Agricultural Science Digest

  • Chief EditorArvind kumar

  • Print ISSN 0253-150X

  • Online ISSN 0976-0547

  • NAAS Rating 5.52

  • SJR 0.156

Frequency :
Bi-monthly (February, April, June, August, October and December)
Indexing Services :
BIOSIS Preview, Biological Abstracts, Elsevier (Scopus and Embase), AGRICOLA, Google Scholar, CrossRef, CAB Abstracting Journals, Chemical Abstracts, Indian Science Abstracts, EBSCO Indexing Services, Index Copernicus
Submit

Full Research Article

Multi Drug Resistant (MDR) Klebsiella pnuemoniae Isolated from Different Sources

Shikha Chaudhary1,*, T.S. Rai, 1, A.K. Arora1, Mudit Chandra1
1Department of Veterinary Microbiology, Guru Angad Dev Veterinary and Animal Sciences University, Punjab-141 004, Ludhiana, India.

ABSTRACT

Background: Multidrug-resistant pathogens are a significant cause of morbidity globally. The recent rise in resistant bacterial strains is largely attributed to the extensive use of antibiotics in human and animal treatment. In recent years, there has been a notable increase in drug-resistant Klebsiella pneumoniae strains, posing a major challenge for clinicians worldwide.

Methods: In the current study, 121 samples were obtained from bovine mastitis milk and faeces, dairy cattle farm premises, chicken cloacal swabs, poultry farm litter and water. The samples were processed for the isolation and identification of Klebsiella species. Klebsiella isolates were identified by cultural, morphological and biochemical characteristics and were subsequently confirmed by PCR assays that targeted species-specific genes. The isolates were subjected to in vitro antibiotic sensitivity test. The DNA from all the isolates was extracted and subjected to PCR to identify the presence of 10 different Antibiotic Resistance Genes (ARG) using published primers. The ARGs targeted were blaTEM, blaSHV, blaOXA, blaIMP, DHAM, MOXM, tetA, tetB, sul1 and aadA.

Result: Out of 121 samples, twenty-six (21.4%) samples were identified as Klebsiella pnuemoniae isolates. The occurence of Klebsiella pnuemoniae in samples from different sources was- 3/33 (09%) from mastitis milk, 8/27 (29.6%) from faecal samples and 04/14 (28.5%) from environmental samples collected from dairy farms. Similarly, Klebsiella pnuemoniae prevalence was recorded to be 6/33 (18.1%) in cloacal swabs and 5/14 (35.7%) from environmental samples collected from poultry farms. On in vitro antibiotic sensitivity test, all the Klebsiella pneumoniae isolates were found to be resistant to penicillin, amoxicillin, cefuroxime and ampicillin/ sulbactam (100% each), followed by cefalexin (65.3%), streptomycin (53.8%), tetracycline (38.4%), imipenum and co-trimoxazole (34.6% each), ofloxacin (30.7%), norfloxacin (27%), ceftriaxone (23%), amikacin (15.38%) and gentamicin (11.5%). All the K. pneumoniae isolates were found to be Multi Drug Resistant (MDR). Out of 26 isolates, 25 (96%) were positive for Sul1, 22 (84.6%) for blaTEM, 19 (73%) for blaSHV, 19 (3%) for tetA, 16 (61.5%) for aadA, 10 (38.4%) for OXA, 9 (34.6%) for tetB and 2 (7.6%) for DHAM and MOXM each. None of the isolates harboured blaIMP gene.

INTRODUCTION

Across the globe, it is established that multidrug-resistant pathogens are responsible for a large amount of morbidity. There has been an upsurge in resistant bacteria strains in recent years due to the widespread use of antibiotics both in human and animal treatment. Antimicrobial susceptibility testing has proven to be an effective technique to optimize antibiotic therapy for treating such infections, especially those caused by gram-negative bacteria. Many drug resistant forms of Klebsiella pneumoniae have emerged in the last few years, making it a global issue for clinicians worldwide. Apart from the conditions like mastitis, pneumonia and diarrhea, Klebsiella has also been isolated from apparently healthy animals. The treatment, especially of the Multiple Drug Resistant (MDR) Klebsiella pneumoniae therefore, poses a serious challenge to clinicians around the world. Furthermore, increasing resistance to antibiotics is rendering infection by these strains very challenging to treat. The multidrug resistance in the microbial organisms, in particular the Enterobacteriaceae, is often due to the acquisition of resistance genes from a shared pool Partridge, (2011).

