article are solely those of the authors and do not necessarily represent the views of their affiliated institutions. The authors are responsible for the accuracy and completeness of the information provided, but do not accept any liability for any direct or indirect losses resulting from the use of this content.
 
Informed consent
 
All animal procedures for experiments were approved by the Committee of Experimental Animal care and handling techniques were approved by the University of Animal Care Committee.
The authors declare that there are no conflicts of interest regarding the publication of this article. No funding or sponsorship influenced the design of the study, data collection, analysis, decision to publish, or preparation of the manuscript.

  1. Bouzid, M., Hunter, P.R., Chalmers, R.M. and Tyler, K.M. (2014). Cryptosporidium pathogenicity and virulence. Clinical Microbiology Reviews. 26(1): 115-134.

  2. Crawford, C.K. and Kol, A. (2021). The mucosal innate immune response  to Cryptosporidium parvum, a global one health issue. Frontiers in Cellular and Infection Microbiology. 11: 689401.

  3. Deng, Z., Zhang, Y. and Li, L. (2022). A dual luciferase reporter system for characterization of small RNA target genes in both mammalian and insect cells. Insect Science. 29(3): 631-644.

  4. Dixit, P., Rao, M.L.V., Dixit, A.K., Gupta, R. and Shukla, P.C.  (2019). Prevalence and molecular characterisation of Cryptosporidium spp. in goat kids. Indian Journal of Animal Research. 53(9): 1234-1238. doi: 10.18805/ijar.B-3642.

  5. Gallego, L.G., Mendoza, C.C. and Tibabuzo, P.A. (2022). Dual transcrip- tomics to determine gamma interferon-independent host response to intestinal Cryptosporidium parvum infection. Infection and Immunity. 90(2): e63821.

  6. Hu, G., Gong, A., Amanda, L.R. and Huang, B.Q. (2013). Release of luminal exosomes contributes to TLR4-mediated epithelial antimicrobial defense. PLoS Pathogens. 9(4): e1003261.

  7. Jesenič, T., Štajner, N., Radišek, S. and Mishra, A.K. (2022). Discovery of microRNA-like small RNAs in pathogenic plant fungus verticillium nonalfalfae using High-throughput sequencing and qPCR and RLM-RACE validation. International Journal of Molecular Sciences. 23(2): 900.

  8. Khandelwal, V., Sharma, T., Choudhary, P. and Gupta, S. (2024). MicroRNAs: An Important Signature Molecule to Improve Health and Welfare in Livestock: A Review. Indian Journal of Animal Research. 58(2): 179-189.

  9. Li, T., Liu, H., Jiang, N. and Wang, Y. (2021). Compamiceive proteomics reveals Cryptosporidium parvum manipulation of the host cell molecular expression and immune response. PLoS Neglected Tropical Diseases. 15(11): e9949.

  10. Nahand, J.S., Shojaie, L., Akhlagh, S.A. and Ebrahimi, M.S. (2021). Cell death pathways and viruses: Role of microRNAs. Molecular Therapy-nucleic Acids. 24: 487-511.

  11. Rider, S.D. and Zhu, G. (2010). Cryptosporidium: Genomic and biochemical features. Experimental Parasitology. 124(1): 2-9.

  12. Shaw, H.J., Armstrong, C., Uttley, K. and Morrison, L.J. (2021). Genetic diversity and shedding profiles for Cryptosporidium parvum in adult cattle and their calves. Current Research in Parasi- tology and Vector-Borne Diseases. 1: 100027.

  13. Xiao, X., Mao, X., Chen, D.W. and Yu, B.  (2022). MiRNAs can affect intestinal epithelial barrier in inflammatory bowel disease. Frontiers in Immunology. 13: 863229.

  14. Xie, H., Lei, N., Gong, A., Xian-Ming, C.b. and Hu, G. (2014). Cryptosporidium parvum induces SIRT1 expression in host epithelial cells through downregulating let-7i. Human Immunology. 75(8): 760-765.

