Buxtonella sulcata is a ciliated protozoan parasite that belongs to the family Pycnotrichidae within the genus Buxtonella Kalkal et al. (2024). It primarily infects the gastrointestinal tract of ruminants, especially cattle and buffaloes. This infection results in diarrhoea, weight loss and decreased productivity in affected animals, which ultimately leads to economic losses in the livestock sector (Patel et al., 2019). An opportunistic protozoan parasite, it inhabits the alimentary canal of ruminants, notably in the “caecum and colon” across the globe (Huang et al., 2014; Kumar et al., 2017). Cattle act as the reservoir for this pathogen. Cattle are the reservoir for this pathogen. Its structure closely resembles that of Balantidium coli (B. coli), which is found in both humans and pigs. The life cycle of B. sulcata includes an intestinal cyst stage and a trophozoite stage. The life cycle consists of two main phases: the trophozoite stage, where the organism actively feeds and reproduces in the host’s large intestine and the cyst stage, which is the environmentally resistant form that is excreted in faeces. Upon reaching the small intestine post-ingestion, the cyst is triggered by the intestinal pH and proteases, subsequently releasing trophozoites that invade and settle in the colon wall, causing cytotoxic effects that result in diarrhoea (El-Ashram et al., 2015).
       
In serious situations, extended diarrhoea can cause imbalances in electrolytes, metabolic acidosis and secondary bacterial infections, potentially deteriorating the animal’s health status (Kumar et al., 2020). The distribution of B. sulcata is influenced by geographic factors and seasonal shifts, showing higher infection rates during humid and monsoon periods that aid in the parasite’s persistence and transmission (Patel et al., 2019). A research study in Gujarat, India, revealed that 23.15% of Gir cattle and 16.18% of Jaffrabadi buffaloes were infected with B. sulcata, with a notable rise in cases during the rainy season (Patel et al., 2019). Similarly, in Karnal, Haryana, a study reported 63.7% prevalence rate among buffaloes, with 83.33% of diarrheic animals testing positive for the parasite, highlighting its potential role in enteric diseases (Sharma et al., 2020). B. sulcata infection can have a major impact on herd health, particularly in high-density farming systems where the rates of transmission are higher.
       
The diagnosis of B. sulcata infection primarily relies on the microscopic analysis of faecal samples to identify cysts and trophozoites. Common identification techniques include direct smear, sedimentation and flotation methods. Molecular techniques such as polymerase chain reaction (PCR) offer a more sensitive and specific diagnostic approach for confirming infections (Sharma et al., 2021). This investigation intends to analyze the prevalence of B. sulcata infection in cattle groups within the Western Uttar Pradesh.

The ongoing research took place in the Western area of Uttar Pradesh, celebrated for its lush alluvial plains, significant livestock density and subtropical climate. The epidemiological study was conducted from July 2024 to June 2025 in the locations of Meerut, Ghaziabad, Moradabad, Rampur, Gautam Buddha Nagar, Saharanpur and Amroha.
 
Sample collection
 
Around 5 grams of faecal samples were aseptically gathered from the rectum of each animal, placed in appropriately labelled plastic containers and transported to the laboratory for microscopy and molecular analysis. In total, 398 faecal samples were collected, comprising 60 from Meerut, 55 from Ghaziabad, 58 from Moradabad, 30 from Rampur, 102 from Gautam Buddha Nagar, 60 from Saharanpur and 33 from Amroha. During the sample collection, the age, diarrhoeic condition and sex of cattle was recorded. In the analysis of 398 samples, 108 were identified as diarrhoeic, compared to 270 that were non-diarrhoeic. In the course of sample collection, the cattle were sorted into two age groups: young (<3 years) and adults (>3 years). A total of 128 samples were gathered from young animals, while 270 from adult animals. Of the samples collected, 124 were male and 274 were female.
 
Microscopic examination of faecal samples
 
To screen for B. sulcata infection in cattle, the direct faecal wet smears method was employed. A small quantity of faecal material was applied to a clean, grease-free glass slide and then a few drops of tap water were added. A smear was then prepared and examined under the microscope (10X/40X). The identification of enteric protozoan trophozoites and cysts was based on their morphological characteristics as outlined by Soulsby (1982).
 
DNA extraction
 
The DNA was isolated by QIAamp Fast DNA Stool Mini Kit (Qiagen, Germany), adhering to the manufacturer’s guidelines with slight modifications, from feces. The isolated DNA was preserved at -20°C for subsequent use.
 
Polymerase chain reaction
 
Primers designed to amplify a partial segment of the 18S rRNA gene from B. sulcata yield a product size of 1047 bp. These primers were produced by BR Biochem Life Sciences Pvt. Ltd, based in New Delhi. The forward and reverse primers utilized are 5’CGCAAATCGCGATTTTGTC GCG-3’ and 5’AAATACATAGTCCCTCTAAGAAGTC3’, respectively, for B. sulcata (Pomajbikova et al., 2013).
       
