Molecular Occurrence and Characterization of Canine Babesiosis in Naturally Infected Pet Dogs in Jaipur, Rajasthan, India

Canine babesiosis is a tick-borne protozoal haemolytic disease with global distribution and significance. Global distribution, including India, poses an important veterinary medical problem. It is a serious clinically significant tick-borne haemoprotozoan disease of dogs (Kjemtrup and Conrad, 2006). Hard-bodied ticks of various genera and species, including Rhipicephalus sanguineus, Dermacentor reticulatus, D. marginatus, Haemaphysalis ellipticum, H. longicornis and H. leachi transmit the infection to dogs. Canine babesiosis caused by two organisms Babesia gibsoni and B. canis causing disease in ocular, neural and anaemic forms of clinical manifestation (Senthil and Chakravarthi, 2023). In India, ticks Rhipicephalus sanguineus and Haemaphysalis longicornis are found to be transmitted Babesia vogeli and B. gibsoni, respectively (Shaw et al., 2001).
       
Clinical signs of babesiosis are haemolytic anaemia, pyrexia, anorexia, pale mucous membrane, anaemia, tachypnoea, tachycardia, splenomegaly, icterus, malaise and apathy. Many approaches are currently being used to diagnose canine babesiosis, with varying sensitivity and specificity. Babesiosis is diagnosed through clinical signs and symptoms, simple microscopy, in-vitro culture, animal inoculation, serological tests (CFT, ELISA and IFAT) and molecular methods such as Polymerase Chain Reaction (PCR). For the diagnosis of babesiosis most common method is the direct microscopic examination of Giemsa or Wright-stained blood smears because it is conclusive, feasible and cost-effective, but it cannot always detect inapparent or chronic infection in dogs because the level of parasitaemia is low (Caccio et al., 2002, Kushwaha et al., 2018). Recent advances in molecular biology techniques such as PCR have enabled piroplasm to be identified with far greater sensitivity and specificity than traditional methods. PCR can also be used to detect and differentiate infections caused by various Babesia species that cannot be identified morphologically by blood smear examination (Duarte et al., 2008). Objective of this study is standardisation of PCR and diagnose the babesiosis disease with the help of light microscopy and PCR.

Selection of dogs and blood samples collection
 
Dogs of different ages, sex and breeds presented at the government veterinary polyclinic, Jaipur and Veterinary Clinical Complex of Post- Graduate Institute of Veterinary Education and Research (PGIVER), Jaipur with clinical signs such as high fever above 104oF, inappetence, anaemia, lethargy, congested/pale/icteric mucous membranes, lymphadenopathy, haematuria, epistaxis and a tick infestation history were randomly selected for the blood sample collection. The duration of the study was from March 2022 to September 2022. Blood samples were collected from the cephalic or saphenous veins and preserved in EDTA as a blood anti-coagulant for smear observations and PCR to detect Babesia spp.
 
Thin film blood smear
 
Thin blood smears were made with each blood sample and was fixed with methanol and then stained with Giemsa solution. The Giemsa-stained blood smear was examined under the oil immersion objective of a microscope. Babesia organisms were blue, rod/piriform-shaped found in erythrocytes. After evaluating at least 500 oil immersion fields in 30 minutes, failure to detect the parasite in a smear was declared microscopically negative.
 
DNA extraction, PCR and sequencing
 
Genomic DNA was extracted from 200 μl of each blood sample using a commercial DNA extraction kit, (DNASure ^® Blood Mini kit; NP 61107) as per the manufacturer’s protocol. DNA samples were stored at -20^oC until further use. A conventional PCR was conducted to detect the presence of piroplasm in the blood samples. The PCR for the amplification of B. gibsoni and B. canis in the blood samples were performed based on the method of Inokuma et al., (2004) and Foldvari et al., (2005), respectively with a few modifications.
       
Species-specific set of primers for B. canis PIRO-A1 (F5‟  AGGGAGCCTGAGAGACGGCTACC 3‟ ) and PIRO-B (R5‟  TTAAATACGAATGCCCCCAAC 3‟) was used to amplify 450 bp gene fragment of 18S rRNA. For B. gibsoni Gib599 (F5‟  CTCGGCTACTTGCCTTGTC 3‟) and Gib1270 (R5‟  GCCGAAACTGAAATAACGGC3‟) was used to amplify 671 bp gene fragment of 18S rRNA. Known positive and negative control was used in PCR.
       
Briefly, reactions were conducted in a total of 10 μl, including 1.0 μl of 10 ×  PCR buffer (included 10 mM MgCl2), 1.0 μl of dNTP (2.5 mM each), 0.4 U of Taq DNA polymerase, 2.0 μl of template DNA, 0.5 μl of each primer (10 pmol) and 4.6 μl of double distilled water.
       