  15. Xie, F., Zhang, Y., Li, J. and Sun, L. (2022). MiR-942-5p targeting the IFI27 gene regulates HCT-8 cell apoptosis via a TRAIL- dependent pathway during the early phase of Cryptosporidium  parvum infection. Parasites and Vectors. 15(1): 291.

  16. Xie, X., Pang, M. and Liang, S. (2021). Cellular microRNAs influence replication of H3N2 canine influenza virus in infected cells. Veterinary Microbiology. 257: 109083.

  17. Yin, H., Xiaqing, S., Liu, J., Li, L., Tian, Y. and Peng, J. (2021). Potential effect of β-casomorphin-7 on lymphocyte and tlr\NF-κb signaling pathway in intestinal mucosa of aged mice. Indian Journal of Animal Research. 55(7): 791-795. doi: 10.18805/ijar. B-1215.

  18. Zolova, A., Keidāne, D. and Zolovs, M. (2022). Prevalence of susceptibility to Cryptosporidium spp. among dairy calves with different feeding regimens with an emphasis on the feeding of transition milk. Veterinary World. 15(5): 1256-1260.

Screening of Intestinal Cytokines Differentially Expressed microRNAs in Cryptosporidium parvum-infected Mice

1Department of Life Science, Tangshan Normal University, Tangshan Key Laboratory of Animal Nutrition and Feed Engineering, Tangshan 063000, Hebei, China.
2College of Veterinary Medicine, Agricultural University of Hebei, Baoding 071000, Hebei, China.
3Tangshan Agricultural Science Research Institute, Thangshan 063001, Hebei, China.
4Tangshan Animal Disease Prevention and Control Center, Thangshan 063001, Hebei, China.
Cite article:- Chang Liyun, Chen Yanli, Kang Qian, Dong Lixue, Liu Zhiyong, Li Ying, Qin Jianhua (2026). Screening of Intestinal Cytokines Differentially Expressed microRNAs in Cryptosporidium parvum-infected Mice . Indian Journal of Animal Research. 60(5): 807-815. doi: 10.18805/IJAR.BF-2009.

Background: Cryptosporidium (C. parvum) is a kind of the intestinal tract that can cause diarrhea in humans and calves, however, the molecular mechanisms of host-parasite interactions are still poorly understood. Recently, non-coding microRNAs (miRNAs) have been identified as key regulators of host infection with parasites. This study aims to identify MicroRNAs molecules involved in C. parvum infection and immunity and to reveal their molecular mechanisms at the RNA level. This will provide a new idea for revealing the molecular mechanism of the relationship between trace small molecules and pathogenic infections.

Methods: It used bioinformatics analysis, qPCR and dual luciferase reporter test to investigate the miRNA expression profile of the posterior intestinal epithelium of Cryptosporidium-infected mice.

Result: The present study found that 204 microRNAs had differential expression in mice after infection with C. parvum, with 126 of them up-regulated and 78 of them down-regulated and quantitative real-time PCR validated partially differentially expressed microRNA (mmu-mi R-10, mmu-mi R-196, mmu-miR-27, mmu-miR-146, mmu-miR-145, mmu-mi R-21, let-7i and mmu-mi R-101), which consistented with high-throughput sequencing results. Different microRNAs were implicated in the pathways for Ras signaling, microbial infection, cancer, receptor interaction and the interaction of chemokine and cytokine receptors. By means of dual luciferase, TLR 11 was the target gene identified for miR-196, which indicated that MiR-196 may be involved in the host immune response to C. parvum through regulation of TLR-11. These results provide new insights into the regulatory mechanisms of host miRNAs during C. parvum, which may provide potential targets for future C. parvum control stmiceegies.

