volume 58 issue 4 (april 2024) : 660-665,   Doi: 10.18805/IJAR.BF-1483

Prevalence and Antibiogram of Clostridium perfringens in Small Ruminants of District Kalat, Balochistan

A
Abdul Hakeem1
A
Asghar Ali Kamboh1,2,*
A
Abdulkareem Mohammed Matar3
S
Sibtain Ahmad4
S
Shahbaz Ahmad5
V
Vijay Kumar1
I
Imran Taj6
1Department of Veterinary Microbiology, Faculty of Animal Husbandry and Veterinary Sciences, Sindh Agriculture University, Tandojam, Pakistan.
2College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, PR China.
3Department of Animal Production, College of Food and Agriculture Sciences, King Saud University, P.O. Box 2460, Riyadh 11451, Saudi Arabia.
4Institute of Animal and Dairy Sciences, University of Agriculture, Faisalabad, Pakistan.
5Department of Education, The University of Lahore, Sargodha Campus, Pakistan.
6Center for Advanced Studies and Vaccinology and Biotechnology, University of Balochistan, Quetta, Pakistan.
Cite article:- Hakeem Abdul, Kamboh Ali Asghar, Matar Mohammed Abdulkareem, Ahmad Sibtain, Ahmad Shahbaz, Kumar Vijay, Taj Imran (2024). Prevalence and Antibiogram of Clostridium perfringens in Small Ruminants of District Kalat, Balochistan . Indian Journal of Animal Research. 58(4): 660-665. doi: 10.18805/IJAR.BF-1483.
Background: Among life-threatening infections of small ruminants (sheep/goat), enterotoxaemia has vital importance. This disease is caused by certain serotype of Clostridium perfringens and commonly known as pulpy kidney or overeating infection. The current study was carried out to determine the prevalence of C. perfringens in small ruminants in different zones (Kalat, Mangochar, Johan, and Gazg) of district Kalat, Balochistan. 

Methods: Fecal samples (n=100) were collected aseptically, from rectum of enterotoxaemia suspected animals. The samples were cultured in Reinforced Clostridial Media (RCM). Biochemically identified isolates were further confirmed through polymerase chain reaction (PCR). 

Result: Overall prevalence of C. perfringens was noticed 48%, with higher occurrence rate (p < 0.01) in sheep (60%) than goat (36%). Among fifty samples of each specie, 30 and 18 isolates recovered from sheep and goat respectively. The area wise analysis showed that, in goats, the highest prevalence was found in Kalat (50%) followed by the Mangochar (38.46%), Johan (30.77%) and Gazg (25%). The statistical analysis revealed the significant differences (p < 0.05; 95% confidence interval (CI) 18.80-68.91) in C. perfringens prevalence in various areas of Kalat district. The results of the gender-wise prevalence of C. perfringens exhibited a numerically higher (p>0.05; 95% CI 9.23-49.02) prevalence in female goats (40%) than male goats (32%). Whereas, the age-wise analysis indicated that, in < 1 year age group (44.44%), the prevalence of C. perfringens was higher (p<0.05; 95% CI 8.00-57.89) than >1 but <2 years  (29.41%) and ³ 2-year (33.33%) age groups. Similarly, in sheep, the highest prevalence (p<0.05) was found in Kalat (76.92%) followed by Mangochar (66.67%), Johan (58.33%) and Gazg (38.46%). The age wise and gender-wise differences (p<0.05) were also observed in various age and gender groups of sheep similar to goat. Among 30 sheep isolates of C. perfringens, a highest number (28 isolates) showed resistance against amikacin, followed by amoxicillin/penicillin (25 isolates) and colistin sulphate (22 isolates); while among 18 isolates of goat 17 were found resistant against colistin sulphate and 16 were resistant against amoxicillin and amikacin. In conclusion enterotoxaemia is prevailing in small ruminants of district Kalat, Balochistan thus mass scale vaccination campaign should be carried out to prevent losses.
In human nutrition, sheep and goat products (milk and meat) have great importance and consumers’ acceptability. Small ruminants (sheep/goat) are common livestock animals all over the globe that play significant role in human nutrition.  In most of the developing countries small ruminants are considered the greatest resource of income. However, occurrence of various diseases in these animals is a serious issue as it causes extensive losses to small ruminants and their guardians (Singh et al., 2018). Among life-threatening infections, enterotoxaemia has vital importance. The disease usually occurs due to the ingestion of more grain or luxurious pasture (Taj et al., 2018). It has been estimated that defense of small ruminants from infectious diseases particularly from enterotoxaemia can help to get good production and profit. Production of the livestock and farmers’ profit are mainly affected by enterotoxaemia (Chandran et al., 2010; Wang et al., 2011). Investigators from various parts of the world stated dissimilar incidence percentage (24.13 to 100 per cent) of enterotoxaemia in small ruminants (Fayez et al., 2013). Enterotoxaemia which is also known as pulpy kidney or overeating disease is caused by certain serotype of C. perfringens in small ruminants, which can even devastate the whole farm (Taj et al., 2018; Uzal et al., 2016).
       
Clostridium perfringens may be present in atmosphere, soil, water and decomposing animals as well as gut of animals and humans. It is an anaerobic, rod shaped, spore forming bacteria (Talukdar et al., 2017). C. perfringens produces about 17 dissimilar toxins that belongs to four main types, named as iota, epsilon, beta and alpha which prior to onset of disease formed in gut and absorbed in overall circulation (Park et al., 2019). Enterotoxaemia disease in small ruminants is produced by C. perfringens type D that rarely found in other livestock species. Clinical and pathological findings of the disease are relatively changed in sheep and goats. Type D of C. perfringens produce two types of toxins i.e., epsilon and alpha toxins. Definite toxin types produce intestinal disease in numerous species of animals (Nazki et al., 2017). A study reported the 14.5% occurrence of C. perfringens in food samples and recommended that it is important to ensure product protection mainly when it is to be consumed by newborns and elderly people (El-Bayomi et al., 2020). A previous study conducted in Punjab, Pakistan showed 64 and 37% prevalence of C. perfringens in diseased and healthy animals respectively (Mohiuddin et al., 2020). The high distribution of disease also reported in the neighboring countries including India, Bangladesh and China (Chai et al., 2001; Milton et al., 2017).
       