MATERIALS AND METHODS

Sample collection
 
The research work was accomplished in the Department of Veterinary Microbiology, College of Veterinary Science, Guru Angad Dev Veterinary and Animal Sciences University (GADVASU), Ludhiana in the year of 2020 for the research period of two years i.e. 2018 to 2020. The study was ethically approved by Institutional Animal Ethical Committee, Guru Angad Dev Veterinary and Animal Sciences University (GADVASU), Ludhiana (497/GO/ab/2001/CPCSEA dated 31-10-2013).
       
A total of 121 samples were collected from bovine mastitis milk and faeces, dairy cattle farm premises and poultry cloacal swabs, poultry farm litter and water. Out of 121 samples, 60 were faecal samples (13 from cattle, 14 from buffalo, 33 from poultry) and 28 were from environment/ farm premises (14 samples from cattle farm premises viz., 4 feed samples, 4 drinking water samples, 3 floor scrappings, 1 from cracks and crevices and 2 bedding material samples; and 14 were from poultry premises viz., 8 feed samples, 5 drinking water samples, 1 litter sample), 33 were mastitis milk samples (20 from cattle and 13 from buffalo). The rectal and cloacal swabs were taken aseptically using sterile swabs, milk and farm premises and were immediately transferred in the sterile tubes. All the collected samples were immediately brought to lab and were processed for the isolation of bacteria.
 
Isolation of bacteria
 
All the faecal samples brought were streaked on McConkey Lactose agar, Mastitis milk samples were streaked initially on Brain Heart Infusion agar (overnight incubation), samples collected from farm premises were immediately inoculated in BHI broth and incubated overnight at 37°C. Subsequently a loopful of bacterial growth from BHI broth was streaked on MLA agar and incubated at 37°C for 18-24 h for the isolation of bacteria. Single isolated bacterial colonies were streaked on McConkey Lactose agar and incubated at 37°C for 18-24 hrs for the isolation of bacteria. Following these, various biochemical tests like Catalase, Oxidase, Indole, Methyl Red and Vogues Proskauer test, etc were applied for identification of the Klebsiella species. Finally, the confirmation was done by applying PCR assay targeting species specific primers for Klebsiella pneumonia as per reference number CP024838.1 as reported by Sekhri (2019).
 
Molecular detection of Klebsiella pnuemoniae
       
The species-specific primers having reference number CP024838.1 were used as referred by Sekhri (2019), with a sequence of (5'-3') F: ATGGCCGGGCATGGTACTTC, R: ACCGGAGGTGATGTTTTCGGT. PCR reaction mixture was prepared that consisted of 12.5 ml mastermix (2X GoTaq® Master Mix) (Promega, USA) 1 ml of 20 pmol/ml of each forward and reverse primers (Metabion International, Germany), 1 ml of template DNA and finally the reaction volume was made up to 25 ml using Nuclease free water (Promega, USA) PCR was performed on a thermocycler (Veriti, ABI, USA).
 
Antibiotic sensitivity testing
 
Fifteen antibiotic discs viz., Penicillin (10 units), Streptomycin (10 mcg), Ampicillin/Sulbactam (10/10 mcg), Amoxicillin (10 mcg), Imipenum (10 mcg), Cefalexin (30 mcg), Cefuroxime (30 mcg), Ceftriaxone (30 mcg), Tetracycline (30 mcg), Gentamicin (10 mcg), Amikacin (30 mcg), Co-trimoxazole (25 mcg), Norfloxacin (10 mcg), Ofloxacin (5 mcg), Ciprofloxacin (5 mcg)were used in the study. Antibiotic sensitivity test was applied as per disc diffusion method of Bauer et al., (1966) on all the Klebsiella pnuemoniae isolates.
 
Molecular detection of antimicrobial resistance (AMR) genes
 
The Anti-microbial Resistance Genes coding for AMR in these 15 Klebsiella pneumoniae isolates was observed by targeting the 10 antibiotic resistance genes blaTEM, blaSHV, IMP, OXA, DHAM, MOXM, tetA, tetB, sul1 and aadA with the help of PCR assay using already published primers having following sequences (Table 1). PCR reaction mixture for each reaction was prepared that consisted of 12.5 ml mastermix (2X GoTaq® Master Mix) (Promega, USA) 1ml of 20 pmol/ul of each forward and reverse primers (Metabion International, Germany), 3 ml of template DNA and finally the reaction volume was made up to 25 ml using Nuclease free water (Promega, USA) PCR was performed on a thermocycler (Veriti, ABI, USA).
 