C. parvum is a zoonotic parasite belonging to the phylum Apicomplexa. The parasite C. parvum has an genome, with eight chromosomes that range in size from 0.9 to 1.4 megabases (Rider et al., 2010). It can colonise  gastroin-testinal epithelial cells and in calves it causes diarrhoea, dehydmiceion and emaciation which in severe cases can be fatal (Zolova et al., 2022). C. parvum is transmitted via the faecal-oral route. When C. parvum oocysts infect a person or animal, they release infectious sporozoites that attach to the intestinal epithelial cells and cause the development of parasitic vacuoles where C. parvum lives (Dixit et al., 2019; Li et al., 2021). Unlike other apicomplexan parasites, it is shielded from the unfavorable intestinal environment by utilizing parasitic vacuoles and provided with energy and nutrients by the host cell through a feeder organelle (Bouzid et al., 2014). In the digestive tract, new oocysts are produced through asexual or sexual reproduction and they are then expelled from the body to infect new hosts (Gallego et al., 2022). Pre-weaning calves are mainly infected with C. parvum (Shaw et al., 2021). However, the precise molecular pathogenic processes of C. parvum infection remain poorly known despite extensive research over the past years.
               
MicroRNAs (miRNAs) are highly conserved single-stranded non-coding RNAs of 21-23 nucleotides that play important gene regulatory roles in animals (Xie et al., 2021; Khandelwal et al., 2024), including regulating immune cells, affecting the integrity of the intestinal epithelial barrier, participating in epithelial cell development and influencing the intestinal flor (Xiao et al., 2022). For example, Some microRNAs have been demonstmiceed to participate in C. parvum infection and to control the epithelial cells’ immunological response to C. parvum in a particular way. Through the use of TLR2/TLR4/NF-B channels, C.parvum -infected organisms enhanced the expression of miR-942-5 p in HCT-8 cells (Xie et al., 2022); Let-7 can contribute to the epithelial cell defense mechanism brought on by C. parvum infection by triggering TLR4 signaling and increasing SNAP23 expression (Hu et al., 2013). Currently, although some studies have revealed changes in miRNA expression profiles after sporozoite infection of intestinal epithelial cells, there are no well-established reports on changes in microRNA expression profiles in in vivo models of C. parvum infection. Recently, to determine the interactions between microRNAs and their target genes, single or dual-luciferase reporter systems are frequently used (Deng et al., 2022). High-throughput sequencing methods and bioinformatics are also widely used for microRNA identification and differential expression analysis (Jeseninik et al., 2022).
Parasites strain and test animals
 
The C. parvum oocysts were kept by the Labomiceory of Preventive Veterinary Parasitology, College of Animal Medicine, Hebei Agricultural University; 48 three-week-old SPF-grade female Balb/c mice were purchased from Vitalriver, Beijing, China.
 
Establishment of BALB/c mice model infected with C. parvum
 
The animal and environment were disinfected thoroughly before the experiment. The setting in which mice are housed is sterile and drinking water is sanitized by boiling. Forty-eight female BALB/c mice (weigh: 11 g-14 g) aged 3 weeks, after 3 days of feeding adaptation, microscopic examination of mice feces confirmed no parasitic infection were randomly divided into four groups, namely two infection groups with 12 mice in each group, two control groups with 12 mice in each group, One of the groups for intestinal tissue extraction and another group for collection of mice feces, weighing and dissection.
       
Oral drinking water with the 15 mg/mL of dexamet-hasone acetate and 40 mg/L of gentamicin were used for immunosuppression for 7d. We use gastric lavage needles to administer orally. Artificial gavage of C.parvum 1.0 × 105/mL oocyst suspension was administered twice at 500 μL each on an empty stomach. Mice feces were collected daily after infection, starting on the first day and were detected under a microscope and with acid-fast staining.
       
The present study was researched in agreement with the institutional and national guidelines and was supported by the Animal Use and Ethics Committee of the Agricultural University of Hebei (University Identifi-cation Number: HB/2023/03).
 
MicroRNA sequencing and differential expression analysis
 
Small intestine tissue was taken from mice infected with C. parvum one week after infection and total RNA was extracted. The purity of RNA was detected by formaldehyde denatured agarose gel and Nanodrop. Then, Qubit and Agilent 2100 were used to detect the concentration and integrity of RNA. After pooling the different libraries according to the effective concentration and the amount of target offline data, they were sent to Beijing Nuohe Source Sequencing Company for HiSeq sequencing and analysis. concentration.
 
