Assessment of Adverse Effects of Lead, Nickel and Cadmium on Biochemical Parameters, Antioxidants Status and Metallothionein Expression in Buffaloes Slaughtered at Local Abattoir

Industrialization has led to environmental pollution that causes release of toxic heavy metals from the industries entering the ecosystem leading to geo-accumulation, bioaccumulation and biomagnification. The term heavy metals have been widely used as a group name for metals and metalloids that have been associated with contamination and potential toxicity or ecotoxicity. Decomposition of urban and industrial waste, leaks and accidental spills of pollutants causes heavy metals to enter the human/animal system through the food chain (Singh et al., 2010). There is a wide prevalence of heavy metals in soil, plants, dairy feed, blood and hair of animals (Rashed and Soltan, 2005; Golia et al., 2008; Hundal et al., 2006).
       
Lead is an abundant mineral with a worldwide distribution. It poses threat to animal health and is accumulated in the environment by industrial pollution (Patra et al., 2006; Patra et al., 2007; Swarup et al., 2007). Lead when accumulated in the tissues results into poison and gets stored in different parts of the body especially in bones, liver, kidney and brain. Besides, direct ingestion of Pb leads to increased blood Pb levels, accumulated Pb in the body also acts as a significant source of blood Pb burden (Swarup et al., 2005).
       
Cadmium is the seventh most toxic heavy metal according to ATSDR (2001) ranking. The higher concentrations of hexavalent Cd in blood may cause bloodcell damage leading to functional damage of liver and kidney (Dartsch et al., 1998; Patra et al., 2006; Swarup et al., 2007). Nickel (Ni) is an important essential trace element for proper functioning of the immune system for many animal species (Samal and Mishra 2011). The toxic exposure of nickel through contaminated fodder and water leads to dermatitis, allergy of skin and oral epithelium damage (Jacob et al., 2015).
       
Heavy metals, at cellular level, leads to production of reactive oxygen metabolites, elicit oxidative stress, affect cell membrane functions, nutrient assimilation and disturb protein function/activity (Tamas et al., 2014). Antioxidant defense has an important role in the protection of organisms against metal induced oxidative stress. Living systems most often interact with a cocktail of heavy metals in the environment, which may disrupt the metabolism of trace elements, and antioxidants in the cattle (Arslan et al., 2011).

Their overloaded level in tissues may also affect glycolysis, protein and lipid profile (Javed et al., 2017) which in turn may induce damage to blood composition, kidneys, lungs, liver and reduction in energy levels (Hajeb et al., 2014).
       
Heavy metal exposure causes alteration in the expression of antioxidant enzymes and metal binding proteins, metallothioneins (MTs). MTs are, ubiquitous, intracellular low molecular weight cysteine-rich proteins which are characterized by their high affinity for d10 electron configuration metals, including essential (Zn and Cu) and non-essential (Cd and Hg) trace elements (Margoshes et al., 1957). MTs have four isoforms MT-1 to MT-4, in which, MT-2 are expressed in many tissues, particularly kidney, liver, pancreas and intestine (Wu et al., 2007). For mammals, MTs binds to zinc (Kagi, 1991) or with excess copper or cadmium, where zinc can be replaced easily by these other metals (Shaw et al., 1991). Because of their rich thiol contents, MTs bind a number of trace metals including cadmium, mercury, platinum and silver and protect cells and tissues against heavy metal toxicity. The present study has been planned to assess the level of heavy metals, antioxidants, metabolic profile and MTs in blood and tissues with the impetus to assess the damage caused by heavy metals. 

The blood and tissue samples were collected from local buffalo abattoir. For RNA isolation, samples were collected in Tri-Reagent BD and stored at -80°C till further processing.
 
Processing of samples
 
Separation of plasma
 
Blood samples from slaughtered buffaloes were collected in sterile tubes containing anticoagulant (heparin). The blood samples were centrifuged at 3000 rpm, for 30 min at room temperature to obtain plasma. The plasma samples were stored in aliquots in vial free from any mineral at -20°C.
 
Preparation of 10% RBC hemolysate
 
Freshly, collected heparinized blood samples after separation of plasma, sediment cells were washed with 0.9% NaCl solution. This process was repeated three times then the erythrocytes obtained after washing were hemolyzed with 9-fold volume of distilled water to prepare 10% hemolysate.
       
Hemolysate was used to analyze reduced blood glutathione, superoxide dismutase (SOD), lipid peroxidation, catalase and glutathione peroxidase.
 