Keeping in view the above situation the present study planned to study the prevalence of C. perfringens in goat and sheep of district Kalat, Balochistan using culture- and PCR (polymerase chain reaction)- based techniques. The study further investigated the associated risk factors as well as the antibiogram profile of C. perfringens isolates.
Study area and sampling
 
Fecal samples (n= 100) were collected from various zones (Kalat, Mangochar, Johan and Gazg) of Kalat district during October to December 2020. Rectal swabs were collected aseptically from sheep and goats (n= 50 each) showing diarrhea or loose stool, stomach pain characterized by kicking their belly or repeated laying down and getting up, panting and crying. The samples collected in sterile polyethylene sachets and brought to Center for Advanced Studies and Vaccinology and Biotechnology, University of Balochistan, Quetta for isolation and identification of Clostridium perfringens using standard bacteriological techniques (Musawa et al., 2021). In brief, PBS diluted (1:10) samples were cultured onto reinforced clostridial media (RCM) and incubated anaerobically at 37oC for 24 h. After primary identification based on colony characteristics and Gram staining, the isolates were confirmed by biochemical characterization as stated earlier (Mohiuddin et al., 2020).
 
Genomic DNA Extraction and Polymerase Chain Reaction
 
Extraction of genomic DNA was done from C. perfringens isolates using commercially available extraction kit following the instruction of the manufacturer (GeneAll, Korea). Polymerase chain reaction was performed for recognition of target Cpe gene by using specific primers CpeF 5' - GGAGATGGTTGGATATTAGG - 3' cpeR5' - GGACCAGCAG TTGTAGATA - 3' according to the procedures of Taj et al., (2018). For performing PCR, the total volume of reaction mixture was 30 µl that comprises 12 µl of grade water, 6 µl of DNA template, 1 µl of each primer and 10 µl of master mix. Initial temperature provided for denaturation was 94oC for 5 minutes. Then 55oC for 30 seconds for annealing and 72oC for 7 minutes for extension was provided. Denaturation, annealing and extension was repeated for 25 cycles. A 324 bp amplification product was confirmed through 5% agarose gel, having 0.5 µl of ethidium bromide.
 
Antibiotic sensitivity test
 
The test was carried out to check susceptibility and resistance of C. perfringens to various antibiotics according to guidelines of CLSI (2017). Commercially available antibiotic discs (Oxoid, UK) used via disk diffusion method and all samples were analyzed in triplicate. Antibiotic discs (viz., trimethoprim (5 µg), colistin sulphate (10 µg), amoxicillin (25 µg), clarithromycin (15 µg), tetracycline (10 µg), ciprofloxacin (5 mcg), ceftazidime (30 µg), amikacin (30 µg), penicillin g (10 units) and meropenem (10 µg) were placed onto the surface of Muller Hinton agar with the help of disc dispenser and pressed slightly with sterile forceps for fixing. Then petri dishes incubated for 24 h at 37oC. After overnight incubation, diameter of zone of inhibition was measured.   

Statistical analysis
 
All data was tabulated in Microsoft Excel spreadsheets and analyzed by JMP® Statistical Package Software. Chi-square test was applied to calculate the association of risk factors with prevalence of C. perfringens.
Overall prevalence of C. perfringens
 
As shown in Table 1, from 100 feacal samples C. perfringens was identified in 48 samples, while 52 samples were found negative. The prevalence of C. perfringens was found significantly higher (p<0.01) in sheep (60%) as compared to goats (36%). The confirmation of positive samples was done by amplification of 324 bp fragment of CPA gene using PCR (Fig 1). 
 

Table 1: The overall prevalence of C. perfringens in goats and sheep of district Kalat.


 

Fig 1: Molecular identification of C. perfringens isolates.


 
Prevalence of C. perfringens in goats
 
The results presented in Table 2 exhibited a highest prevalence in Kalat (50%) followed by the Mangochar (38.46%), Johan (30.77%) and Gazg (25%). The statistical analysis revealed the significant differences (p<0.05; 95% confidence interval (CI) 18.808-68.913) in C. perfringens prevalence in various areas of Kalat district. The results of the gender-wise prevalence of C. perfringens exhibited a numerically higher (p>0.05; 95% CI 9.228-49.023) prevalence in females’ goats (40%) than male goats (32%). All the specimens were collected from dissimilar age groups of goats and categorized as <1 year, >1 but <2 years and ≥2 year. The age-wise analysis indicated that, in <1 year age group (44.44%), the prevalence of C. perfringens was higher (p<0.05; 95% CI 8.002-57.888) than >1 but <2 years (29.41%) and ≥ 2-year (33.33%) age groups.
 

Table 2: The prevalence of C. perfringens in goats in district Kalat.


 
Prevalence of C. perfringens in sheep
 
As shown in Table 3, the highest prevalence was found in Kalat (76.92%) followed by Mangochar (66.67%), Johan (58.33%) and Gazg (38.46%). The statistical analysis revealed the significant difference (p<0.014; 95% CI 19.009-93.092) in C. perfringens prevalence in various areas of Kalat district. Similarly, the age wise analysis indicated that, in <1 year age group (68.18%), the prevalence of C. perfringens was higher (p<0.05; 95% CI 29.514-82.467) than >1 but <2 years (62.50%) and ≥2-year (41.67%) age groups. However, the results regarding gender-wise prevalence of C. perfringens exhibited a numerically higher (p>0.05; 95% CI 38.038-83.594) prevalence in female (72%) as compared to male (48%) sheep.
 

Table 3: The prevalence of C. perfringens in sheep in district Kalat.


 
Antibiogram of C. perfringens isolates
 
As shown in Table 4, among 30 sheep isolates of C. perfringens, a highest number (28 isolates) showed resistance against amikacin, followed by amoxicillin/penicillin (25 isolates) and colistin sulphate (22 isolates). Whereas, among 18 isolates of goat a highest number (17 isolates) found resistant against colistin sulphate, followed by amoxicillin/amikacin (16 isolates) and penicillin (13 isolates). All the isolates (100%) of sheep and goat origin found susceptible to ceftazidime.
 