Differential microRNA target gene enrichment analysis
 
Prediction of microRNA target genes by intersection of miRanda, PITA and RNAhybrid, Gene Ontology and KEGG enrichment analysis were performed on the set of different microRNA-expressing target genes according to the correspondence between microRNA and its target genes. The most important biochemical metabolic pathway and signal transduction pathway in which the candidate gene is involved can be determined by significant enrichment analysis.
 
Validation of differentially expressed microRNAs
 
MicroRNAs that were differentially expressed were confirmed using real-time quantitative PCR. The volume of reaction mixtures was 20 μL, containing 2 μL cDNA, 10 μL trans start tip green qPCR super mix (Trans gen biotech, China), 0.4 μL forward primer (0.2 μM), 0.4 μL reverse primer (0.2 μM) and 7.2 μL dd H2O. MicroRNA primers are shown in Table 1. The following amplification program was used: pre-denatumiceion at 95oC for 10 min, followed by a total of 45 cycles, consisting of denatumiceion at 95oC for 30 s, annealing at 60oC for 20 s and extension at 72oC for 20 s. The expression level was calculated using 2-ΔΔCt method and normalized by the reference gene.

Table 1: Design and synthesis of primers for microRNAs.


 
Verification of miR-196 regulating TLR-11 gene
 
Prediction of microRNA target genes
 
By combining the functions of the programs microRNAmi Randa, PITA and RNAhybrid, the microRNA target genes were predicted. The primary biochemical metabolic pathways and signal transduction pathways involved in potential target genes were identified using Gene Ontology and KEGG enrichment analysis in conjunction with the correlation between microRNA and its target genes.
 
Construction of TLR-11 3'  -UTR target gene vector
 
According to microRNA target gene prediction results, the correspondence between microRNA and target gene was analyzed.
       
miR-196 was increased by 135.85 times and it was related to the toll-like receptor signaling pathway by simultaneous association analysis. Bioinformatics analysis predicts that there may be a site that is not completely complementary to miR-196 at the 2932-2954 base position of the 3'-UTR of TLR-11 mRNA gene, as shown in Fig 1. According to the prediction results, a 162-base sequence that may contain a complementary binding site with miR-196 was designed and synthesized. At the same time, a 3' -UTR base mutation chain gene sequence of the TLR-11 mRNA gene that may contain a complementary binding site with miR-196 was designed and synthesized. The Xho I restriction endonuclease site was added to the 5' end and 3' end of the target fragment. The designed and synthesized gene sequence is as follows.

Fig 1: Binding site of miR-196 and TLR-11 mRNA gene.



TLR-11 3'-UTR base normal strand (176 bp)                                               

5'CCTCGAGAGCTGGACAAGAAAGAGATTAAG GACTGCAGGAATGCTGTTGTGCAGAAGATCCTTTCAG CAGCAGAGGGAATGTGCTCTCATCACTAAAGCATGG GCTCACCAAGGGGGCAAAATGATATATTAAATTCC ACTGGGAGAGAAGTCTTTTAAAACACTGAAACTCGAGT3' TLR-11 3'-UTR base mutation strand (176 bp)

5'CCTCGAGAGCTGGACAAGAAAGAGATTAA GGACTGCAGGAATGCTGTTGTGCAGAAGATCCTTAG TCGTCGTGAGGGAATGTGCTCTCATCACTAAAGCA TGGGCTCACCAAGGGGG CAAAATGATAT ATTAAATTCCAC TGGGAGAGAAGTCTTTT AAAACACTGAAACTCGAGT3'
       
The 3'-UTR sequence of the target gene TLR-11 of miR-196 was inserted into the MCS downstream of the firefly luciferase reporter vector gene and part of the 3' non-coding region of TLR-11 was ligated to the pmir-GLO vector. Renilla luciferase gene was used as internal reference gene.
 