PCR was performed in an Applied Biosystems (United States). The reaction mixture was prepared a volume of 25 µl, containing 12.5 µl of master mix (BR Biochem), 1 µl each primer at a concentration of 10pmol, 3µl of DNA template and 7.5 µl of nuclease-free water. The initial denaturation done at 94°C for 10 minutes, followed by denaturation at 94°C for 1 minute, annealing at 59°C for 1 minute and extension at 72°C for 1 minute, repeated for 35 cycles and concluding with a final extension at 72°C for 5 minutes. To visualize the PCR products, 7 µl of the PCR end products and 9 µl of a 100 bp plus ladder (BR Biochem) were loaded onto a 1.25% agarose gel (Bio-Rad, Japan) and ethidium bromide (0.5 µg/ml from a 10 mg/ml stock solution). The gel was subjected to horizontal gel electrophoresis at 90V for 60 minutes (Bio-Rad, Japan). The resulting resolution pattern was analyzed and an image was captured using the Bio-print (Vilber, France).
 
Statistical analysis
 
Using SPSS software, the chi-square test was employed to analyze the data. A p-value below 0.05 suggests a statistically significant correlation between the two categorical variables (Snedecor and Cochran, 1994).

Fig 1 depicts the morphological analysis and essential characteristics of B. sulcata, which are mainly seen in a cyst form that typically has a circular diameter between 60 and 68 mµ. Conversely, the trophozoites are generally ovoid and show a size range of about 84 to 127 mµ by 68 to 84 mµ, surrounded by numerous cilia and possess both micro and macronuclei, an anterior cytostome, along with several nutritional food vacuoles in the cytoplasm.


       
A sum of 398 faecal samples was gathered from seven districts within western Uttar Pradesh, India. Among these samples, 33.41% tested positive for B. sulcata through microscopic examination, while 35.92% were confirmed positive using the PCR method (Table 1). The PCR technique exhibited a higher rate of positive results than the microscopic examination, implying that the PCR method is more trustworthy. Earlier research has reported comparable prevalence rates, such as 30.15% in cattle from various areas in El-Minia Province, Egypt (El-Ashram et al., 2015). In contrast, buffaloes in the Hisar district of Haryana, India exhibited a higher prevalence of 54.5% (Kalkal and Sangwan, 2020).


       
Microscopic analysis revealed that Saharanpur had the highest prevalence at 38.30%, followed closely by Moradabad at 37.90%, Rampur at 36.70%, Gautam Buddha Nagar at 36.27%, Meerut at 28.30%, Amroha at 27.30% and Ghaziabad with the lowest prevalence at 25.50%. Conversely, the PCR technique revealed that the highest prevalence of B. sulcata infection was in Saharanpur district at 43.33%, followed by Rampur at 40.00%, Moradabad at 39.65%, Gautam Buddha Nagar at 38.23%, Amroha at 30.30%, Meerut at 30.00% and the lowest in Ghaziabad at 27.27%. There was no variation among the districts in the chi-square test (Table 2). This implies that despite a noticeable numerical variation, the infection is distributed relatively uniformly throughout the districts that were examined. This uniformity may be a result of the largely similar agro-climatic conditions in Western Uttar Pradesh and the comparable agricultural practices in these regions. Bhanot et al., (2022) also reported the overall prevalence of B. sulcata in Haryana, with the highest occurrence noted in Rohtak (33.8%), followed by Bhiwani (29.4%) and Ambala (15.5%), whereas the lowest was found in Sirsa (6.09%) and Mahendergarh (3.71%).


       
Based on the analysis of faecal consistency from 398 samples, 108 were identified as diarrhoeic while 290 were classified as non-diarrhoeic. The incidence of B. sulcata infection was significantly elevated (p<0.0001) in diarrhoeic cattle relative to their non-diarrhoeic counterparts. Specifically, 50% of the diarrhoeic cases tested positive for B. sulcata through microscopic examination, whereas the PCR method revealed a positivity rate of 51.85% among faecal samples. In the non-diarrhoeic group, 27.24% of samples were positive for B. sulcata via microscopic examination and 30.00% were positive according to the PCR method (Table 3). This supports the increasing acknowledgment that B. sulcata, once regarded merely as a commensal organism, can behave as an opportunistic pathogen in situations of compromised gut health. The organism may either directly induce diarrhoea by damaging the colonic mucosa or may proliferate as a result of dysbiosis triggered by other infections. In buffaloes from the Karnal district, those with diarrhoea exhibited an 83.33% higher association with B. sulcata infection compared to those without diarrhoea, who had a 54.74% association, indicating a significant difference (Kalkal and Sangwan, 2020). In addition, Ganai et al., (2015) reported that bovines affected by diarrhoea had a markedly higher infection rate of 38.5% compared to those with normal faeces, which stood at 9.9%, with a significance level of p<0.0001. These outcomes are in agreement with the results of several other studies (Fox and Jacobs, 1986; Tomczuk et al., 2005; Al-Saffar et al., 2010; Al-Saffar et al., 2013).


