Reports on Tetrameres fissipina from the Naturally Infested Indigenous Chicken in Phek District of Nagaland

Poultry production is an integral part of smallholder agriculture in the developing world and has a multidimensional contribution to the livelihood of both rural and urban households. Its contribution spans economic and social to cultural and environmental benefits (Gueye, 2000; Akinola and Essien, 2011; Birhanu et al., 2022, Birhanu et al., 2023). In Nagaland, backyard poultry farming covers about 97.56% of total poultry population and mostly consists of desi (60.27%) birds (Singh et.al, 2018). The local or desi chicken population therefore, serves as a crucial source of readily available animal protein for rural households in Naga villages, along with other livestock such as pigs, rabbits, ducks, mithun and tho-tho (indigenous hill cattle).

Phek district in Nagaland features diverse terrain and has a moderately warm climate, with average temperatures around 27°C, without exceeding 32°C. Winters are cold with the temperature dropping to 0°C in the coldest months of January and February (Borkotoky et al., 2024). Looking at the geo-climatic condition, north eastern region is quite conducive for growth and propagation of parasites (Chamuah et al., 2019a). Harsh and varied climatic conditions, combined with limited access to poultry vaccines and medicines, significantly increase the challenges posed by poultry diseases in the state. The humid tropical climatic conditions largely favour faster propagation and development of larval stages of helminth parasites (Matta and Ahluwalia 1981; Malhotra 1983; Kulkarni et al., 2001). Further endoparasitic infection produces ill effects, immuno-suppression and predisposes the animals for various potential pathogens (Chamuah et al., 2019) that adversely affect the successful poultry farming. It is, therefore, important to monitor and manage gastrointestinal helminthic infections in backyard free range birds to safeguard the health and productivity of these birds and the well-being of the rural communities they support.

Tetrameres is a dimorphic genus of spirurid nematode that infects domestic poultry such as chicken, duck, turkey, pigeon, quail, guineafowl, pheasant and wild birds, almost exclusively parasitising the proventriculus (Megha et al., 2022).  Mature females are almost spherical, dark blood-red in colour, while males are small, white and filiform and found free in lumen (Kamil et al., 2011). Bird infested with Tetrameres spp. manifest reduced body weight, delayed maturity, decreased egg production, emaciation, diarrhoea and anemia (Ramaswamy and Sundaram, 1983). Birds become infected through the oral route when exposed to intermediate hosts, such as crustaceans, grasshoppers and cockroaches. Various studies highlight the presence of Tetrameres infections in poultry populations in different regions, emphasizing the significance of understanding and addressing this parasite’s impact on poultry health. The present communication, reports finding of exceptionally high incidence of Tetrameres spp. in local chicken in Phek district of Nagaland.
 
Case history and observation
 
Twenty local poultry pullets from Gidemi village (25°37'9"N latitude, 94°0'22.0"E longitude; 5300 feet MSL), located in the Pfutsero block of the Phek district, were presented to the Division of Animal Science, Krishi Vigyan Kendra-Phek for post-mortem examination. The birds were reared in free range backyard system, unvaccinated and received occasional supplementary grains (maize and rice) as feed. The farmers reported regular death of chicken pullets exhibiting decreased activity levels, gradual emaciation, distended crop, coughing, poor feather quality, occasional diarrhoea, torticollis and paralysis before their death. No such symptoms were reported in adult birds. Pock lesions were frequently reported in both diseased and apparently healthy birds. Upon gross examination, majority of the birds displayed pock lesions around the eye and beak, although no pock lesions were observed in the shanks. The birds appeared emaciated and the paleness observed in their combs, wattles and legs indicated chronic anemia. A detailed post-mortem examination was conducted, during which representative tissue samples and parasites were collected for laboratory examinations.

Morphological identification
 
Adult parasites were collected from naturally infected poultry during-postmortem at Division of Animal Science, Krishi Vigyan Kendra-Phek. The recovered parasites were washed with normal distill water to remove dirt and debris, then placed in 10% langhans lactophenol solution, observed under a microscope and identified according to keys based on species characteristics provided by Soulsby (2012). The adult parasites were preserved in 70% alcohol for DNA extraction and stored at -20°C until further use.
 
Molecular identification
 
Total genomic DNA was extracted from individual adult helminth parasites using a commercial genomic DNA extraction kit according to the manufacturer’s instructions (G-Sure Tissue Kit, GCC Biotech, India) and DNA concentration was measured using spectrophotometer (Nanodrop 2000, Thermoscientific, USA). Genomic DNA was diluted to a working concentration of 100 ng/µL and 1 µL of this dilution was used as a template in a 25 µL of reaction mixture. The PCR was performed with 18SrDNA with the help of primer F: 5'ATACCAACCAGCGTTCCGTT3' and R: 5'TTCTCGAAACGGCTCAGTCC3'. The PCR condition included initial denaturation at 95°C for 5 mins,   30 cycles of 94°C for 30 secs, 50°C for 30 secs (Annealing temperature), 72°C for 45 secs and final extension at 72°C for 10 mins. The resulting amplicons were confirmed by gel electrophoresis using 1.0% agarose-TBE gel and subsequently sequenced from University of Delhi, Delhi. The sequence analysis and similarity searches were performed with the basic local alignment search tool using default matrix. For phylogenetic analyses, multiple sequence alignment of the resulting sequences with already existing databases in GenBank was carried out using ClustalW of MEGA 6.01 software (http://www.Megasoftware.net/mega6.01.html). The evolutionary history was inferred using the Neighbor-Joining method as per Saitou N. and Nei M. (1987) with 1000 bootstrap values.
 