Table 4: The antibiogram of C. perfringens isolated from goats and sheep of district Kalat.*


       
In current investigation, the overall prevalence of C. perfringens was detected as 48%; with comparatively higher incidence in sheep (60%) as compared to goats (36%). A total of 48 isolates (30 sheep and 18 goat) were confirmed using biochemical characterization from 48 positive colonies.  Similar results of C. perfringens prevalence have been reported by Taj et al., (2018), who reported 34.4% prevalence in goats and 54.78% in sheep in different areas of Balochistan. In another study, Rahimoon et al., (2020) examined 100 samples, collected from small ruminants, out of which 45 samples were found positive for C. perfringens. In contrast, Ajaz-ul-Haq et al., (2016) reported 66.5% incidence of C. perfringens in goats and sheep of district Khuzdar Balochistan. This high prevalence percentage of the organism may be due to environmental conditions, vaccination status and management (Shehzadi et al., 2021). In current investigation, we also used polymerase chain reaction assay to confirm the isolates of C. perfringens by amplifying the 324bp fragment of CPA (alpha toxin gene) as suggested in literature (Alsaab et al., 2021).
       
Our study showed the area-wise differences (25 to 50% in goats and 38.46 to 76.92% in sheep) in the prevalence of C. perfringens in small ruminants in Kalat district. Similar results have been reported by Rahimoon et al., (2020) who reported the 11.11 to 44.44% prevalence of C. perfringens in goats of different areas of district Tharparkar. The authors postulated that occurrence rates of enterotoxaemia in different geographical locations might be due to improper vaccination schedule against enterotoxaemia, geographical differences and/or difference in breeds used in study. Earlier studies have reported the breed-wise differences in farm animals for susceptibility against infectious diseases (Mangi et al., 2015).
       
Gender wise prevalence of C. perfringens in goats and sheep exhibited the high prevalence in females as compared to males. These results reveled that females are at high risk then males. Our results are in agreement with the results of Ajaz-ul-Haq et al., (2016) who observed that 38% females are positive with C. perfringens, as compared to males 28.5%. Previous published literature have also demonstrated that females are comparatively more susceptible to chronic as well as acute microbial infections as compared to male animals (Malhi et al., 2020).
       
The current investigation demonstrated the high incidence of C. perfringens in small ruminants of less than 1 year age group, which are in aggrement with the results of Ajaz-ul-Haq et al., (2016), who reported 18.5% prevalence of C. perfringens in age group of 6 months to 1 year as compared to adult small ruminants (7.5%). In another study, Nazki et al., (2017), reported high prevalence of C. perfringens in lambs (56.16%) and kids (46.16%) than adult goat and sheep (3.84%). The authors described that high prevalence rate of C. perfringens in young animals is probably due to heavy feeding of lambs and kids on lush pastures in addition to milking by their mothers; they also detected higher incidence in adult small ruminants grazed on luxurious pastures (Nazki et al., 2017).
               
 In this study antibiogram of the isolated organisms from small ruminants was conducted by disk diffusion method. The obtained results revealed that C. perfringens isolates of both sheep and goat origin exhibited 100% susceptibility against ceftazidime (a third generation cephalosporin) which is also in accordance with study of Mohiuddin et al., (2020) who reported 100% inhibition of  C. perfringens isolates against a third generation cephalosporin viz., ceftiofur. Our results revealed trimethoprim as a second most susceptible antibiotic against C. perfringens isolates. In contrary, the study of Haider et al., (2022) reported the little efficacy of trimethoprim against C. perfringens isolates of poultry. This might be due to the frequent use of this antibiotic in poultry production to get utmost production (Mohsin et al., 2019). Our results are also in agreement with the study of Elariny et al., (2021), who reported the resistant behavior of C. perfringens against oxytetracycline (87.5%), amoxicillin (83.4%), ampicillin and erythromycin (75%).
In conclusion, enterotoxaemia causing bacterium viz., C. perfringens is prevalent in goats and sheep of district Kalat, Balochistan. Sheep were more affected than goats, the female animals were at high risk than males. Moreover, higher prevalence of C. perfringens was detected in <1 year age group. This study will be help full in designing the large-scale epidemiological studies and vaccination programs for control of the disease particularly in the study area.
The authors extend their appreciation to the Researchers Supporting Project number (RSPD2024R1111), King Saud University, Riyadh, Saudi Arabia. The authors thank the farmers for their cooperation in sampling.
This research was funded by the Researchers Supporting Project number (RSPD2024R1111), King Saud University, Riyadh, Saudi Arabia.
The authors declared no conflict of interest.

  1. Ajaz-ul-Haq, M.K.T., Taj, I., Arif, S., Ahmed, A., Muhammad, G., Ahmed, Z., Ahmed, Z., Abbas, F. and Samad, A. (2016). Isolation of Clostridium perfringens from goats and sheep of the Khuzdar district of Balochistan, Pakistan. International Journal of Biosciences. 9(5): 156-162.

  2. Alsaab, F., Wahdan, A. and Saeed, E.M. (2021). Phenotypic detection and genotyping of Clostridium perfringens associated with enterotoxemia in sheep in the Qassim Region of Saudi Arabia. Veterinary World. 14(3): 578-584.

  3. Babar, W., Iqbal, Z., Khan, M. N. and Muhammad, G. (2012). An Inventory of the Plants Used for Parasitic Ailments of Animals. Pakistan Veterinary Journal. 32(2): 183-187.

  4. Chai, T., Ma, R., Chang, W. and Zhang, S. (2001). Spread and pathogenic mechanism of Clostridium perfringens. Chinese Journal of Preventive Veterinary Medicine. 1: 70-72.

  5. Chandran, D., Naidu, S.S., Sugumar, P., Rani, G.S., Vijayan, S.P., Mathur, D., Lalit, C. Garg and Srinivasan, V.A. (2010). Development of a recombinant epsilon toxoid vaccine against enterotoxemia and its use as a combination vaccine with live attenuated sheep pox virus against enterotoxemia and sheep pox. Clinical and Vaccine Immunology. 17(6): 1013-1016.

  6. CLSI Guidelines (2017). Clinical and Laboratory Standards Institute.

  7. Standards Development Policies and Process. Annapolis Junction, Maryland, USA.

  8. Elariny E.Y.T., Ahmed H.A., Khatab, A.A.H. and Mohamed, R.E. (2021). Genotyping, antibiotic resistance and biofilm formation ability of Clostridium perfringens isolated from raw milk, dairy products and human consumers. Journal of Animal Health and Production. 9(s1): 34-41.