Identification of target gene vector by enzyme digestion
 
The pmir-GLO vector was transferred into the receptor cell Mch1T1 strain and incubated at 37oC for 12-15 h. After incubation on medium containing AMP, monoclonal colonies were picked and incubated for 12 h-15 h. The plasmids were extracted using the Plasmid Extraction Kit. The successful ligation was verified with Xho I restriction endonuclease and operate according to the Thermo Fisher (USA) enzyme digestion kit instructions. The reaction solution after enzyme digestion was examined by agarose gel electrophoresis.
 
Culture and transfection of 293T cells
 
The experiments were divided into 4 groups: TLR-11 3'-UTR+miR-196mimic group; TLR-11 3'-UTR+miR-196 NC group, TLR-11 mut-3'-UTR+miR-196mimic group, TLR-11 mut-3'-UTR+miR-196 NC group. The assay was conducted in a 24 well plate. Firstly, 293T cells were cultured in 37oC, 5% carbon dioxide and satumiceed humidity and the culture medium was removed when they grew to 80%. Then 500 μL of Opti-MEM reduced serum medium was added to each well and incubate for 2 h. The TLR-11 3'-UTR+miR-196mimic group was loaded with 0.25 ug miR-196mimic and TLR-11 3'-UTR, TLR-11 3'-UTR+miR-196 NC group was loaded with 0.25 ug miR-196 NC and TLR-11 3'-UTR, the TLR-11 mut-3'-UTR+miR-196mimic group was loaded with 0.25 ug TLR-11 mut-3'-UTR and miR-196mimic, TLR-11 mut-3'-UTR+miR-196NC group was loaded with 0.25 ug TLR-11 mut-3'-UTR and miR-196NC and each well was added 1.5 μL liposome 2000, 548.5 uL Opti-MEM reduced serum medium, Mix up all components. The cells were inspected under a microscope after incubated for 24 and 48 h.
 
BiLuciferase reports experimental validation of target gene activity
 
The sea kidney fluorescence luminescence value and the firefly fluorescence luminescence value were detected by a multifunctional microplate reader in accordance with the dual luciferase reporter gene detection system kit’s instructions. The following formula was used to compute the relative fluorescence activity:

 
Institutional review board statement
 
All the experiments were approved by the appropriate ethics committees of Hebei Agricultural University. 
Observation results of BALB/c Mice After Infection with C. parvum
 
Poor mental functioning, lack of appetite, decreased activity, piloerection and decreased skin elasticity were all observed in the mice. As shown in Fig 2, The mice in the experimental group gained weight more slowly than these in the control group. Four mice perished two weeks after infection. All of the dead mice experienced dyspnea, generalized shaking, dehydmiceion and body emaciation prior to passing away. The small intestine’s intestinal chyme was yellow and fluid, the stomach was swollen and the intestinal wall was thin and inflated, according to the autopsy. As shown in Fig 3, red arrows in the figures point to C. parvum after acid fast staining under a microscope and without acid fast staining.

Fig 2: Mouse body weight changes.



Fig 3: The images were obtained microscopically for C. parvum.


       
After intragastric administration of C.parvum oocysts, fresh mouse feces were collected every day. Fecal samples were filtered and centrifuged and the oocyst output was observed by Maxwell’s counting method. The overall change was in a wave shape as shown in Fig 4. On 1st day, oocysts were detected from feces and the output of oocysts was relatively large, due to part of the oocysts being excreted with feces after gavage infection; the number of oocysts increased significantly on the 3rd day. The peak of output was 7-11 dpi and reached the top on the 9th day. After that, oocysts were continuously discharged until the 14th day.

Fig 4: Changes in the discharge of oocysts.


 
HiSeq sequencing and analysis results
 
MicroRNA sequencing results
 
A total of 656 microRNA precursors and 812 microRNA matures were found and 15 new matures and 15 new precursors were predicted. And the details are shown in Table 2. What’s more, the results showed that there were 204 differentially expressed microRNAs, of which 126 were up-regulated and 78 were down-regulated (Table 3).