Lead (Pb), Nickel (Ni) and Cadmium (Cd) determination in the plasma
 
Glassware decontamination
 
All glassware used for the estimation of heavy metals (Pb, Ni, Cd) were washed in detergent, soaked overnight in chromic acid and rinsed several times with triple distilled water and dried in an oven. Blood plasma was digested in a conical flask after adding 5 ml triple acid (HNO₃, 70% HClO₄ and H₂SO₄ in 10:3:1, v/v) (Ludmila, 1976). The solution was covered and kept overnight at room temperature. The solution was then heated on hot plate until it becomes clear and about 0.5-1 ml of solution is left. It was then diluted with 10 ml of triple distilled water and used for estimation of heavy metals. The concentration of heavy metals was estimated by inductively coupled plasma optical emission spectrometer (Perkin Elmer, Optima 2100DV) by using specific standard operating conditions meant for specific mineral. All the determinations were performed in duplicates.
 
Antioxidants and biochemical parameters
       
Estimation of lipid peroxidation in erythrocytes was done by the reaction of thiobarbituric acid (TBA) with malonyldialdehyde (MDA) (Placer et al., 1996). The activity of superoxide dismutase (SOD), in blood was estimated by method based on principle that the nitro blue tetrazolium inhibits superoxide dismutase with reduced nicotinamide adenine dinucleotide (NADH) mediated by phenazonium methosulphate under aerobic conditions (Nishikimi et al., 1972). The  erythrocytic cell glutathione peroxidase (GPx) were measured by the method given by Hafeman et al., 1974. Erythrocytic catalase (CAT) activity were analysed according to the method given by Hugo (1984).
       
The blood biochemical profile (glucose, total protein [TP], albumin [ALB] and globulin), lipid profile (cholesterol and triglyceride) and liver and kidney function parameters (alanine aminotransferase [ALT], aspartate aminotransferase [AST], blood urea nitrogen [BUN] and creatinine) were determined by auto analyzer using kits (Erba Manheim).
 
Isolation of RNA
 
0.1% DEPC treated and properly sterilized laboratory wares was used to minimize ribonuclease activity during collection of samples and all other RNA works. Isolation of RNA from blood was done by standard protocol using “TRI Reagent BD (Sigma-Aldrich, USA). The optical density of nucleic acid (RNA) was measured in an ultraviolet light Nano drop spectrophotometer (Thermo, USA). For quantification of RNA concentration, the readings were taken at a wavelength of 260 nm and 280 nm. Pure preparations of RNA with OD260/OD280 ratio greater than 1.7 were selected for further studies (according to Sigma-Aldrich, USA guidelines).
       
After isolation of RNA, reverse transcriptase-polymerase chain reaction (RT-PCR) was done for synthesis of cDNA using MMLV Reverse transcriptase 1st-Strand cDNA Synthesis kit (Epicenter®). The cDNA was used immediately for real-time PCR or stored at -20°C for future use. INTEGRATED DNA TECHNOLOGIES (India) synthesized primers were used for qPCR. Simple PCR was run at different gradient temperature (60°C to 62°C) using specific MT2 primers. The oligonucleotide sequences for MT2 forward and reverse primers are 5'AAAGATTGCAA GTGCGCCTC 3' and 5' CACTTGTCCGAAGCCCCTTT 3' respectively. RPL4 was used as the reference gene (Nygard et al., 2007) and forward and reverse primer sequence were 5' TTGGAAACATGTGTCGTGGG 3' and 5' GCAGATGG CGTATCGCTTCT 3' respectively. qPCR was performed using aliquots of cDNA and KAPA SYBR FAST qPCR Master Mix (2X) kit. Each reaction was performed in a 25 µl reaction volume containing 200nM of each amplified primer and 1µg of cDNA. Expression of MT2 gene was compared with expression of RPL4 housekeeping gene along with negative control (NTC).
       
The reaction was run in duplicates and carried out in CFX96 Touch™ Real-Time PCR detection System (BIO-RAD®) using the following cycling protocol: 95°C-3 min; 40 cycles of 90°C-3 sec, 60°C-30 sec and 95°C-5 sec. A melting curve analysis was performed for each primer pair.
 
Statistical analysis
 
The data were analyzed using statistical package for social sciences (SPSS) software (version 16.0). Statistical comparison between means of different groups was carried out using independent t-tests. The result of real time PCR was then calculated using: ΔCt = Ct [Target]-Ct [Housekeeping] and ΔΔCt = (ΔExp.) - (ΔControl). The following formula 2^-ΔΔCt was used to calculate the fold change expression of MT2 gene. Those animals in which heavy metals were found to be within permissible range have been taken as control.

The heavy metals were estimated in the plasma of slaughtered buffaloes (n=50) by atomic absorption spectrophotometer (AAS). The blood plasma concentrations of lead, cadmium, nickel in the exposed buffaloes were 2.44±0.18, 0.48±0.03, 0.07±0.01 ppm respectively and were higher than the permissible limit (Puls, 1994) (Fig 1).
 