  9. El-Bayomi, R.M., El-Mesalamy, Y.M., Hafez, A.E. and Ahmed, H.A. (2020). Prevalence of Clostridium perfringens in retail meat and meat products with some decontamination trials by some essential oils. Journal of Animal Health and Production. 9(s1): 61-68.

  10. Fayez, M.M., Al Musallam, A., Al Marzoog, A. and Suleiman, M.B. (2013). Prevalence and toxinotyping of the toxigenic Clostridium perfringens in sheep with suspected Enterotoxemia. Natural Sciences. 11(8): 15-21. 

  11. Haider, Z., Ali, T., Ullah, A., Basit, A., Tahir, H., Tariq, H., Ilyas, S.Z., Hayat, Z., Rehman, S.U. (2022). Isolation, toxinotyping and antimicrobial susceptibility testing of Clostridium perfringens isolated from Pakistan poultry. Anaerobe. 73: 102499.

  12. Malhi, K.K., Kamboh, A.A., Kumar, C., Dewani, P., Kumar, M., Abro, S.H., Leghari, Ambreen, Wang, X. and Yu, S. (2020). Prevalence of bovine tuberculosis in buffaloes in Hyderabad and TandoAllahyar districts of Sindh, Pakistan. Indian Journal of Animal Research. 54(1): 101-105. doi: 10.188 05/ijar.B-931.

  13. Mangi, M.H., Kamboh, A.A., Rind, R., Dewani, P., Nizamani, Z.A., Mangi, A.R., Nizamani, A.R. and Vistro, W.A. (2015). Seroprevalence of brucellosis in Holstein-Friesian and indigenous cattle breeds of Sindh Province. Pakistan. Journal Animal Health Production. 3(4): 82-87.

  14. Milton, A.A.P., Agarwal, R.K., Priya, G.B., Saminathan, M., Aravind, M., Reddy, A., Athira, C., Ramees, T., Sharma, A.K. and Kumar, A. (2017). Prevalence and molecular typing of Clostridium perfringens in captive wildlife in India. Anaerobe. 44: 55-57.

  15. Mohiuddin, M., Iqbal, Z., Siddique, A., Liao, S., Salamat, M.K.F., Qi, N., Din, A.M. and Sun, M. (2020). Prevalence, genotypic and phenotypic characterization and antibiotic resistance profile of Clostridium perfringens type A and D isolated from feces of sheep (Ovis aries) and goats (Capra hircus) in Punjab, Pakistan. Toxins. 12(10): p.657.

  16. Mohsin, M., Van Boeckel, T.P., Saleemi, M.K., Umair, M., Naseem, M.N., He, C., Khan, A. and Laxminarayan, R. (2019). Excessive use of medically important antimicrobials in food animals in Pakistan: A five-year surveillance survey. Global Health Action. 12(sup 1): p.1697541.

  17. Musawa, A.I., Bashiru, G., Al-Rasheed, A., Yakubu, Y., Jibril, A.H., Ballah, F.M., Sidi, S., Lawal, N., Bala, J.A., Odhah, M.N., Muhammad, N. and Umar, M. (2021). Prevalence and antimicrobial susceptibility profiling of salmonella isolated from poultry products sold in Sokoto metropolis, Nigeria. Journal of Animal Health and Production. 9(2): 148-155.    

  18. Nazki, S., Wani, S.A., Parveen, R., Ahangar, S.A., Kashoo, Z.A., Hamid, S., Dar, Z.A., Dar, T.A. and Dar, P.A. (2017). Isolation, molecular characterization and prevalence of Clostridium perfringens in sheep and goats of Kashmir Himalayas, India. Veterinary World. 10(12): 1501-1507.

  19. Park, C.S., Hwang, J.Y. and Cho, G.J. (2019). The first identification and antibiogram of Clostridium perfringens type C isolated from soil and the feces of dead foals in South Korea. Animals. 9(8): 579-586.

  20. Rahimoon, M.M., Zaman, J.K., Babar, A., Mirani, A.H. and Kalhoro, N.H. (2020). Prevalence of enterotoxemia and antibiogram of Clostridium perfringens isolated from diarrheic goat in the vicinity of district Tharparkar, Sindh, Pakistan. Pure and Applied Biology. 10(2): 408-415. 

  21. Shehzadi, S., Khan, S.B., Sadique, U. and Nawaz, S. (2021). Isolation and molecular identification of Clostridium perfringens type D in goats in district Peshawar. Sarhad Journal of Agriculture. 37(1): 110-114. 

  22. Singh, D.D., Pawaiya, R.V.S., Gururaj, K., Gangwar, N.K., Mishra, A.K., Singh, R., Andani, D. and Kumar, A. (2018). Detection of Clostridium perfringens toxinotypes, enteropathogenic E. coli, Rota and corona viruses in the intestine of neonatal goat kids by molecular techniques. Indian Journal of Animal Sciences. 88(6): 655-661.

  23. Taj, I., Abbas, F., Ahmad, Z., Taj, M.K., Shahzad, F., Haq, A.U., Ahmed, Z., Mohammad, G., Ahmad, D. and Azam, S. (2018). Detection and Characterization of Clostridium perfringens Serotype D from Small Ruminants of Balochistan. Pakistan Journal of Zoology. 50(6): 1-4.

  24. Talukdar, P.K., Udompijitkul, P., Hossain, A. and Sarker, M.R. (2017). Inactivation strategies for Clostridium perfringens spores and vegetative cells. Applied and Environmental Microbiology. 83: 1-13.

  25. Uzal, F.A., Giannitti, F., Finnie, J.W. and García, J.P. (2016). Diseases produced by Clostridium perfringens type D. Clostridial Diseases of Animals; Wiley Blackwell: Ames, IA, USA, 157-172. 

  26. Wang, G., Zhou, J., Zheng, F., Lin, G., Cao, X., Gong, X. and Qiu, C. (2011). Detection of different genotypes of Clostridium perfringens in feces of healthy dairy cattle from China using real-time duplex PCR assay. Pakistan Veterinary Journal. 31(2): 120-124.