To standardize PCR for Babesia gibsoni, various temperature and time settings were applied during each stage of the reaction. The denaturation step was performed at either 94^oC or 95^oC for 40 seconds. Annealing temperatures ranged from 52°C to 64^oC, with durations of 30 to 45 seconds: 52^oC, 53.8^oC and 55^oC for 30 seconds each; 58^oC and 59.5^oC for 40 seconds each; 60^oC for 45 seconds and 61^oC, 62^oC and 64^oC for 40 seconds each. The extension step occurred at 72^oC for 30, 40, 45, or 60 seconds, followed by a final extension step at 72^oC for either 5 or 7 minutes. Likewise, for Babesia canis, the PCR was standardized using similar but slightly different conditions. The denaturation phase was carried out at either 94^oC or 95^oC for 40 seconds. Annealing temperatures were tested at 58^oC for 30 seconds and 60^oC and 62^oC for 40 seconds each. The extension step was performed at 72^oC for either 40 or 60 seconds. The final extension step also took place at 72^oC for either 40 or 60 seconds.
       
After standardisation, the ideal cycling conditions for the 18S PCR assay of Babesia gibsoni begin with an initial denaturation stage at 94^oC for 5 minutes, followed by 35 cycles of three steps: denaturation at 94oC for 30 seconds, annealing at 60°C for 45 seconds and extension at 72^oC for 45 seconds. The process concludes with a final extension at 72^oC for 7 minutes. For Babesia canis, the conditions are similar but with slight adjustments. The initial denaturation is set at 95^oC for 5 minutes. This is followed by 35 cycles that consist of denaturation at 95^oC for 40 seconds, annealing at 60^oC for 40 seconds and extension at 72^oC for 40 seconds. The final extension step is also conducted at 72^oC for 7 minutes (Fig 1).


       
The PCR products were electrophoresed on a 1.5% agarose gel containing 5 µl of ethidium bromide in Tris-acetate-EDTA buffer at 100 V for 1.5 hours and then examined under UV light. Purified DNA from one representative sample was sequenced by Eurofins Scientific India Pvt. Ltd. Bengaluru, Karnataka, India, using the same PCR primers to prime the sequencing reaction. PCR-purified amplicons were sequenced in both directions, using the forward and reverse PCR primer.
 
Sequences analysis
 
The 18S rRNA gene sequences were subjected to blast analysis on the NCBI website using the BLAST program. The obtained sequence was submitted to GenBank NCBI have accession number OP954492.
 
Animals ethics
 
The permission for sampling and other procedures was duly approved by the Institutional Animal Ethics Committee (IAEC) vide memo no. IAEC Approval No: PGIVER / IAEC 12022 - 19.
 
Statistical analysis
 
Data obtained were subjected to analysis by chi-square test using the statistical package SPSS software 20 version.

Incidence of Babesiosis through light microscopy and PCR
 
The microscopic blood smear examination of 100 suspected cases revealed 7% incidence of canine babesiosis. The PCR was performed for all 100 cases using both B. canis and B. gibsoni primers, which revealed 24% incidence of canine babesiosis. In the present study, out of 100 suspected samples, 7 (7%) blood samples show parasitaemia through microscopic blood smear examination and 24 (24%) sample were found positive for B. canis infection through PCR and no case was found positive for B. gibsoni infection.
 
Comparative efficacy of light microscopy and PCR assay
 
In this study, Pearson’s chi-square test was used to assess the statistical difference between diagnostic methods. A chi-square value of 11.03 with a p-value of 0.0008 indicates a highly significant difference (p<0.01) between the results obtained by light microscopy and PCR assay. Specifically, while only 7 out of 100 samples tested positive with light microscopy, PCR detected 24 positive cases from the same sample set, demonstrating that PCR is notably more sensitive than conventional blood smear examination.
       
However, the PCR assays were able to detect parasitaemia in dogs with sub-clinical or chronic disease and a total of 24 cases were found positive for Babesiosis through the PCR technique. DNA amplification has been stated to be far more sensitive than conventional methods because lower parasitaemia cannot always be detected by Giemsa staining, but because PCR assays are known to have extremely high sensitivity, they can amplify even minute amounts of parasitic DNA.
 
Diagnosis of Babesiosis by blood smear examination and PCR
 
In the present study, Giemsa-stained blood smear examination through light microscopy, of 100 suspected canine babesiosis cases revealed 7 (7%) cases positive for babesiosis. After the standardisation of PCR, all 100 samples were subjected to PCR for both B. gibsoni and B. canis. PCR revealed a total of 24 (24%) positive clinical cases of B. canis, out of 100 suspected cases (Fig 2a, 2b and 3).