Pathological study
 
At time of post-mortem examination, visible gross lesions were recorded and representative tissue samples were collected in 10% formalin solution. The tissues were properly processed and embedded in paraffin wax. Paraffin sections were cut 4-5 ìm thick and stained with Hematoxylin and Eosin (H and E) by method as described by Luna (1968). Histological alteration of all sections was examined using light microscope and photographed. The grossly visible parasites were collected from different organs and identified based on the morphological characteristics (Soulsby, 2012).

The necropsy results and subsequent analysis revealed several notable observations in the examined birds. The birds were emaciated, anaemic, with a poor body condition (Fig 1) and their feathers appeared dull and unkempt. Among the cases studied, 20% exhibited a diphtheric membrane in the trachea. A majority of the cases (65%) demonstrated petechial haemorrhages in the kidneys and liver. Mild to moderate congestion was observed in the lungs, spleen and pancreas. All birds showed catarrhal inflammation in the small intestine. All pox infected birds (Fig 2) had concurrent infections with Tetrameres spp.



​

Further examination of the proventriculus (glandular stomach) uncovered the presence of Tetrameres spp., a blood-red nematode parasite (Fig 3), from the Spiruridae family, embedded within the proventricular glands (Fig 4).  These parasites were visible from both the serosal and mucosal surfaces of the proventriculus. The proventricular nodules contained tarry red-colored parasites, identified as female Tetrameres, with each nodule typically housing one or occasionally two females. Additionally, small, slender male Tetrameres were observed in association with some of the females within the nodules. Morphologically, mature female Tetrameres were spherical, dark blood-red and characterized by four longitudinal furrows, while males are smaller, white and filiform, without spines on the cuticle and tail. Species identification as Tetrameres fissipina was confirmed through PCR amplification of 18S rDNA and sequencing (Fig 5). The sequence (Accession number: MN305802.1) of the present investigation is 100% similar with the Canadian isolate (EF180077.1) and 98.86% similarity with Kashmir isolate (Accession number: OM920823.1) in the present investigation (Fig 6). It is worth noting that T.fissispina infestation has been reported in ducks from the Bandipora area of the Kashmir Valley (Kamil et al., 2011), domestic indigenous fowl in Nigeria (Kamani et al., 2010; Biu and Haddabi, 2005), as well as in local poultry in Selangor, Malaysia (Lee et al., 1986).









Histopathological examination of the proventriculus revealed gland lumen dilation (Fig 7), atrophy, degeneration and desquamation of the glandular cells (Fig 8). Numerous nematode parasites, eggs, bacterial colonies and mixed inflammatory cells (heterophils and lymphocytes) with associated necrosis were observed in the proventriculus (Fig 9,10). Mild lymphoplasmacytic and heterophilic inflammation in the ventriculus and multifocal cystic spaces (parasite tracts) within the koilin of the ventriculus were noted. Mild to moderate congestion of hepatic blood vessels was observed, contributing to the overall picture of hepatic stress and compromised blood flow. In liver parenchyma evidence of significant inflammatory response characterized by the presence of mixed inflammatory cells, including heterophils and lymphocytes were noted. In some cases, there was early evidence of fibrosis, which manifested as increased collagen deposition in the liver parenchyma. This fibrotic change was indicative of chronic inflammatory responses and ongoing tissue damage. There was significant inflammatory infiltration in the renal interstitium. This inflammation primarily involved heterophils and lymphocytes, resulting in diffuse or focal areas of interstitial nephritis. Lungs should mild inflammation, congestion, edema and localized haemorrhage. The lesion in small intestine including catarrhal inflammation, epithelial damage, inflammatory infiltration, edema and localized necrosis. This report marks the first identification of Tetrameres species in the Phek district of Nagaland.

The present study conducted morphological vis-à-vis PCR and sequencing to identify T. fissipina in local chickens for the first time in Phek district of Nagaland. This sequencing method provides cent percent accuracy in identifying the parasite and allows for the detection of genetic variations within the population. By minimizing ambiguity arising from morphological identification, this genetic identification can contribute to the development of effective preventive measures for future control programs against the parasite. Histopathological revealed distinct proventricular lesions leading to dysfunction of digestive process and leading to lower immunity and disease incidence. In summary, the study’s findings provide valuable data on the identification of T. fissipina in local chickens using PCR and subsequent sequencing. This knowledge can aid in implementing targeted control measures to combat the parasite, ensuring the well-being and productivity of the poultry industry in the region.

The authors are thankful to the ICAR-Director, NRC on Mithun, Jharnapani, Nagaland for providing necessary facilities for the present research work.
 
Author’s contributions
 
DB, JKC: Involved in investigation, data generation, interpretation and preparing original draft; RD:  Laboratory assistance and final editing.
 
Disclaimers
 
The views and conclusions expressed in this article are solely those of the authors and do not necessarily represent the views of their affiliated institutions. The authors are responsible for the accuracy and completeness of the information provided, but do not accept any liability for any direct or indirect losses resulting from the use of this content.
 
Informed consent
 
All animal procedures for experiments were approved by the Committee of Experimental Animal care and handling techniques were approved by the University of Animal Care Committee.

The authors declare that there are no conflicts of interest regarding the publication of this article, funding or sponsorship influenced the design of the study, data collection, analysis, decision to publish, or preparation of the manuscript.