Prevalence and Antibiogram of Clostridium perfringens in Small Ruminants of District Kalat, Balochistan

A
Abdul Hakeem1
A
Asghar Ali Kamboh1,2,*
A
Abdulkareem Mohammed Matar3
S
Sibtain Ahmad4
S
Shahbaz Ahmad5
V
Vijay Kumar1
I
Imran Taj6
1Department of Veterinary Microbiology, Faculty of Animal Husbandry and Veterinary Sciences, Sindh Agriculture University, Tandojam, Pakistan.
2College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, PR China.
3Department of Animal Production, College of Food and Agriculture Sciences, King Saud University, P.O. Box 2460, Riyadh 11451, Saudi Arabia.
4Institute of Animal and Dairy Sciences, University of Agriculture, Faisalabad, Pakistan.
5Department of Education, The University of Lahore, Sargodha Campus, Pakistan.
6Center for Advanced Studies and Vaccinology and Biotechnology, University of Balochistan, Quetta, Pakistan.
Cite article:- Hakeem Abdul, Kamboh Ali Asghar, Matar Mohammed Abdulkareem, Ahmad Sibtain, Ahmad Shahbaz, Kumar Vijay, Taj Imran (2024). Prevalence and Antibiogram of Clostridium perfringens in Small Ruminants of District Kalat, Balochistan . Indian Journal of Animal Research. 58(4): 660-665. doi: 10.18805/IJAR.BF-1483.
Background: Among life-threatening infections of small ruminants (sheep/goat), enterotoxaemia has vital importance. This disease is caused by certain serotype of Clostridium perfringens and commonly known as pulpy kidney or overeating infection. The current study was carried out to determine the prevalence of C. perfringens in small ruminants in different zones (Kalat, Mangochar, Johan, and Gazg) of district Kalat, Balochistan. 

Methods: Fecal samples (n=100) were collected aseptically, from rectum of enterotoxaemia suspected animals. The samples were cultured in Reinforced Clostridial Media (RCM). Biochemically identified isolates were further confirmed through polymerase chain reaction (PCR). 

Result: Overall prevalence of C. perfringens was noticed 48%, with higher occurrence rate (p < 0.01) in sheep (60%) than goat (36%). Among fifty samples of each specie, 30 and 18 isolates recovered from sheep and goat respectively. The area wise analysis showed that, in goats, the highest prevalence was found in Kalat (50%) followed by the Mangochar (38.46%), Johan (30.77%) and Gazg (25%). The statistical analysis revealed the significant differences (p < 0.05; 95% confidence interval (CI) 18.80-68.91) in C. perfringens prevalence in various areas of Kalat district. The results of the gender-wise prevalence of C. perfringens exhibited a numerically higher (p>0.05; 95% CI 9.23-49.02) prevalence in female goats (40%) than male goats (32%). Whereas, the age-wise analysis indicated that, in < 1 year age group (44.44%), the prevalence of C. perfringens was higher (p<0.05; 95% CI 8.00-57.89) than >1 but <2 years  (29.41%) and ³ 2-year (33.33%) age groups. Similarly, in sheep, the highest prevalence (p<0.05) was found in Kalat (76.92%) followed by Mangochar (66.67%), Johan (58.33%) and Gazg (38.46%). The age wise and gender-wise differences (p<0.05) were also observed in various age and gender groups of sheep similar to goat. Among 30 sheep isolates of C. perfringens, a highest number (28 isolates) showed resistance against amikacin, followed by amoxicillin/penicillin (25 isolates) and colistin sulphate (22 isolates); while among 18 isolates of goat 17 were found resistant against colistin sulphate and 16 were resistant against amoxicillin and amikacin. In conclusion enterotoxaemia is prevailing in small ruminants of district Kalat, Balochistan thus mass scale vaccination campaign should be carried out to prevent losses.
In human nutrition, sheep and goat products (milk and meat) have great importance and consumers’ acceptability. Small ruminants (sheep/goat) are common livestock animals all over the globe that play significant role in human nutrition.  In most of the developing countries small ruminants are considered the greatest resource of income. However, occurrence of various diseases in these animals is a serious issue as it causes extensive losses to small ruminants and their guardians (Singh et al., 2018). Among life-threatening infections, enterotoxaemia has vital importance. The disease usually occurs due to the ingestion of more grain or luxurious pasture (Taj et al., 2018). It has been estimated that defense of small ruminants from infectious diseases particularly from enterotoxaemia can help to get good production and profit. Production of the livestock and farmers’ profit are mainly affected by enterotoxaemia (Chandran et al., 2010; Wang et al., 2011). Investigators from various parts of the world stated dissimilar incidence percentage (24.13 to 100 per cent) of enterotoxaemia in small ruminants (Fayez et al., 2013). Enterotoxaemia which is also known as pulpy kidney or overeating disease is caused by certain serotype of C. perfringens in small ruminants, which can even devastate the whole farm (Taj et al., 2018; Uzal et al., 2016).
       
Clostridium perfringens may be present in atmosphere, soil, water and decomposing animals as well as gut of animals and humans. It is an anaerobic, rod shaped, spore forming bacteria (Talukdar et al., 2017). C. perfringens produces about 17 dissimilar toxins that belongs to four main types, named as iota, epsilon, beta and alpha which prior to onset of disease formed in gut and absorbed in overall circulation (Park et al., 2019). Enterotoxaemia disease in small ruminants is produced by C. perfringens type D that rarely found in other livestock species. Clinical and pathological findings of the disease are relatively changed in sheep and goats. Type D of C. perfringens produce two types of toxins i.e., epsilon and alpha toxins. Definite toxin types produce intestinal disease in numerous species of animals (Nazki et al., 2017). A study reported the 14.5% occurrence of C. perfringens in food samples and recommended that it is important to ensure product protection mainly when it is to be consumed by newborns and elderly people (El-Bayomi et al., 2020). A previous study conducted in Punjab, Pakistan showed 64 and 37% prevalence of C. perfringens in diseased and healthy animals respectively (Mohiuddin et al., 2020). The high distribution of disease also reported in the neighboring countries including India, Bangladesh and China (Chai et al., 2001; Milton et al., 2017).
       