Table 2: The number of microRNA mature bodies and precursors.



Table 3: Number of differential microRNAs.



Results of microRNA differential expression analysis
 
The results of microRNA differential expression analysis based on sequencing and analysis are shown in Table 4. The expression of microRNA of let-7 family, mmu-miR-10, mmu-miR-196, mmu-miR-146 and mmu-miR-145 in the experimental group were significantly higher than those in the control group. When compared to the control group, the expression was significantly lower in mmu-miR-21, mmu-miR-27and mmu-miR-101. The results indicated that the expression of microRNA changed after C. parvum infection.

Table 4: Partial results of microRNA differential expression analysis.


 
Screening of differential microRNAs
 
According to the microRNA difference fold and q.value in the sequencing results, the evaluation was performed. The overall distribution of small differential RNAs is shown in Fig 5. The horizontal and vertical axes indicate the expression and statistical significance of microRNAs in different experimental groups, respectively. The microRNAs with no significant difference were expressed in blue and the differentially up-regulated microRNAs were expressed in red, with 126; down-regulated significantly differential microRNAs were expressed in green, with 78.

Fig 5: Overall distribution of differential microRNAs.



Differential microRNA target gene enrichment analysis
 
The results of Geneontology (GO) enrichment analysis and KEGG Pathways enrichment analysis of differential microRNA target genes are shown in Fig 6, According to the enrichment analysis of microRNA target genes, indicating that differential microRNAs are involved in Ras signaling pathway, microbial infection, cancer pathway, receptor interaction pathway and chemokine and cytokine receptor interaction.

Fig 6: Differential microRNA target gene enrichment analysis results.


 
Verification of differentially expressed microRNAs
 
Using miR-16 as the internal parameter, real-time fluore-scence quantitative RT-qPCR detection was performed and the differential expression microRNA ( mmu-miR-10, mmu-miR-196, mmu-miR-27, mmu-miR-146, mmu-miR-145, mmu-miR-21, let-7i and mmu-miR-101) in sequencing results were randomly selected for verification. These results were consistent with the results of high-throughput sequencing, as shown in Fig 7. Let-7i can regulate NF-κB activation by modifying SIRT1 protein expression and participate in NF-κB-mediated epithelial innate immunity (Xie et al., 2014; Yin et al., 2021). Furthermore, the production of TLR4 in bile duct cells, which let-7i can control, can help the epithelial immune system respond to the C.parvum infection. Therefore, let-7i may be associated with antigen presentation and T cell activation. The expression of let-7 family was significantly higher in the test group compared to the control group in this experiment (P<0.01) and it is speculated that let-7 may be involved in the innate and cellular immune responses of C. parvum.

Fig 7: Validation of differential expression microRNA.


       
The expression of miR-146 was significantly decreased in this experiment, which may further cause the positive regulation of toll-like receptors, while TLR2 and TLR4 are involved in the recognition of microscopic C. parvum by the intestinal mucosa, which may be one of the mechanisms of host resistance to C. parvum infection. Recently, a study found that Knockdown of miR-21 inhibits NLRP3 inflammasome-mediated caspase-1 activation and IL-1β secretion in macrophages (Nahand et al., 2021). C. parvum can evade clearance by the host immune system by inhibiting host cell apoptosis (Crawford et al., 2021). In this study, the expression of miR-21 was reduced. The occurrence of this change may be due to the fact that after host infection with C. parvum, the organism regulates the low expression of miR-21 to promote apoptosis, attenuate the oxidative stress caused by NLRP3, alleviate tissue damage and further promote the parasite clearance effect. This may be one of the mechanisms of action for host clearance of immune parasite infections.
 
Verification results of miR-196 on TLR-11 gene regulation
 
Target gene prediction results
 
The correspondence of known microRNA target gene was obtained by miRanda, PITA and RNAhybrid analysis and bioinformatics analysis predicted. In the 2932-2954 base position of TLR-11 mRNA gene 3'-UTR, there may be a site that is not completely complementary to miR-196. The known microRNA target gene prediction results show that the target gene of miR-196 may be TLR-11 and the up-regulation of miR-196 may affect TLR-11 expression.
 