 
These heavy metals enter the animal body through feeding of the fodder cultivated on heavy metal rich soil and water and get accumulated in the system of buffaloes and other ruminants (Dash et al., 2019; Yeotikar et al., 2018). According to the study of Dhaliwal et al., (2016), cattle inhabiting Buddha nallah area of Ludhiana, Punjab (India) had high concentrations of Pb, Ni and Cd in blood which were comparable to the present study. Similar findings in buffaloes with heavy metals were reported by Dey et al., (1997), Swarup et al., (1993, 1997), Gowda et al., (2003), Somasundaram et al., (2005) and Dash et al., (2019) in different parts of India. The current research result was found to be in agreement with Dwivedi et al., (2001) and Sidhu et al., (1994). The above authors recorded varying degrees of Pb poisoning in cows and buffaloes near a Lead-Zinc smelter in Punjab, India. Somasundaram et al., (2005) recorded higher Pb, Cd and Cu serum concentrations in Jersey crossbred cattle in Coimbatore, India.
 
Oxidative stress parameters
 
The overall mean values for lipid peroxidation (MDA) in lead, cadmium, nickel exposed animals were significantly (p<0.05) higher compared to control non-exposed groups (Fig 2). Increased level of MDA in the blood might be due to high heavy metals (Pb, Ni, Cd) resulting in production of free radicals  thereby resulting in an increase in lipid peroxidation as reported by Rana et al., (2010a), Dhaliwal et al., (2016) and Yeotikar et al., (2018). Increased malondialdehyde observed in lead exposed buffaloes was in accordance with reports of El-Nekeety et al., (2009) who also observed same findings in lead exposed mice.
 

 
The level of oxidative stress in animal body can be assessed by free radical scavenging enzymes such as SOD, CAT and GST (endogenous antioxidants) in blood (Roy et al., 2013). The overall level of superoxide dismutase and catalase enzymes activity of Pb, Ni and Cd exposed groups were found to be significantly (p<0.05) higher in exposed group (Fig 2). The increase in blood SOD and catalase activity indicated cellular protective mechanism against enhanced production of superoxide radicals during heavy metal metabolism as reported by Yamanaka, (1991). Moreover, the increase in blood SOD activity observed might be due to their ability to protect the cellular DNA, proteins and cell membranes from oxidative stress. Since SOD catalyzes the dismutation of superoxide anion to H₂O₂, which is in turn the substrate of CAT, this fact could explain the observed increment in the activities of the two enzymes concurrently. This is because these enzymes have a protective role against oxygen free radical-induced damage to the body of animals, their induction can be understoodas an adaptive response to oxidative stress. SOD activity also reflected the intensity of the stress because of toxic action (Patlolla et al., 2009). Contrast to the current findings, few other studies reported significantly inhibition of the antioxidant enzyme activities in blood of exposed buffalo and cattle due to high heavy metals (Dhaliwal et al., 2016; Dash et al., 2019; Yeotikar et al., 2018).
 
The concentrations of GSH in the blood of buffaloes exposed to Pb, Ni and Cd were found to be 1.4885±0.231, 1.0949±0.215 and 1.0091±0.174 µg/ml respectively which were significantly lower (p<0.05) than the control group (2.5904±0.00896 µg/ml) as presented in Fig 2. However, the GPx activity in the blood of lead exposed, cadmium exposed and nickel exposed buffaloes were 37.1674±31.257, 38.9728±2.886 and 37.1674±3.257 U/mg respectively which were significantly (p<0.05)  higher than control non exposed group (Fig 2).
 
GSH functions by detoxifying various xenobiotic, scavenging free radicals and consequently converting it to its oxidized form GSSG. GPx may utilize GSH during its course of action. The decrease in the concentrations of GSH makes cells more proned to oxidative injuries (Kumar and Padhy, 2013; Yeotikar et al., 2018). The reduced GSH level noticed in Pb, Ni and Cd exposed blood in this study might be due tooxidative damage caused by free radical and binding of these metals to various intracellular sulfhydryl groups (Sinha et al., 2008; El-Nekeety et al., 2009). The increased blood GPx activity noted in this study might be compensatory up-regulation in response to increased oxidative stress due to  Pb, Ni and Cd exposure in the blood. The decreased level of GSH and the increased level of MDA were in agreement with previous studies in cattle blood (Dhaliwal et al., 2016; Yeotikar et al., 2018).
 