Keeping in view the above situation the present study planned to study the prevalence of C. perfringens in goat and sheep of district Kalat, Balochistan using culture- and PCR (polymerase chain reaction)- based techniques. The study further investigated the associated risk factors as well as the antibiogram profile of C. perfringens isolates.
Study area and sampling
 
Fecal samples (n= 100) were collected from various zones (Kalat, Mangochar, Johan and Gazg) of Kalat district during October to December 2020. Rectal swabs were collected aseptically from sheep and goats (n= 50 each) showing diarrhea or loose stool, stomach pain characterized by kicking their belly or repeated laying down and getting up, panting and crying. The samples collected in sterile polyethylene sachets and brought to Center for Advanced Studies and Vaccinology and Biotechnology, University of Balochistan, Quetta for isolation and identification of Clostridium perfringens using standard bacteriological techniques (Musawa et al., 2021). In brief, PBS diluted (1:10) samples were cultured onto reinforced clostridial media (RCM) and incubated anaerobically at 37oC for 24 h. After primary identification based on colony characteristics and Gram staining, the isolates were confirmed by biochemical characterization as stated earlier (Mohiuddin et al., 2020).
 
Genomic DNA Extraction and Polymerase Chain Reaction
 
Extraction of genomic DNA was done from C. perfringens isolates using commercially available extraction kit following the instruction of the manufacturer (GeneAll, Korea). Polymerase chain reaction was performed for recognition of target Cpe gene by using specific primers CpeF 5' - GGAGATGGTTGGATATTAGG - 3' cpeR5' - GGACCAGCAG TTGTAGATA - 3' according to the procedures of Taj et al., (2018). For performing PCR, the total volume of reaction mixture was 30 µl that comprises 12 µl of grade water, 6 µl of DNA template, 1 µl of each primer and 10 µl of master mix. Initial temperature provided for denaturation was 94oC for 5 minutes. Then 55oC for 30 seconds for annealing and 72oC for 7 minutes for extension was provided. Denaturation, annealing and extension was repeated for 25 cycles. A 324 bp amplification product was confirmed through 5% agarose gel, having 0.5 µl of ethidium bromide.
 
Antibiotic sensitivity test
 
The test was carried out to check susceptibility and resistance of C. perfringens to various antibiotics according to guidelines of CLSI (2017). Commercially available antibiotic discs (Oxoid, UK) used via disk diffusion method and all samples were analyzed in triplicate. Antibiotic discs (viz., trimethoprim (5 µg), colistin sulphate (10 µg), amoxicillin (25 µg), clarithromycin (15 µg), tetracycline (10 µg), ciprofloxacin (5 mcg), ceftazidime (30 µg), amikacin (30 µg), penicillin g (10 units) and meropenem (10 µg) were placed onto the surface of Muller Hinton agar with the help of disc dispenser and pressed slightly with sterile forceps for fixing. Then petri dishes incubated for 24 h at 37oC. After overnight incubation, diameter of zone of inhibition was measured.   

Statistical analysis
 
All data was tabulated in Microsoft Excel spreadsheets and analyzed by JMP® Statistical Package Software. Chi-square test was applied to calculate the association of risk factors with prevalence of C. perfringens.
Overall prevalence of C. perfringens
 
As shown in Table 1, from 100 feacal samples C. perfringens was identified in 48 samples, while 52 samples were found negative. The prevalence of C. perfringens was found significantly higher (p<0.01) in sheep (60%) as compared to goats (36%). The confirmation of positive samples was done by amplification of 324 bp fragment of CPA gene using PCR (Fig 1). 
 

Table 1: The overall prevalence of C. perfringens in goats and sheep of district Kalat.


 

Fig 1: Molecular identification of C. perfringens isolates.


 
Prevalence of C. perfringens in goats
 
The results presented in Table 2 exhibited a highest prevalence in Kalat (50%) followed by the Mangochar (38.46%), Johan (30.77%) and Gazg (25%). The statistical analysis revealed the significant differences (p<0.05; 95% confidence interval (CI) 18.808-68.913) in C. perfringens prevalence in various areas of Kalat district. The results of the gender-wise prevalence of C. perfringens exhibited a numerically higher (p>0.05; 95% CI 9.228-49.023) prevalence in females’ goats (40%) than male goats (32%). All the specimens were collected from dissimilar age groups of goats and categorized as <1 year, >1 but <2 years and ≥2 year. The age-wise analysis indicated that, in <1 year age group (44.44%), the prevalence of C. perfringens was higher (p<0.05; 95% CI 8.002-57.888) than >1 but <2 years (29.41%) and ≥ 2-year (33.33%) age groups.
 

Table 2: The prevalence of C. perfringens in goats in district Kalat.


 
Prevalence of C. perfringens in sheep
 
As shown in Table 3, the highest prevalence was found in Kalat (76.92%) followed by Mangochar (66.67%), Johan (58.33%) and Gazg (38.46%). The statistical analysis revealed the significant difference (p<0.014; 95% CI 19.009-93.092) in C. perfringens prevalence in various areas of Kalat district. Similarly, the age wise analysis indicated that, in <1 year age group (68.18%), the prevalence of C. perfringens was higher (p<0.05; 95% CI 29.514-82.467) than >1 but <2 years (62.50%) and ≥2-year (41.67%) age groups. However, the results regarding gender-wise prevalence of C. perfringens exhibited a numerically higher (p>0.05; 95% CI 38.038-83.594) prevalence in female (72%) as compared to male (48%) sheep.
 

Table 3: The prevalence of C. perfringens in sheep in district Kalat.


 
Antibiogram of C. perfringens isolates
 
As shown in Table 4, among 30 sheep isolates of C. perfringens, a highest number (28 isolates) showed resistance against amikacin, followed by amoxicillin/penicillin (25 isolates) and colistin sulphate (22 isolates). Whereas, among 18 isolates of goat a highest number (17 isolates) found resistant against colistin sulphate, followed by amoxicillin/amikacin (16 isolates) and penicillin (13 isolates). All the isolates (100%) of sheep and goat origin found susceptible to ceftazidime.
 