Results of enzyme digestion identification of target gene vector
 
The plasmid digested by Xho I restriction endonuclease was detected by 1.5% agarose gel electrophoresis and the strips of 7350 bp and 176 bp sizes can be seen as shown in Fig 8. This proves that the pmir-GLO vector has been joined to both the normal TLR-11 mRNA gene 3'-UTR chain and the TLR-11 mRNA gene 3'-UTR mutant chain.

Fig 8: 1.5% agarose gel electrophoresis results.


 
Dual luciferase reporter assay verified the prediction results of miR-196 target genes
 
Statistical analysis was conducted on all data using SPSS 22.0 software and t-test analysis was used to analyze the data. P≤0.05 was considered significant.The target gene of miR-196 was predicted by RNAhybrid and Targetscan and it was found that the target gene was TLR-11. In the comparison test of transfection of recombinant plasmid TLR-11 3’-UTR+miR-196 mimic and TLR-11 3’-UTR+miR-196 NC, the luciferase activity of TLR-11 3’-UTR+miR-196 mimic group decreased significantly (P<0.05) and the difference was significant. There was no significant difference in the activity expression of each group of  fluorinase (P>0.05) in the comparison of plasmid TLR-11 mut-3’-UTR+miR-196 mimic and TLR-11 mut 3’-UTR+miR-196 NC of transfected recombinant vector as shown in Fig 9. It was proved that miR-196 could bind specifically to 3’UTR region of TLR-11 gene, which affected the expression of firefly fluorinase in plasmid, resulting in a significant decrease in the luminescence value of firefly in the test group. In turn, it is concluded that TLR-11 is the target gene of miR-196.

Fig 9: Expression of the TLR-11-3 ‘- UTR gene. *means P<0.05.

This study was conducted by using cutting-edge techniques like fluorescence quantitative PCR and high-throughput sequencing to analyze and identify MicroRNAs involved in C. parvum infection, to reveal their molecular mechanism at the RNA level and investigate the variation of microRNA in the body after C. parvum infection. Therefore, studying changes in intestinal epithelial miRNAs following C.parvum infection of the host will help us understand the mechanisms of host- C. parvum interactions.
The present study was supported by Scientific Research Fund of Tangshan Normal University (20255129066); Tangshan Livestock and Poultry Intestinal Health Regulation Basic In Novation Team (23130234E); Special Fund for the Construction of Modern Agricultural Industry Technology System in Hebei Province (HBCT2024230201); Tangshan Experimental Station of the Innovation Team for Milk and Beef Cattle in the Modern Agricultural Industry Technology System of Hebei Province (HBCT2023180403).
 
Disclaimers
 
The views and conclusions expressed in this article are solely those of the authors and do not necessarily represent the views of their affiliated institutions. The authors are responsible for the accuracy and completeness of the information provided, but do not accept any liability for any direct or indirect losses resulting from the use of this content.
 
Informed consent
 
All animal procedures for experiments were approved by the Committee of Experimental Animal care and handling techniques were approved by the University of Animal Care Committee.
The authors declare that there are no conflicts of interest regarding the publication of this article. No funding or sponsorship influenced the design of the study, data collection, analysis, decision to publish, or preparation of the manuscript.

  1. Bouzid, M., Hunter, P.R., Chalmers, R.M. and Tyler, K.M. (2014). Cryptosporidium pathogenicity and virulence. Clinical Microbiology Reviews. 26(1): 115-134.

  2. Crawford, C.K. and Kol, A. (2021). The mucosal innate immune response  to Cryptosporidium parvum, a global one health issue. Frontiers in Cellular and Infection Microbiology. 11: 689401.

  3. Deng, Z., Zhang, Y. and Li, L. (2022). A dual luciferase reporter system for characterization of small RNA target genes in both mammalian and insect cells. Insect Science. 29(3): 631-644.

