The new freshwater crab belongs to the genus Geothelphusa as inferred from mitochondrial and nuclear DNA markers 

There are approximately 1,300 species of freshwater crabs that spend their entire life cycle in freshwater environments throughout the world. Freshwater crabs play a key role in the worldwide ecology (Yeo et al., 2008; Shy et al., 2014). True freshwater crabs are regarded as those that have adopted freshwater, semi-terrestrial or terrestrial modes of life and are characterized by their ability to complete their life cycle independently of the marine environment (Yeo et al., 2008). The genus Geothelphusa Stimpson, 1858, is a diverse and abundant group of true freshwater crabs. More than 60 Geothelphusa spp. reportedly inhabit the islands of Far East Asia, including Taiwan, the Ryukyus, Pinnacle islands and Japan (Shih et al., 2011; Shy et al., 2014).
        
In recent years, the nucleotide sequence variations of mitochondrial DNA in animals could be enough to distinguish closely related species (Yeo et al., 2008; Shy et al., 2014). The genes, mitochondrial 16S rDNA and cytochrome oxidase I (COI), were mostly used for classification and finding phylogenetic relationships (Kim et al., 2017; Hanan, 2018).
        
Until now, no specimen of a true freshwater crab from the Korean peninsula had been studied. In this report, a population of Naju crab was found to inhabit a mountain stream in the JeollaNamdo Province, ROK. The Naju freshwater crab belongs to Geothelphusa spp. by comparing the phylogenetic characters and nucleotide sequences.

=Specimens were collected from the stream and its entire bodies were preserved in 95% ethanol, and then at -80°C. Genomic DNA was isolated from the four full bodies of the crab (Geothelphusa sp. DJL-2014 isolate Gm01) by grinding in liquid nitrogen and was extracted with GeneAll Exgene cell SV kit (GeneAll, Seoul, Korea).
 
Partial regions of the 16S rDNA gene, COI gene, and genomic ITS region were selected for amplification with polymerase chain reaction (PCR), using the following primer sets. CrustCO1LP (GGTCAACAAATCATAAGATATTGG) and CrustCO1RP (TAAACTTCAGGGTGA CCAAAAAA TCA) were used for COI gene Former et al., (1994). Crustml16S1471LP (CCTGTTTANCAAAAACAT) and Crustml16S1472RP (AGATAGAAACCAACCTGG) were used for the 16S rDNA gene (Crandall and Fitzpatrick, 1996). CrustITSLP1 (GGAAGTAAAAGTCGTAACAAGG) and CrustITSRP1 (TTCAGTCGCCCTTACTAAGGGAATCC) were used for the genomic ITS region (Tang et al., 2003). PCR reaction mixes contained 5 µL of 10× buffer, 2.5 mM dNTP Mix and 5 units of Taq Polymerase (Genotech, Daejeon, Korea). The amplification program included 25-30 cycles of 95°C for 20 s, 40-50°C for 30 s and 72°C for 30-90 s, followed by an extension for 10 min at 72°C. The PCR product was purified and sequenced using ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, CA, USA) Lee et al., (2015).
        
The phylogenetic trees of the mitochondrial genes (16S rDNA and COI) were generated using the Molecular Evolutionary Genetics Analysis version 7.0. (MEGA7) Kumar et al., (2016). Other nucleotide sequences were obtained from the NCBI GenBank to compare the phylogenetic relationships. The evolutionary history was inferred by using the Maximum Likelihood method based on Kimura 2-parameter model Kimura (1980).

Habitat and morphology
 
The Naju crab was first found in clean and moderately flowing fresh water in a mountain stream. The Naju crabs live mainly in water (aquatic), whereas G. dehaani lives both in water and on land (amphibious) Aotsuka et al., (1995). The total population of Geothelphusa sp. is estimated to be more than ten thousand. Its carapace is hexagonal. It has a moderately wide front-orbital border, and its margin is usually smooth (Fig 1A and 1B). Its color is reddish and dark-brown. The color of the legs resembles almond skin. Female specimens collected in September 2014, 2015, 2016, 2017, and 2018 showed a typical characteristic in which the mother crab carries her fertilized eggs and immature crabs in the abdomen (data not shown). The males of Naju crabs only have a well-developed, enlarged, major cheliped, whereas the female chelipeds are small and symmetrical.
 

 
Phylogenetic analysis using 16S rDNA
 
It was endeavored to distinguish the Naju crab from G. dehaani by studying the differences between the two species. The nucleotide sequences of both 16S rDNA and COI gene were selected to establish the genotype of crabs and to identify the species (Former et al., 1994; Crandall and Fitzpatrick, 1996; Sobita and Basudha, 2017).
        
Among the 27 true freshwater crabs tested, there was a wide variance of the 28 nucleotide sequence of 16S rDNA analyzed. There was a total of 564 positions in the final dataset and 105 positions were found to be variable. A search using the BLAST of 548bp of the 16S rDNA gene of the Naju crab (accession no. KM507490) showed a 94 to 98 percentage of maximum identity among four G. dehaani (AB551391, AB187570, AB290630 and AB535460). However, a BLAST search of 548bp of the 16S rDNA gene of G. dehaani isolate Gd23 (AB551391) showed 96 to 99 percentage of maximum identity among four G. dehaani (AB187570, AB290630 and AB535460). This sequence of the Naju crab was AT lower (71.9%) than G. dehaani (AB551391; 72.6%), G. dehaani (AB187570; 72.2%) and G. dehaani (AB290630; 72.2%).
        