Table 4: The antibiogram of C. perfringens isolated from goats and sheep of district Kalat.*


       
In current investigation, the overall prevalence of C. perfringens was detected as 48%; with comparatively higher incidence in sheep (60%) as compared to goats (36%). A total of 48 isolates (30 sheep and 18 goat) were confirmed using biochemical characterization from 48 positive colonies.  Similar results of C. perfringens prevalence have been reported by Taj et al., (2018), who reported 34.4% prevalence in goats and 54.78% in sheep in different areas of Balochistan. In another study, Rahimoon et al., (2020) examined 100 samples, collected from small ruminants, out of which 45 samples were found positive for C. perfringens. In contrast, Ajaz-ul-Haq et al., (2016) reported 66.5% incidence of C. perfringens in goats and sheep of district Khuzdar Balochistan. This high prevalence percentage of the organism may be due to environmental conditions, vaccination status and management (Shehzadi et al., 2021). In current investigation, we also used polymerase chain reaction assay to confirm the isolates of C. perfringens by amplifying the 324bp fragment of CPA (alpha toxin gene) as suggested in literature (Alsaab et al., 2021).
       
Our study showed the area-wise differences (25 to 50% in goats and 38.46 to 76.92% in sheep) in the prevalence of C. perfringens in small ruminants in Kalat district. Similar results have been reported by Rahimoon et al., (2020) who reported the 11.11 to 44.44% prevalence of C. perfringens in goats of different areas of district Tharparkar. The authors postulated that occurrence rates of enterotoxaemia in different geographical locations might be due to improper vaccination schedule against enterotoxaemia, geographical differences and/or difference in breeds used in study. Earlier studies have reported the breed-wise differences in farm animals for susceptibility against infectious diseases (Mangi et al., 2015).
       
Gender wise prevalence of C. perfringens in goats and sheep exhibited the high prevalence in females as compared to males. These results reveled that females are at high risk then males. Our results are in agreement with the results of Ajaz-ul-Haq et al., (2016) who observed that 38% females are positive with C. perfringens, as compared to males 28.5%. Previous published literature have also demonstrated that females are comparatively more susceptible to chronic as well as acute microbial infections as compared to male animals (Malhi et al., 2020).
       
The current investigation demonstrated the high incidence of C. perfringens in small ruminants of less than 1 year age group, which are in aggrement with the results of Ajaz-ul-Haq et al., (2016), who reported 18.5% prevalence of C. perfringens in age group of 6 months to 1 year as compared to adult small ruminants (7.5%). In another study, Nazki et al., (2017), reported high prevalence of C. perfringens in lambs (56.16%) and kids (46.16%) than adult goat and sheep (3.84%). The authors described that high prevalence rate of C. perfringens in young animals is probably due to heavy feeding of lambs and kids on lush pastures in addition to milking by their mothers; they also detected higher incidence in adult small ruminants grazed on luxurious pastures (Nazki et al., 2017).
               
 In this study antibiogram of the isolated organisms from small ruminants was conducted by disk diffusion method. The obtained results revealed that C. perfringens isolates of both sheep and goat origin exhibited 100% susceptibility against ceftazidime (a third generation cephalosporin) which is also in accordance with study of Mohiuddin et al., (2020) who reported 100% inhibition of  C. perfringens isolates against a third generation cephalosporin viz., ceftiofur. Our results revealed trimethoprim as a second most susceptible antibiotic against C. perfringens isolates. In contrary, the study of Haider et al., (2022) reported the little efficacy of trimethoprim against C. perfringens isolates of poultry. This might be due to the frequent use of this antibiotic in poultry production to get utmost production (Mohsin et al., 2019). Our results are also in agreement with the study of Elariny et al., (2021), who reported the resistant behavior of C. perfringens against oxytetracycline (87.5%), amoxicillin (83.4%), ampicillin and erythromycin (75%).
In conclusion, enterotoxaemia causing bacterium viz., C. perfringens is prevalent in goats and sheep of district Kalat, Balochistan. Sheep were more affected than goats, the female animals were at high risk than males. Moreover, higher prevalence of C. perfringens was detected in <1 year age group. This study will be help full in designing the large-scale epidemiological studies and vaccination programs for control of the disease particularly in the study area.
The authors extend their appreciation to the Researchers Supporting Project number (RSPD2024R1111), King Saud University, Riyadh, Saudi Arabia. The authors thank the farmers for their cooperation in sampling.
This research was funded by the Researchers Supporting Project number (RSPD2024R1111), King Saud University, Riyadh, Saudi Arabia.
The authors declared no conflict of interest.

  1. Ajaz-ul-Haq, M.K.T., Taj, I., Arif, S., Ahmed, A., Muhammad, G., Ahmed, Z., Ahmed, Z., Abbas, F. and Samad, A. (2016). Isolation of Clostridium perfringens from goats and sheep of the Khuzdar district of Balochistan, Pakistan. International Journal of Biosciences. 9(5): 156-162.

  2. Alsaab, F., Wahdan, A. and Saeed, E.M. (2021). Phenotypic detection and genotyping of Clostridium perfringens associated with enterotoxemia in sheep in the Qassim Region of Saudi Arabia. Veterinary World. 14(3): 578-584.

  3. Babar, W., Iqbal, Z., Khan, M. N. and Muhammad, G. (2012). An Inventory of the Plants Used for Parasitic Ailments of Animals. Pakistan Veterinary Journal. 32(2): 183-187.

  4. Chai, T., Ma, R., Chang, W. and Zhang, S. (2001). Spread and pathogenic mechanism of Clostridium perfringens. Chinese Journal of Preventive Veterinary Medicine. 1: 70-72.

  5. Chandran, D., Naidu, S.S., Sugumar, P., Rani, G.S., Vijayan, S.P., Mathur, D., Lalit, C. Garg and Srinivasan, V.A. (2010). Development of a recombinant epsilon toxoid vaccine against enterotoxemia and its use as a combination vaccine with live attenuated sheep pox virus against enterotoxemia and sheep pox. Clinical and Vaccine Immunology. 17(6): 1013-1016.

  6. CLSI Guidelines (2017). Clinical and Laboratory Standards Institute.

  7. Standards Development Policies and Process. Annapolis Junction, Maryland, USA.

  8. Elariny E.Y.T., Ahmed H.A., Khatab, A.A.H. and Mohamed, R.E. (2021). Genotyping, antibiotic resistance and biofilm formation ability of Clostridium perfringens isolated from raw milk, dairy products and human consumers. Journal of Animal Health and Production. 9(s1): 34-41.