Table 1: Primers used for the amplification of different AMR genes.

RESULTS AND DISCUSSION

Out of 121 samples, 26 (21.4%) Klebsiella pnuemoniae strains were isolated and identified on the basis of cultural, morphological, biochemical characteristics and PCR assay using species specific pimers. Out of these 26 Klebsiella pnuemoniae strains, 08/27 (29.6%) were from cattle and buffalo faecal origin, 06/33 (18.1%) belonged to poultry cloacal swabs, 3/33 (09%) strains were from mastitis milk samples, 04/14 (28.5%) from cattle and buffalo farm premises and 05/14 (35.7%) from poultry farm premises. All of these strains were found to be Klebsiella pnuemoniae with the help of species-specific PCR assay in which an amplicon size of 156 bp was considered as positive (Fig 1). The prevalence in environmental samples in present study, including water, collected from dairy farms was 28.5% which is in close agreement to reports of 26% by Pathak and Gopal (2008). The prevalence rate of Klebsiella spp. could be attributed to several reasons such as geographical location, season, type and source of samples, species and age of animal, type of bedding material, zoosanitary conditions of farms particularly farm waste disposal and quality of water.
 

Fig 1: Gel electrophoresis of amplicon (156 bp) of Klebsiella pneumoniae isolates.


       
The anti-microbial sensitivity test revealed that all (100%) the isolates were found to be resistant to penicillin, amoxicillin, cefuroxime and ampicillin/ sulbactam, followed by Cefalexin (65.3%), Streptomycin (53.8%), Tetracycline (38.4%), Imipenum and Co-trimoxazole (34.6% each), Ofloxacin (30.7%), Norfloxacin (27%), Ceftriaxone and Ciprofloxacin (23% each), Amikacin (15.38%) and Gentamicin (11.5%). All the isolates (100%) were found to be multidrug resistant (MDR) as each of the isolate was resistant to minimum one agent of atleast three antimicrobial groups. It was observed that two of the isolates were resistant to an alarming number of 14 antibiotics used in the study. The MDR and the sensitivity patterns of the isolates are depicted in the Table 2a and 2b. Our findings are similar to those of Brisse and Duijkeren (2005) where Klebsiella isolates were found resistant to ampicillin (99%). Similarly, Jones et al., (2005), Yadav et al., (2022) also recorded 100% resistance to ampicillin in Klebsiella isolates, which is in agreement with our findings. Montso et al., (2019) isolated 196 isolates of E. coli and K. pneumoniae and found that upto 100% of the isolates were MDR. A similar study was undertaken by Tewari et al., (2018), where MDR was found in some of the K. pneumoniae isolates of livestock origin. Resistance to various antimicrobial agents in 67 K. pneumoniae isolates was observed and all were MDR isolates (Sousa et al., 2019). All these findings are in corroboration to our observations.

Table 2a: MDR pattern of Klebsiella pneumoniae isolates (n=26).



Table 2b: Antibiotic sensitivity test results of Klebsiella pnuemoniae isolates (n=26).


 
The PCR assay results for AMR specific genes revealed that 25/26 (96%) isolates harboured Sul1 gene, followed by blaTEM which was harboured by 22/26 (84.6%) isolates, followed by blaSHV and tetA 19/26 each (73% each), aadA 16/26 (61.5%), blaOXA 10/26 (38.4%), tetB 9/26 (34.6%), DHAM and MOXM 2/26 each (7.6% each) (Fig 2-10), whereas none of the isolates harboured blaIMP gene. Similar study was reported by Yadav et al., (2023), where the resistance in Klebsiella spp was observed for multiple antibiotics such as imipenem, meropenem, cefotaxime, ceftriaxone, ampicillin, etc and the Klebsiella spp harboured blaOXA gene. The present study is evident of Multi Drug Resistant Klebsiella pnuemoniae in cattle and buffalos in the area of study. Tetracyclines used to be the drug of choice in treating bacterial infections in veterinary medicine, but their use has now been restricted due to increasing resistance, choice of more efficacious drugs and certain side effects. A wide range of bacterial species harbor these genes, which are located in transposons and in self-transferable or mobilizable plasmids with a broad host range. K. pneumoniae encompasses a wide array of ARGs that continuously evolve and diversify. K. pneumoniae have the means and opportunity to pass plasmids on to other clinically important Gram-negative bacteria (Navon-Venezia et al., 2017). It has, therefore, been positioned as a key amplifier and spreader of clinically important AMR genes (Wyres and Holt 2018). A correlation has also been recorded and speculated between ARG and virulence genes by some workers (Yang et al., 2019; Mbelle et al., 2020).
 