 
Sequence analysis
 
BLAST analysis of 18s small subunit rRNA gene was performed for the B. canis sequence to obtain sequence similarity and per cent identity with other available sequences of dogs viz. with Thailand, Junagadh, West Bengal, Kolkata, China, Chile, Brazil, Ludhiana, France etc. Our study revealed that the 18S small subunit rRNA gene of B. canis has 100% query cover with Junagadh, West Bengal, Kolkata, Chile, Brazil, Ludhiana’s B. canis vogeli strain as well as B. canis strain of Thailand, France and Brazil (Fig 4). This is an important finding of our study as this is not reported in earlier studies and also the strain present in Rajasthan is B. vogeli which is symptomatically same as B. canis, which needs to be characterized at a large scale for the diagnosis purpose. This shows 57.07% similarity with B. vogeli Junagadh strain, 56.54% with West Bengal, Kolkata, Chile and Brazil of B. canis vogeli strain and B. canis strain of Thailand, France and Brazil whereas 48.17% Ludhiana B. canis vogeli strain (Fig 4). Maximum likelihood phylogenetic analysis showed that our sequence is very closely related to that of B. canis vogeli strain of Ludhiana followed by B. canis vogeli strain of Kolkata and distantly related with B. canis of China and B. canis vogeli of Junagadh (Fig 4). The possible reason for this variation is that some addition and deletion is existing in our population which are not present in any other studied sequence and there are some substitutions also there in our population (Fig 5).




       
The results emphasize the heightened sensitivity of PCR as a diagnostic tool for detecting Babesia infections, especially in subclinical cases where low parasitaemia might escape detection through light microscopy. Traditional methods of diagnosis of babesiosis in dogs are based on the morphologic appearance of intra-erythrocytic piroplasm seen in peripheral blood smears. Microscopic examination of Babesia is effective in the acute phase, but in chronic and/or subclinical infection, the disease tends to be associated with cryptic infection, which often limits the sensitivity of microscopic examination. Intra-species differentiation is also not possible through microscopic examination (Shaw et al., 2001). Whereas light microscopy has a detection limit of approximately 0.001% parasitaemia, PCR could even detect parasite loads in the range of 50 organisms/ml (Birkenheuer et al., 2003) and 9 parasites/μl (Matsuu et al., 2005).
       
A previous study conducted by Godara et al., (2010) in the Jaipur region showed a 13.1% prevalence of canine babesiosis. Another study conducted by Yoak et al., 2014 showed a 10% prevalence of B. canis in Jaipur. According to Jumde et al., (2011), Shrivastava and Shukla (2013) and Das and Konar (2013), the prevalence of canine babesiosis was 8%, 6.93% and 8.51% in Nagpur, Jabalpur and West Bengal, respectively, which is comparable to our findings. Kopparthi et al., (2021), Obeta et al., (2020) and Chaurasia et al., (2022) were found 11.8%, 10.8% and 9.8% positive cases through microscopic blood smear examination.
       
The PCR result is in the accordance with Gonmei et al., (2020) and Panda et al., (2021) who detected 28.3% and 19.19% incidence, respectively. Higher species-wise prevalence rate of Babesia canis was also reported by Bilwal and Mandali (2016), who recorded the prevalence rate of Babesia canis i.e., 88.89% and Babesia gibsoni 11.11%. The higher prevalence of B. canis was also recorded by Abd Rani et al., (2011).
       
The prevalence of Babesia canis and Babesia gibsoni in dogs can vary depending on the region and the breed of dog. The prevalence of Babesia canis infection can be influenced by the geographical distribution of its tick vectors.
               
The 18S rRNA gene sequencing of Babesia canis from Rajasthan showed a high degree of similarity to global B. canis vogeli strains, including those from Junagadh, West Bengal, Thailand, France and Brazil, with 100% query coverage. Phylogenetic analysis revealed a close genetic relationship with Ludhiana’s B. canis vogeli strain, followed by the strain from Kolkata, while showing greater divergence from strains in China and Junagadh. These findings suggest regional genetic variations, potentially due to unique insertions, deletions, or substitutions, highlighting the need for extensive sequencing across regions to improve diagnostics and characterization of B. canis strains.

In the present study, Babesia infection was diagnosed using conventional technique i.e., light microscopy and molecular technique i.e., PCR. The microscopic examination is cost-effective and rapid but the PCR is a more specific and sensitive test because it differentiates the Babesia species that is difficult to identified morphologically by blood smear examination. PCR also detect a low level of parasitaemia which cannot be detected by blood smear examination.
               
In this study, we can conclude that the occurrence of canine babesiosis was found at 7% through light microscopy and 24% through PCR technique. Babesia canis species was found in PCR results and none of the sample was found positive for B. gibsoni. More studies are further needed towards confirming the trend of different species of babesia and other blood protozoa in canines of this area.

The authors are grateful to the Dean, Post Graduate Institution of Veterinary Education and Research (PGIVER), Jaipur and Principal investigator Dr. D. S. Meena of Centre for Diagnosis, Surveillance and Response of Zoonotic Diseases (CDSRZ), PGIVER, Jaipur for providing the required facilities for this research work.
 
Disclaimers
 
The perspectives and conclusions presented in this article are solely those of the authors and do not necessarily represent the views of their affiliated institutions. While the authors have carefully ensured the accuracy and completeness of the information shared, they disclaim any liability for direct or indirect losses that may result from the application of this content.
 
Informed consent
 
All procedures involving animals in this study were approved by the Committee for Experimental Animal Care and were conducted in accordance with the guidelines set forth by the University Animal Care Committee.

The authors affirm that there are no conflicts of interest regarding the publication of this article. This work was conducted independently, with no external funding or sponsorship influencing the study design, data collection, analysis, decision to publish, or manuscript preparation.