Prevalence, Molecular Identification and Phylogenic Analysis of Hepatozoon canis from Naturally Infected Dogs in Andhra Pradesh, South India

Hepatozoonosis in dogs was first described in 1905 by Bentley as leucocytozoan of canines responsible for causing the disease. H. canis is widely distributed in Africa, South western Asia, South and  North America whereas H. americanum  is restricted to USA (Baneth et al., 2003). There are scanty reports on molecular detection of Hepatozoon canis transmitted through brown dog tick  in India however few studies from Kerala have reported the infection by morphological studies of stained thin peripheral blood smears (Priya et al., 2004; Lakshmanan et al., 2018). However, molecular studies for detection of Hepatozoon canis has been carried out in Nigeria (Kamani et al., 2013), in Thailand (Kledmanee et al., 2009) and in India (Murugesan et al., 2017 and Lakshmanan et al., 2018). In Andhra Pradesh no attempt was carried out on molecular characterization of Hepatozoon canis associated with natural infections in dogs. Hence, the present study was undertaken by amplifying 18S rRNA gene of Hepatozoon canis using polymerase chain reaction and for better understanding of phylogenetic relationships.

The whole blood collected from the dogs of 23 Veterinary hospitals of Andhra Pradesh were subjected to examination at Tirupati Parasitology Laboratory for 8 months period (From May 2021 to December 2021). Immediately thin blood smears were prepared and stained with Giemsa stain. The Giemsa-stained blood smears were screened microscopically under 1000x microscope and haemoparasites were identified based on the morphological characters (Greene et al., 2008). Remaining blood was stored at -20°C for further DNA extraction. DNA was isolated from each blood sample (200 μL aliquots of EDTA blood, stored at -20°C) using a QIAamp DNA Blood Mini Kit (Quiagen ® Kit, Germany), according to the manufacturer’s instructions with slight modifications. Polymerase chain reaction was performed in a 25 µl of final reaction volume containing Taq DNA polymerase, DNA template, nuclease free water and primers. In the present study 18S rRNA gene of H. canis was amplified using the following primers designed for identification.

Hepatozoon FP 14094: ATACATGAGCAAAATCTCAACTT and Hepatozoon R14095: CCAACTGTCCCTATCAATCATTAA.

Cycling conditions  were carried out with initial denaturation at 94°C for 5 min followed by 34 cycles of denaturation (94°C, 30s), annealing (60-67°C, 30s) extension (72°C, 30s) and a final extension (72°C,30s) (Kledmanee et al., 2009). All the amplified products were subjected to electrophoresis using 2% agarose gel (Himedia Low EEO) containing 0.5 µg/ml ethidium bromide in 1x TAE buffer and visualized on UV transilluminator. The horizontal gel electrophoresis was carried out at 100 volts for 55 min. The amplified PCR products were verified by comparison with 100 bp ladder (Genei Merck, Bengaluru, India). and the image of the gel was captured by gel doc system (Bio-Rad). The amplicons were sequenced and compared with the sequences deposited at GenBank database. To validate the molecular identification the randomly selected DNA amplicons of 18s rRNA gene of H. canis were subjected to Boot srap analysis. The phylogenic analysis was carried out on partial sequencing of 18 srRNA gene of H. canis and the strains revealed closet association with other H. canis species from out side of India.

The microscopic examination of thin blood smears revealed typical gelatin capsule shaped gamonts inside neutrophils indicating Hepatozoon canis infection (Fig 1). Out of 97 samples examined, only two (2.06%) samples were found positive (Table 1). Out of 97 samples screened subjected to PCR analysis, nine samples - showed amplification of 737 bp DNA fragment specific to H. canis with prevalence rate of 9.28% (Table and Fig 2). The phylogenetic analysis revealed 100% similarity with 18S rRNA gene of Hepatozoon canis deposited at the GenBank database (Accession No:MZ460581) (Fig 3) and confirmed the pathogen as Hepatozoon canis. In the present study, PCR assay has shown more reliability as shown in Table 1.