Fig 2: Gel electrophoresis of sul1 resistance gene.


 

Fig 3: Gel electrophoresis of blaTEM resistance gene.


 

Fig 4: Gel electrophoresis of blaSHV resistance gene.


 

Fig 5: Gel electrophoresis of tetA resistance gene.


 

Fig 6: Gel electrophoresis of aadA resistance gene.


 

Fig 7: Gel electrophoresis of blaOXA resistance gene.


 

Fig 8: Gel electrophoresis of tetB resistance gene.


 

Fig 9: Gel electrophoresis of DHAM resistance gene.


 

Fig 10: Gel electrophoresis of MOXM resistance gene.

CONCLUSION

Taken together, from the present study, we could conclude that a total of 26 Klebsiella pneumoniae were isolated from 121 samples processed for isolation from different sources, leading to an overall occurrence of 21.4%. Antibiotic sensitivity testing revealed that Klebsiella pneumoniae were resistant to penicillin, amoxicillin, cefuroxime and ampicillin/sulbactam (100% each), while they were sensitive to gentamicin (77%), norfloxacin and ciprofloxacin (69.2% each) and co-trimoxazole and ofloxacin (65.3% each). All the isolates (100%) were found to be multi-drug resistant. The isolates resistant to most of the antimicrobial drugs (up to 13/15 or 14/15) were from poultry cloacal swabs, buffalo mastitis milk and drinking water from poultry farms. The most prevalent antibiotic resistance genes were Sul1, followed by blaTEM, blaSHV, tetA, aadA and tetB, while none of the isolates were positive for the blaIMP gene.

ACKNOWLEDGEMENT

We gratefully acknowledge the support and assistance of the Department of Veterinary Microbiology, Guru Angad Dev Veterinary and Animal Sciences University for this study. Their resources and guidance were invaluable to our research.

CONFLICT OF INTEREST

All authors declare that they have no conflicts of interest.

REFERENCES


  1. Barwa, R. and Shaaban, M. (2017) Molecular characterization of Klebsiella pneumoniae clinical isolates with elevated resistance to carbapenems. The Open Microbiology Journal. 11: 152-159.

  2. Bauer, A.W., Kirby, W.M., Sherirs, J.C. and Turck, M. (1966). Antibiotic susceptibility testing by standardized single disk method. American Journal of Clinical Pathology. 45: 433-496.

  3. Brisse, S. and Duijkeren, E. (2005). Identiûcation and antimicrobial susceptibility of 100 Klebsiella animal clinical isolates. Veterinary Microbiology. 105: 307-312.

  4. Jones, L.A., McIver, C.J., Kim, M.J., Rawlinson, W.D. and White, P.A. (2005). The aadB Gene Cassette Is Associated with blaSHV Genes in Klebsiella Species Producing Extended- Spectrum β-Lactamases. Antimicrobial Agents and Chemotherapy. 49: 794-797.

  5. Maynard, C., Bekal, S., Sanschagrin, F., Levesque, C.R., Brousseau, R., Masson, L., Larivi‘ere, S. and Harel J. (2004). Heterogeneity among virulence and antimicrobial resistance gene proûles of extraintestinal Escherichia coli isolates of animal and human origin. Journal of Clinical Microbiology. 42: 5444- 5452.

  6. Mbelle, N.M., Feldman, C., Sekyere, J.O., Maningi, N.E., Modipane, L. and Essack, S.Y. (2020). Pathogenomics and evolutionary epidemiology of Multi-drug resistant clinical Klebsiella pneumoniae isolated from pretoria, South Africa. Scientific Reports. 10: 1232.