       
Microscopic examination revealed that B. sulcata was more prevalent in young animals (< 3 years) at 40.62%, compared to adults (>3 years) at 30.0%. In contrast, the PCR method showed a prevalence of 42.96% in young animals and 32.59% in adults. Young cattle (<3 years) exhibited a significantly higher incidence of the infection compared to adults (> 3 years), with the chi-square test demonstrating statistical significance (p=0.047) (Table 4). This finding supports the hypothesis that immunological immaturity makes young cattle more susceptible. Furthermore, management practices such as group housing of calves and increased exposure to contaminated environments may enhance transmission. Ganai et al., (2015) highlighted a significantly greater prevalence in young once (33.1%) as opposed to adults (13.9%). Similarly, Omeragic and Crnkic (2015) reported that the infection rate among young animals was higher (33.1%) compared to that of adults (13.9%). The most significant prevalence (P<0.05) occurred in animals younger than 1 year at 17.54%, with the next highest being in those older than 5 years at 12.33% and the 1-5-year age group at 5.71% (Khan et al., 2024).


       
Among 398 animals, 124 were identified as male and 274 as female. The detection rate of B. sulcata in male animals was assessed at 37.09% using microscopic evaluation, while the PCR approach showed a prevalence of 39.51%. Microscopic analysis revealed a prevalence of 31.75% in female animals, while PCR testing indicated a prevalence of 34.30%. There was a slight increase in prevalence among male cattle in comparison to females, yet this was not statistically significant (p=0.351) (Table 5) and sex does not significantly affect the risk of infection. The minor difference noted may be attributed to management practices, as males are often utilized more for draught or transport and may receive lower quality feed and fodder, potentially leading to increased stress. Male buffaloes had an infection rate of 40%, which is higher than the 30% seen in females and there were no statistically significant differences between the two sexes (Al-Saffar et al., 2013). Moreover, Al-Zubaidi and Al-Mayah (2011) reported a somewhat elevated prevalence of Buxtonella infection in males at 43.6%, in contrast to 42.8% in females in Baghdad.


 
Detection of B. sulcata through molecular method
 
A comprehensive examination of 398 faecal samples from cattle was conducted to detect B. sulcata via PCR, which involved amplifying a partial sequence of the 18S rRNA gene with the published primers, yielding a band size of 1040 bp (Fig 2). Microscopic examination, though widely used in parasitological diagnosis, has inherent limitations such as low sensitivity in cases of light infection, observer bias and the possibility of missing morphologically similar organisms (Soulsby, 1982). Similar findings have been noted in diagnostic studies of other protozoan parasites, indicating that molecular techniques exceeded microscopy in recognizing subclinical or chronic infections (Khare et al., 2019; Singh et al., 2021). This research illustrates that PCR is a more dependable and sensitive method than faecal smear analysis for diagnosing B. sulcata. However, considering resource-limited field conditions, faecal smear still holds significance as a rapid and cost-effective screening tool, while PCR can serve as a confirmatory diagnostic method for prevention and control of B. sulcata at field level.

The study revealed a notable presence of B. sulcata in cattle across Western Uttar Pradesh, with a positivity rate of 33.41% detected by microscopy and 35.92% through PCR. The rate of infection was markedly increased in young cattle and those suffering from diarrhoea. PCR revealed higher sensitivity relative to microscopy, stressing the requirement for ongoing screening and enhanced management strategies to ensure effective control.

The authors convey their deep appreciation to the Hon’ble Vice Chancellor of Sardar Vallabhbhai Patel University of Agriculture and Technology, Meerut, for providing the vital facilities necessary for this research. They also wish to acknowledge the dairy owners and farmers for their cooperation and support during the collection of faecal samples.
 
Disclaimers
 
The views and conclusions expressed in this article are solely those of the authors and do not necessarily represent the views of their affiliated institutions. The authors are responsible for the accuracy and completeness of the information provided, but do not accept any liability for any direct or indirect losses resulting from the use of this content.

Informed consent
 
All animal procedures for experiments were approved by the Institutional Animal Ethics Committee, SVPUAT, Meerut (IAEC/SVPUAT/2025/168).

The authors declare that there are no conflicts of interest regarding the publication of this article. No funding or sponsorship influenced the design of the study, data collection, analysis, decision to publish, or preparation of the manuscript.