The identification of Hepatozoon canis in the present study was done by detecting gametocytes in the blood smear of affected dogs and by amplifying a variable region of the 18S rRNA gene using nested PCR which was in accordance with the studies of (Allen et al., 2008; Li et al., 2008; Singh et al., 2017) and Mohanapriya et al., (2020). Identification of H. canis is based on clinical manifestations and through PCR assay (Lakshmanan et al., 2018). Abd Rani et al. (2011) reported that H. canis (30%) was the most common haemoparasite infecting dogs in India followed by E. canis (20.6%) and B. gibsoni (0.2%) based on Conventional PCR assay. Hepatozoon canis is transmitted by oral ingestion of infected ticks containing mature sporozoites (Baneth et al., 2007). Hepatozoon canis deserves attention on account of its pathogenicity in natural hosts (Baneth et al., 2003). The prevalence of H. canis is low compared to other canine haemoparasites in India. (Singh et al., 2012; Bhattacharjee and Sarmah, 2013). A Low prevalence of H. canis may be due to low detection limit of light microscopy and in contrast, higher prevalence of 30% was recorded by PCR studies in Namakkal, Tamil Nadu, India (Murugesan et al., 2017). So, PCR assay is most efficient tool for the detection of Hepatozoon canis infections in chronic cases which is in accordance with the studies of Otranto et al., (2011). In the present study, the sequence of 18S rRNA of H. canis was found to have complete homology with isolates of Chaina, Sudan, South Africa, Spain, Israil and Taiwan however, no published isolates are available for comparison with previous isolates in India, Whereas Miranda et al., (2014) reported a similar finding with 99.0 per cent homology. In accordance with the present results, many researchers observed low sensitivity of microscopy, while evaluating the efficacy of the molecular method and routine blood smears in the detection of tick-borne pathogens in dogs (Singh et al., 2014; Jain et al., 2018; Rucksaken et al., 2019).

During the present study, the correlation between incidence of Hepatozoon canis DNA with the presence of ticks (R. sanguineus) was not noticed in dogs which is in contrary with previous studies of Hepatozoon canis infection in dogs to be positively correlated with the presence of ticks (O’Dwyer et al., 2001, Forlano et al., 2005, Aktas et al., 2013). In this study out of 97 dogs only eight (8.71) dogs showed presence of ticks. Most of the sampled dogs did not show tick infestation which may be due to grooming activity by their owners. Hence, good care and management of pets by their owners may be the reason for lesser ticks’ infestation in the sampled dogs. Microscopy could be able to identify only 2.02 per cent prevalence of hepatozoonosis in the present study area indicating lesser reliability than PCR. Hepatozoon canis was the least prevalent (1.52%) haemoparasites in dogs in Krishna and nearby districts andhra Pradesh during last five years of study using microscopy (Sreedevi et al., 2020). Molecular technique (PCR) for H. canis has been utilized in various studies, worldwide and it has been shown to be a sensitive diagnostic technique (Inokuma et al., 2002; Rojas et al., 2014). In India, Singh et al., (2017) reported 13.78 per cent prevalence of canine hepatozoonosis from Punjab. Further molecular evidence of H. canis (6.1%), either as single or as concurrent infection, by the multiplex PCR assay indicated that the prevalence of canine hepatozoonosis is low in Andhra Pradesh state (Kopparthi et al., 2023).

The prevalence of hepatozoonosis in India, estimated either by conventional microscopic examination (Bhattacharjee and Sarmah, 2013; Gautam Patra et al., 2020; Sreedevi et al., 2020) or molecular studies (Laummaunwai et al., 2014; as in the present study), was comparatively low than other tick-borne infections. The reality that H. canis was less frequently found than Babesia spp. and E. canis in dogs from Andhra Pradesh might be correlated to the hypothesis that the local tick vector populations more frequently harbour some specific pathogens than others (Latrofa et al., 2014). Hepatozoonosis was even absent in certain regions of world (semiarid region of Brazil) though the tick vector Rhipicephalus sanguineus exist in that region (Rotondono et al., 2015). However, H. canis was the predominant species than other tick-borne pathogens identified in dogs from north, north-east and central parts of India (Abd Rani et al., 2011), Angola (Cordoso et al., 2016) and from Tamil Nadu, India (Manoj et al., 2020). Some haemoprotozoan diseases like babesiosis in dogs is endemic in tropical countries like India because of presence of tick vectors as well as reservoir stray dog population round the year (Kopparthi et al., 2021).

The study successfully detected the presence of Hepatozoon canis in naturally infected dogs in Andhra Pradesh, South India, utilizing both microscopy and conventional PCR methods.  The results indicated a low prevalence of 2.06% through blood smear examination, while PCR analysis showed a higher prevalence of 9.28%. The amplification of the 18S rRNA gene verified the identity of the pathogen, affirming the effectiveness of the conventional PCR in revealing more natural infections of Hepatozoon species. Additionally, it was noted that approximately 8.71% of the dogs were infested with ticks, specifically Rhipicephalus sanguineus, highlighting the importance of veterinary surveillance and the need for such assays in epidemiological studies to understand and combat tick-borne infections in canines.

The authors are grateful to the Dean, Sri Venkateswara Veterinary University for providing all the necessary facilities and infra structure to carry out the present study.

The authors declare that they have no conflict of interest.