The phylogenetic analysis of the 16S rDNA segment showed that the newly isolated Naju crab seems to belong to the Geothelphusa family (Fig 2). Two main clades (I and II) were found. The larger clade II contains 21 species, which are originated from Taiwan and Ryukyus islands. The smaller clade I contains 6 species, including the Naju crab, four G. dehaani isolates (AB551391, AB187570, AB290630 and AB535460) and one G. sakamotoan (AB266174). The branch length of two G. dehaani (AB551391 and AB187570) is shorter than that of the Naju crab, indicating that the amount of nucleotide change of the Naju crab is more than those of the two G. dehaani, respectively (Fig 2).
 

        
The genetic distance is a measure of the genetic divergence between species; the smaller the genetic distance, the closer the relation and the more recent ancestor. We calculated various genetic distances among 27 species based on the 16S rDNA frequency data (Table 1). Among the 351 combinations of estimated genetic distances, the lowest genetic distance is 0.002, between G. eucrinodonta (AB535454) and G. yangmingshan (AB625669), indicating the highest genetic identity. The sixth lowest genetic distance is 0.011 at three sets; the Naju crab and G. dehaani (AB551391), G. tali (AB625672) and G. fulva (AB428456), G. albogiva (AB127373) and G. tawu (AB127379). Interestingly, it is shown that the genetic distance between G. dehaani (AB551391) and G. dehaani (AB187570) is 0.004, the second lowest. The estimated value of the genetic distance between the Naju crab and G. dehaani (AB187570) is 0.015, the eighth lowest value. The Naju crab showed the highest genetic distance (0.085) with G. monticola (AB535450), which resides in high altitude mountains in Taiwan. In contrast, G. dehaani (AB551391) showed the highest genetic distance (0.081) with G. minei (AB625679) and G. eucrinodonta (AB535454). These observations suggest that the Naju crab and four G. dehaani isolates seem to be somewhat genetically distant from each other.
 
Phylogenetic analysis using the COI gene
 
All four individual of the Naju crabs studied revealed the same haplotype, which was different in 2 nucleotides. A 658bp segment (accession no. KM507491) of the COI gene from the Naju crab was AT richer (65.4%) than G. dehaani (AB535491; 64.5%), G. dehaani (AB187570; 64.9%), G. dehaani (AB290648; 65.1%) and G. dehaani (AB551393; 65.2%). A BLAST search of 658bp of the CO1 gene of the Naju crab showed a 92 to 98 percentage of maximum identity among four G. dehaani, suggesting that G. dehaani may not be a single species. Two nucleotides of the partial COI gene in the Naju crab are distinct (C at 190 position and G at 607 position) among the 28 Geothelphusa spp. tested (data not shown). The variance of the nucleotide sequence of COI between the Naju crab and G. dehaani (AB551393; 15 bases per 616 bases = 2.44%) was revealed. These observations suggest that the Naju crab seem to be separated from 4 G. dehaani crabs, as the 16S rDNA haplotype of S. fleuosa can be differentiated from the S. maena haplotype in 15 nucleotide differences (2.65%) Imsiridou et al., (2011).
        
The analysis involved 28 nucleotide sequences and 194 positions were variable. Two main clades (I and II) were recognized (Fig 3); The larger clade I contains 22 species and the smaller clade II contains only 4 species. The Naju crab, four G. dehaani isolates, and one G. sakamotoan consist of the small subgroup of clade I. Each branch length of four G. dehaani isolates is also longer than that of the Naju crab, indicating that the amount of nucleotide change of four G. dehaani isolates is greater than that of the Naju crab.
 

 
The ITS region and the histone H3 region
 
The aligned ITS region of 1515bp (accession no. MG561922) from the Naju crab contains partial 18S rDNA, ITS1, 5.8S rDNA, ITS2 and partial 28S rDNA sequences. The nucleotide sequences of both the ITS1 region and the ITS2 region are not conserved at all, respectively (data not shown), although the sequence of putative 5.8S rDNA (from 467 to 629 bp) was highly conserved in Epilobocera sinuatifrons (FN395607), Eriocheir sinensis, Cancer productus, Chaceon quinquedens. and Sesarma spp. (data not shown). The partial Histone H3 region of 328bp from the Naju crab was highly conserved in G. dehaani isolate Gd9 (AB290667) with only one base variation (data not shown). 
        
The phylogenetic trees indicate that the Naju crab is grouped into Geothelphusa family. This Naju crab is mostly closed to G. dehaani isolate Gd23 from Tottori, Japan (Fig 1, 2 and Table 1). Therefore, it is not excluded yet the possibility whether the Naju crab may have been imported previously from Japan. That is, it is possible that the Naju crab is a sister species of G. dehaani, as this species is known to include many sister species or be a species complex.
 

This is the first report that a true freshwater crab (Naju crab) was collected from the Korean peninsula and the range of the Naju crab appears to be constrained by mountains and dryness. The population of the Naju crab is relatively small and lives geographically restricted area. The Naju crab may be highly endangered, along with over 80 other endangered animal species living in Korea. Thus, it is necessary and urgent to protect this species from the great threat of extinction. Cement-based constructions, airborne pollution, traffic, habitat loss, global warming and human populations would contribute to a decline in the Naju crab population.
               
Further studies on the anatomical characters including the first male gonopod (G1), historical evidence, evolutionary origin and zoogeographic and ecological aspects such as diagnosis, coloration, habitat, and distribution, should be required. In addition, the complete sequence of mitochondrial genome of the Naju crab remains elusive both to compare with that of G. dehaani (accession no. AB187570) and to elucidate the difference between the Naju crab and G. dehaani.