Feline trypanosomiasis is an uncommon but clinically significant disease caused mainly by
Trypanosoma evansi, which is mechanically transmitted by haempatophagous flies and affects a broad range of domestic and wild mammals across the tropics and subtropics
(Desquesnes et al., 2022). Surra is well known in camels, equids and dogs in India, but naturally occurring cat sickness has been infrequently described, resulting in diagnostic delays and under-recognition
(Kyari et al., 2021; Shoraba et al., 2024). Recent reports from India and elsewhere had described infected cats presenting with nonspecific signs, such as pyrexia, anaemia, periocular oedema, conjunctivitis and neurological disorders, often at low parasitaemia, where microscopy can miss infections
(More et al., 2017; Rathod et al., 2023). Frequent surra cases have been reported from India, including Gujarat, from camel and equine (
Pathak and Chhabra, 2011). However, a molecular confirmation case of feline trypanosomiasis in the country is infrequent
(Rjeibi et al., 2015; Kolangath et al., 2023;
Priyowidodo et al., 2023; Agrawal et al., 2024). The present study was conducted on a cat with clinical signs suggestive of feline trypanosomiasis in Gujarat, India and confirmation was made.
A one-year-old male cat was presented to the Veterinary Clinical Complex, Anand, Gujarat, India, in July, 2025, with a history of bilateral corneal opacity. The routine eye check-up was performed and the cat was treated with tobramycin eye instillations. The owner advised re-examination after one week. The cat again presented to the clinic with increased corneal opacity, epistaxis and vomiting (Fig 1A). The body condition was poor with cachexia, rough hair coat and neurological signs
viz. paresis and head tilt. Rectal temperature was 101°F. Blood was collected for haematological examination and complete blood count revealed white blood cells 0.34×10
3/µl, red blood cells 5.12×10
3/µl, haemoglobin 9.6 gm/dl, packed cell volume 28.83%, platelets 176×10
3/µl, lymphocytes 59.3%, neutrophils 40.1% and monocytes 0.6%. Further, a blood smear examination with field stain showed the presence of
Trypanosoma organisms between the red blood cells (Fig 1B). Diminazene aceturate was given to the cat @ 3.5 mg/kg body weight deep intramuscularly for management of the condition, along with fluid therapy and supportive medications. Tom showed signs of recovery, became somewhat active and started taking food and water. However, the cat succumbed to the disease on third day post treatment.
DNA was isolated from the collected blood sample for detailed molecular investigation using DNeasy Blood and Tissue Kit (Cat#69504). The 18S rRNA target gene DNA was amplified by PCR using forward AACCTGGTTGATCCTGCCAGT and reverse TGATCCTTCTGCAGGTTCACCTAC primers. The PCR conditions used were as described by
Kumar et al. (2019): 10 minutes of initial denaturation at 94°C, 30 cycles at 94°C for 1 minute, 57°C for 1 minute and 72°C for 2 minutes and a final extension at 72°C for 10 minutes (Biometra thermocycler; Analytik Jena). The amplified product was run on a 1.5% agarose gel and visualised using a gel imaging system, showing a 2251 kb band (Fig 2). The PCR product was sequenced using Sanger sequencing (sequencing services provided by Europhins Genomics India Pvt. Ltd., Karnataka, India). Bioedit Sequence Alignment Editor (v.5.0.9) was used to edit and analyze the final sequence. The NCBI blast of the current study’s improved sequence (PX118514.1) revealed 99.88% similarity with T. evansi sequence (AB551922.1), which was isolated from a camel in Egypt. The phylogenetic analysis of the sample based on the 18S rRNA sequence is depicted in Fig 3.