  9. El-Bayomi, R.M., El-Mesalamy, Y.M., Hafez, A.E. and Ahmed, H.A. (2020). Prevalence of Clostridium perfringens in retail meat and meat products with some decontamination trials by some essential oils. Journal of Animal Health and Production. 9(s1): 61-68.

  10. Fayez, M.M., Al Musallam, A., Al Marzoog, A. and Suleiman, M.B. (2013). Prevalence and toxinotyping of the toxigenic Clostridium perfringens in sheep with suspected Enterotoxemia. Natural Sciences. 11(8): 15-21. 

  11. Haider, Z., Ali, T., Ullah, A., Basit, A., Tahir, H., Tariq, H., Ilyas, S.Z., Hayat, Z., Rehman, S.U. (2022). Isolation, toxinotyping and antimicrobial susceptibility testing of Clostridium perfringens isolated from Pakistan poultry. Anaerobe. 73: 102499.

  12. Malhi, K.K., Kamboh, A.A., Kumar, C., Dewani, P., Kumar, M., Abro, S.H., Leghari, Ambreen, Wang, X. and Yu, S. (2020). Prevalence of bovine tuberculosis in buffaloes in Hyderabad and TandoAllahyar districts of Sindh, Pakistan. Indian Journal of Animal Research. 54(1): 101-105. doi: 10.188 05/ijar.B-931.

  13. Mangi, M.H., Kamboh, A.A., Rind, R., Dewani, P., Nizamani, Z.A., Mangi, A.R., Nizamani, A.R. and Vistro, W.A. (2015). Seroprevalence of brucellosis in Holstein-Friesian and indigenous cattle breeds of Sindh Province. Pakistan. Journal Animal Health Production. 3(4): 82-87.

  14. Milton, A.A.P., Agarwal, R.K., Priya, G.B., Saminathan, M., Aravind, M., Reddy, A., Athira, C., Ramees, T., Sharma, A.K. and Kumar, A. (2017). Prevalence and molecular typing of Clostridium perfringens in captive wildlife in India. Anaerobe. 44: 55-57.

  15. Mohiuddin, M., Iqbal, Z., Siddique, A., Liao, S., Salamat, M.K.F., Qi, N., Din, A.M. and Sun, M. (2020). Prevalence, genotypic and phenotypic characterization and antibiotic resistance profile of Clostridium perfringens type A and D isolated from feces of sheep (Ovis aries) and goats (Capra hircus) in Punjab, Pakistan. Toxins. 12(10): p.657.

  16. Mohsin, M., Van Boeckel, T.P., Saleemi, M.K., Umair, M., Naseem, M.N., He, C., Khan, A. and Laxminarayan, R. (2019). Excessive use of medically important antimicrobials in food animals in Pakistan: A five-year surveillance survey. Global Health Action. 12(sup 1): p.1697541.

  17. Musawa, A.I., Bashiru, G., Al-Rasheed, A., Yakubu, Y., Jibril, A.H., Ballah, F.M., Sidi, S., Lawal, N., Bala, J.A., Odhah, M.N., Muhammad, N. and Umar, M. (2021). Prevalence and antimicrobial susceptibility profiling of salmonella isolated from poultry products sold in Sokoto metropolis, Nigeria. Journal of Animal Health and Production. 9(2): 148-155.    

  18. Nazki, S., Wani, S.A., Parveen, R., Ahangar, S.A., Kashoo, Z.A., Hamid, S., Dar, Z.A., Dar, T.A. and Dar, P.A. (2017). Isolation, molecular characterization and prevalence of Clostridium perfringens in sheep and goats of Kashmir Himalayas, India. Veterinary World. 10(12): 1501-1507.

  19. Park, C.S., Hwang, J.Y. and Cho, G.J. (2019). The first identification and antibiogram of Clostridium perfringens type C isolated from soil and the feces of dead foals in South Korea. Animals. 9(8): 579-586.

  20. Rahimoon, M.M., Zaman, J.K., Babar, A., Mirani, A.H. and Kalhoro, N.H. (2020). Prevalence of enterotoxemia and antibiogram of Clostridium perfringens isolated from diarrheic goat in the vicinity of district Tharparkar, Sindh, Pakistan. Pure and Applied Biology. 10(2): 408-415. 

  21. Shehzadi, S., Khan, S.B., Sadique, U. and Nawaz, S. (2021). Isolation and molecular identification of Clostridium perfringens type D in goats in district Peshawar. Sarhad Journal of Agriculture. 37(1): 110-114. 

  22. Singh, D.D., Pawaiya, R.V.S., Gururaj, K., Gangwar, N.K., Mishra, A.K., Singh, R., Andani, D. and Kumar, A. (2018). Detection of Clostridium perfringens toxinotypes, enteropathogenic E. coli, Rota and corona viruses in the intestine of neonatal goat kids by molecular techniques. Indian Journal of Animal Sciences. 88(6): 655-661.

  23. Taj, I., Abbas, F., Ahmad, Z., Taj, M.K., Shahzad, F., Haq, A.U., Ahmed, Z., Mohammad, G., Ahmad, D. and Azam, S. (2018). Detection and Characterization of Clostridium perfringens Serotype D from Small Ruminants of Balochistan. Pakistan Journal of Zoology. 50(6): 1-4.

  24. Talukdar, P.K., Udompijitkul, P., Hossain, A. and Sarker, M.R. (2017). Inactivation strategies for Clostridium perfringens spores and vegetative cells. Applied and Environmental Microbiology. 83: 1-13.

  25. Uzal, F.A., Giannitti, F., Finnie, J.W. and García, J.P. (2016). Diseases produced by Clostridium perfringens type D. Clostridial Diseases of Animals; Wiley Blackwell: Ames, IA, USA, 157-172. 

  26. Wang, G., Zhou, J., Zheng, F., Lin, G., Cao, X., Gong, X. and Qiu, C. (2011). Detection of different genotypes of Clostridium perfringens in feces of healthy dairy cattle from China using real-time duplex PCR assay. Pakistan Veterinary Journal. 31(2): 120-124.
In this Article
Published In
Indian Journal of Animal Research

Editorial Board

View all (0)