  4. Dixit, P., Rao, M.L.V., Dixit, A.K., Gupta, R. and Shukla, P.C.  (2019). Prevalence and molecular characterisation of Cryptosporidium spp. in goat kids. Indian Journal of Animal Research. 53(9): 1234-1238. doi: 10.18805/ijar.B-3642.

  5. Gallego, L.G., Mendoza, C.C. and Tibabuzo, P.A. (2022). Dual transcrip- tomics to determine gamma interferon-independent host response to intestinal Cryptosporidium parvum infection. Infection and Immunity. 90(2): e63821.

  6. Hu, G., Gong, A., Amanda, L.R. and Huang, B.Q. (2013). Release of luminal exosomes contributes to TLR4-mediated epithelial antimicrobial defense. PLoS Pathogens. 9(4): e1003261.

  7. Jesenič, T., Štajner, N., Radišek, S. and Mishra, A.K. (2022). Discovery of microRNA-like small RNAs in pathogenic plant fungus verticillium nonalfalfae using High-throughput sequencing and qPCR and RLM-RACE validation. International Journal of Molecular Sciences. 23(2): 900.

  8. Khandelwal, V., Sharma, T., Choudhary, P. and Gupta, S. (2024). MicroRNAs: An Important Signature Molecule to Improve Health and Welfare in Livestock: A Review. Indian Journal of Animal Research. 58(2): 179-189.

  9. Li, T., Liu, H., Jiang, N. and Wang, Y. (2021). Compamiceive proteomics reveals Cryptosporidium parvum manipulation of the host cell molecular expression and immune response. PLoS Neglected Tropical Diseases. 15(11): e9949.

  10. Nahand, J.S., Shojaie, L., Akhlagh, S.A. and Ebrahimi, M.S. (2021). Cell death pathways and viruses: Role of microRNAs. Molecular Therapy-nucleic Acids. 24: 487-511.

  11. Rider, S.D. and Zhu, G. (2010). Cryptosporidium: Genomic and biochemical features. Experimental Parasitology. 124(1): 2-9.

  12. Shaw, H.J., Armstrong, C., Uttley, K. and Morrison, L.J. (2021). Genetic diversity and shedding profiles for Cryptosporidium parvum in adult cattle and their calves. Current Research in Parasi- tology and Vector-Borne Diseases. 1: 100027.

  13. Xiao, X., Mao, X., Chen, D.W. and Yu, B.  (2022). MiRNAs can affect intestinal epithelial barrier in inflammatory bowel disease. Frontiers in Immunology. 13: 863229.

  14. Xie, H., Lei, N., Gong, A., Xian-Ming, C.b. and Hu, G. (2014). Cryptosporidium parvum induces SIRT1 expression in host epithelial cells through downregulating let-7i. Human Immunology. 75(8): 760-765.

  15. Xie, F., Zhang, Y., Li, J. and Sun, L. (2022). MiR-942-5p targeting the IFI27 gene regulates HCT-8 cell apoptosis via a TRAIL- dependent pathway during the early phase of Cryptosporidium  parvum infection. Parasites and Vectors. 15(1): 291.

  16. Xie, X., Pang, M. and Liang, S. (2021). Cellular microRNAs influence replication of H3N2 canine influenza virus in infected cells. Veterinary Microbiology. 257: 109083.

  17. Yin, H., Xiaqing, S., Liu, J., Li, L., Tian, Y. and Peng, J. (2021). Potential effect of β-casomorphin-7 on lymphocyte and tlr\NF-κb signaling pathway in intestinal mucosa of aged mice. Indian Journal of Animal Research. 55(7): 791-795. doi: 10.18805/ijar. B-1215.

  18. Zolova, A., Keidāne, D. and Zolovs, M. (2022). Prevalence of susceptibility to Cryptosporidium spp. among dairy calves with different feeding regimens with an emphasis on the feeding of transition milk. Veterinary World. 15(5): 1256-1260.
In this Article
Published In
Indian Journal of Animal Research

Editorial Board

View all (0)