  7. Momtaz, H., Rahimi, E. and Moshkelani, S. (2012). Molecular detection of antimicrobial resistance genes in E. Coli isolated from slaughtered commercial chickens in Iran. Veterinary Medicine. 57: 193-197.

  8. Montso, K.P., Dlamini, S.B., Kumar, A. and Ateba, C.N. (2019). Antimicrobial resistance factors of extended-spectrum beta-lactamases producing Escherichia coli and Klebsiella pneumoniae isolated from cattle farms and raw beef in north-west province, South Africa. BioMed research international. 2019: 1-13. 


  9. Osman, M.K., Hassan, H.M., Ahmed, O. and Ahmed, S.T. (2014). Phenotypic, antimicrobial susceptibility profile and virulence factors of Klebsiella pneumoniae isolated from buffalo and cow mastitic milk. Pathogens and Global Health. 108: 191-199.

  10. Partridge, S.R. (2011). Analysis of antibiotic resistance regions in Gram-negative bacteria. FEMS Microbiology Reviews. 35: 820-855.

  11. Pathak, S. and Gopal, K. (2008). Prevalence of bacterial contamination with antibiotic resistant and enterotoxigenic fecal coliforms in treated drinking water. Journal of Toxicology and Environmental Health. 71: 427-433.

  12. Patrick, B., Rebeccah, T., Carlton, L.G., Richard, R.S., Nicol, J.H.L., Vivian, N., Scott, A.M., Robert, F. and Marie, A. (2005). Antimicrobial resistance and virulence genes of escherichia coli isolates from swine in ontario. Applied and Environmental Microbiology. 71: 6753-6761.

  13. Sekhri I. (2019). Prevalence and pattern of antimicrobial resistance in pseudomonas aeruginosa isolated from mastitic milk. MVSc Thesis submitted to Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana.

  14. Shehata, M.E., EL-Sherbiny1, G.M., Mohamed, A.H. and Shafik, H.M. (2016). Molecular and phenotypic characterization of some antimicrobial resistance genes in escherichia coli isolated from human and broiler chickens. International Journal of Current Microbiology and Applied Sciences. 5: 953-965.

  15. Sousa, A.T.H.I., Makino, H., Bruno, V.C.M., Candido, S.L., Nogueira, B.S., Menezes, I.G., Nakazato, L. and Dutra, V. (2019). Antimicrobial resistance profile of Klebsiella pneumoniae isolated from domestic and wild animals. Arquivo Brasileiro de Medicina Veterinária e Zootecnia. 71: 584-593.

  16. Tewari, R., Mitra, S., Venugopal, N., Das, S., Ganaie, F., Sen, A. and Shome, B.R. (2019). Phenotypic and molecular characterization of extended spectrum β-lactamase, ampc β-lactamase and metallo β-lactamase producing Klebsiella spp. from farm animals in India. Indian Journal of Animal Research. 53: 938-943. doi: 10.18805/ijar.B- 3599.

  17. Van, T.T., Chin, J., Chapman, T., Tran, L.T. and Coloe, P.J. (2008). Safety of raw meat and shellfish in Vietnam: An analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. International Journal of Food Microbiology. 124: 217-223. 

  18. Wyres, K.L. and Holt, K.E. (2018). Klebsiella pneumoniae as a key trafficker of drug resistance genes from environmental to clinically important bacteria. Current Opinion in Microbiology. 45: 131-139. 

  19. Yadav, V., Joshi, R.K., Joshi, N., Kumar, A. and Singh, S. (2023). Detection of carbapenemase genes (bla-NDM, bla-KPC, bla-OXA-48) in Escherichia coli and Klebsiella species, isolated from milk samples of bovine in eastern plain zone of Uttar Pradesh. Indian Journal of Animal Research. 57: 66-73. doi: 10.18805/IJAR.B-4543.

  20. Yadav, V., Joshi, R.K., Joshi, N., Singh, S.V., Gupta, R.K., Niyogi, D. and Yadav, D.K. (2022). Prevalence of Extended- spectrum β-lactamase Producing E. coli and Klebsiella spp. Isolated from Buffaloes in Eastern Plain Zone of Uttar Pradesh. Indian Journal of Animal Research. 1: 8. doi: 10.18805/IJAR.B-5036.
Reviewed By

Download Article
In this Article
    Contact us
    Follow us

    Editorial Board

    View all (0)