A phylogenetic analysis based on the 18S rRNA sequences of these organisms was constructed using the Maximum Likelihood method in the MEGA XII program and the bootstrap analysis with 1000 replications to estimate the confidence in the branching pattern of the tree. The phylogenetic analysis showed that the sequence isolate of
T. evansi of cat from the present study (PX118514.1) is closely associated with KY114579.1 and AB551919.1 sequences of
T. evansi isolated from India and Egypt, respectively.
Trypanosomiasis in cats is a rarely documented disease in India and other countries (
Sivajothi and Reddy, 2017;
Rathod et al., 2023). The clinical features observed,
viz., corneal opacity, epistaxis, neurological involvement, weight loss and cachexia, were in consistent with the spectrum of signs previously described in feline trypanosomiasis
(Rjeibi et al., 2015; Jyothi et al., 2026). Neurological signs in feline trypanosomiasis mainly develops when it affects central nervous system or causes severe systemic disturbances that secondarily impair the brain function. In earlier reports, ocular manifestations, particularly corneal opacity, had been emphasised as an essential feature of feline
T. evansi infection (
Tarello, 2015;
Mohammed et al., 2022). These eye changes are caused by immune responses and irritation induced by moving parasites, resulting from long-term exposure to these parasites and leading to corneal injury and eventual loss of vision
(Desquesnes et al., 2022).
Haematological findings in the present case revealed leukopenia and thrombocytopenia, which agrees with the earlier conclusions reported in
T. evansi infected animals
(Rathod et al., 2023). The reduced leukocyte count may be due to parasitic induced immunosuppression and prolonged infection
(Goodwin et al., 1972). The findings highlight the systemic nature of the disease, which often progresses and is challenging to recognise in the early stage.
In the present study, molecular confirmation for
T. evansi was carried out, which is advantageous over conventional microscopy due to the detection of low levels of parasitic load (
Cattand and de Raadt, 1991;
More et al., 2017). The blast result of the edited product showed 99.88% similarity to AB551922.1 sequence isolated in Egypt from a camel. This may be due to the parasite’s broad host adaptability and potential interspecific transmission among domestic animals in the endemic region. Similar molecular confirmation reports from Indonesia and Iraq had demonstrated the utility of molecular diagnosis for trypanosomiasis
(Mohammed et al., 2022; Priyowidodo et al., 2023). The age of tom in the present study was only one year, which is in contrast to the previously reported cases (
Sivajothi and Reddy, 2017;
Rathod et al., 2023). The reason for affection in a young age might be an immature immune system and potential nutritional stress
(Desquesnes et al., 2022). Cats in rural or livestock associated environments may be predisposed to trypanosomiasis because of increased exposure to infected reservoir hosts and biting fly vectors responsible for mechanical transmission of
Tryapanosoma spp.
Cat showed improvement after the treatment with diminazene aceturate @ 3.5 mg/kg body weight. However, death occurred within three days, indicating either advanced disease or inadequate therapeutic response. Previous reports suggest variable outcomes in cats, with some responding favourably to therapy while others succumb despite treatment (
Tarello, 2015;
Sivajothi and Reddy, 2017). The death of cat in present study might be due to lower hemoglobin value or poor body condition. The limited efficacy of available trypanocidal drugs in feline cases underscores the need for optimised treatment protocols, dose adjustments and supportive care. Furthermore, drug resistance to diminazene aceturate used in the study for
T. evansi remains a concern in endemic regions and future studies should investigate feline-specific pharmacokinetics and treatment strategies (
Ungogo and de Koning, 2024).
Surra is endemic in livestock and cats may serve as incidental hosts or potential reservoirs
(Gurtler et al., 2007). Although their exact epidemiological role remains unclear, cases such as this raise the possibility of overlooked feline infections contributing to parasite maintenance in endemic zones
(Gurtler et al., 2007). Strengthening surveillance and incorporating molecular diagnostics into routine veterinary practice will facilitate early detection and improve case management. Earlier, trypanosomosis had been reported in camels and equines from Gujarat. But the case is critical because it is the first molecularly confirmed report in a cat from Gujarat.