Plasma concentrations of vitamin C in Pb, Ni, Cd and control unexposed group of buffaloes were 0.64±0.024, 0.28±0.02, 0.46±0.03 and 1.2±0.03 mg/dl respectively (Table 1). The present finding exhibits significant (p<0.05) low levels of Vitamin C which might be due to defense mechanism during oxidative stress (Pathan et al., 2013; Joshi et al., 2013). The level of total immunoglobulin has been found to be decreased significantly (p<0.05) in exposed group as compared with control group (Table 1). The decreased total immunoglobulin observed in lead exposed buffaloes might be caused by disturbances in immune regulation of the rewrite as animals, abnormal function of white blood cells and loss of immune function due to heavy metal exposure. Chen et al., (2003) have reported similar findings previously.
 

 
Biochemical parameters
 
Biochemical parameters studied in the present study revealed significant (p<0.05) increase in glucose and cholesterol in buffaloes exposed to heavy metals (Table 1). Other parameters like total protein and albumin levels were significantly (p<0.05) low. Increased glucose and plasma cholesterol levels with a decrease in total protein and albumin concentrations and high exposure to different heavy metals like arsenic, cadmium and lead have also been reported in other studies conducted on ruminant and mice (El-Nekeety et al., 2009; Rana et al., 2010a; Mohajeri et al., 2014; Dash et al., 2019) which is in agreement with the current study. The reduced levels of total protein and albumin in buffaloes exposed to heavy metals might be due to effect of the heavy metals on protein biosynthesis and liver function which was also observed in fishes exposed to water loaded with heavy metals (Panigrahi et al., 2016; Javed et al., 2017). Liver dysfunction is accompanied by elevated level of serum hepatic marker enzymes which are indications for hepatic cell damage and loss of function of cell membrane in the liver. In heavy metals exposed group, liver function enzymes like alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) and kidney function tests like urea and creatinine were significantly (p<0.05) higher than control non exposed group (Table 1). It clearly suggests an hepatic and renal dysfunction in buffaloes with high blood metal levels (Prabu et al., 2012). Elevated levels of plasma hepatic and muscle function enzymes due to various heavy metals were also reported in blood of ruminants and mice (El-Nekeety et al., 2009; Rana et al., 2010a; Mohajeri et al., 2014; Dash et al., 2016) which is in agreement with the current present study. Lactate dehydrogenase (LDH) was found to be elevated in heavy metal exposed buffaloes. LDH being an intracellular enzyme, present in both liver and muscle cells. An increased level of plasma LDH is an indicator of hepatocellular or muscular damage. Creatine kinase (CK) activity has been found to be higher in heavy metal affected buffaloes. Various toxic agents including heavy metals could cause myonecrosis that in turn might results in elevated plasma CK activity (Kaneko et al., 1997). Significantly, higher (p<0.05) levels of LDH and CK are indicative of muscle injuries consequent to either heavy metal exposure or stress during slaughtering of buffaloes (Dash et al., 2016; Kaneko et al., 1997; Aslani et al., 2012). Several authors have reported elevated plasmahepatic and muscle function enzymes consequent to heavy metals in cattle and mice (El-Nekeety et al., 2009; Rana et al., 2010a; Mohajeri et al., 2014).
 
Expression studies of metallothionein-2
 
Metallothionein expression was studied to monitor its proportionate fold change consequent to heavy metal exposure in blood and tissues of buffaloes. Fold change expression of MT-2 in lead, nickel and cadmium exposed buffalo blood samples is presented in Fig 3. Mean Ct values for Cd-MT, Pb-MT and Ni-MT were 19.825, 21.619 and 22.606 respectively. When compared with endogenous gene RPL4 whose mean Ct value in Cd, Pb and Ni of exposed blood were 24.03, 24.772 and 24.115 respectively. It has been found that fold change expression (2^^-ΔΔct) of metallothionein (MT-2) in blood containing Cd (9.3114) showed up-regulation expression followed by Pb (1.506) and Ni (1.362). Baurand (2015) also reported similar findings   in snail embryos that had high Cd exposure, which led to an over-expression of the CdMT gene in a concentration-dependent manner, whereas the expression of the Cd/CuMT gene remained unaffected. The above-mentioned study demonstrated the ability of snail embryos to respond very early to Cd exposure by up-regulation of the CdMT gene. Similar to our study Liu et al., (2007) reported arsenic toxicosis in human caused less expression of MT in blood in comparison to tissues.
 

 
Apart from chelating heavy metals, MT-2 also has antioxidant property. Up-regulation of MT-2 expression might prevent animal body from oxidative stress by scavenging the free radicals, generated due to increased level of heavy metals in the body (Ruttkay-Nedecky et al., 2013 and Karin et al., 1983). Marked increase in metallothionein was also reported in liver of lead and nickel of heavy metal injected mice (Šveikauskaitë et al., 2014) which is in accordance with the present study. Increased expression of MT-2 could be a cellular defense mechanism, which either rewrite as prevent the damage caused due to heavy metals by chelating them or rewrite as lessens their effect by acting as cellular antioxidant.