Genetic Polymorphisms and Association of Growth Hormone Gene with Growth Traits in Beetal Goat

Beetal goats are vastly preferred for farming due to their superior body weight, milking strength and higher fecundity rate in tropical and sub-tropical regions of the world (Khan and Ashfaq 2012). It is recommended in J&K either in pure form or for up-gradation of non-descript goats for improving milk and chevon production to narrow down the gap between demand and supply.
       
Growth is primarily regulated by the growth hormone (GH), an anabolic hormone synthesized and secreted by the somatotroph cells of the anterior lobe of the pituitary (Bayan et al., 2018). It is a single polypeptide hormone of 191 amino acids with a molecular size of 22kDa (An et al., 2010). GH influences physiological processes such as growth, reproduction, lactation and metabolism (Bayan et al., 2018 and Gitanjli et al., 2020).
       
GH belongs to a family of somato-lactogenic hormones which is encoded by a single gene present on the short arm of chromosome 19q22 with 2.5 kb in length, consisting of five exons and four intervening introns. GH1 (A781G locus) and GH2 (A1575G locus) located on exon (2 and 3) and exon 4 having size of 422 bp and 116 bp, respectively (Hua et al., 2009). Polymorphism was reported for GH 1 and 2 locus by Aradhana et al., 2021, Pandya et al., 2021, Abbas et al., 2022 and Rashijane et al., 2022 in various goat breeds.
       
Association study of GH1 locus has been confirmed with different traits in goats such as body weight and chest girth at birth (Singh et al., 2015), birth and weaning weight and weaning chest girth (Hua et al., 2009), body weight (Gitanjli et al., 2020, Rashijane et al., 2022). Association between variants of GH2 locus has been reported with birth body weight (Hua et al., 2009 and Gitanjli et al., 2020), litter size and superovulation response (Zhang et al., 2011). To assess genetic variation in goats, GH gene is frequently explored for its biological significance. With this background, current study was undertaken to investigate the GH 1 and 2 locus polymorphism and its association with growth traits in Beetal goats.

Source population
 
The study comprised 60 Beetal goats maintained at Goat Dairy Farm (latitude 32.427828° N and longitude 75.402926° E), Rajbagh, Jammu, along with their growth traits at 0, 3, 6, 9 and 12 months of age. The study was carried out in the Division of Animal Genetics and Breeding, Faculty of Veterinary Sciences and Animal Husbandry, SKUAST-Jammu.
 
DNA isolation
 
Under sterile conditions, blood sample (5 ml) was taken from the jugular vein aseptically in a sterile EDTA-coated vacutainer. DNA was isolated from blood samples as per the protocol of the genomic DNA Blood mini Kit. Nano-drop spectrophotometer was used to determine the purity and concentration of genomic DNA by taking the ratio of optical densities at 260 nm and 280 nm. The quality of the DNA was checked on 0.8% horizontal submarine agarose by electrophoresis. The gel was then examined on a UV trans-illuminator for quality assessment.
 
Polymerase chain reaction (PCR) amplification
 
A pair of primers (forward: 5'CTCTGCCTGCCCTGGACT 3' reverse: 5'GGAGAAGCAGAAGGCAACC3') and (forward: 5'TCAGCAGAGTCTTCACCAAC3'reverse:5' CAACAACGCCATCCTCAC 3') were used to amplify a 422 bp and 116 bp PCR product for GH 1 and 2 locus respectively (Hua et al., 2009). For GH 1 and 2 locus; PCR reaction was carried out in PCR tubes containing 1 µl of genomic DNA, 0.5 µl of (10 pm/ml) forward and reverse primers, 1 µl of MgCl₂ (4mM), 12.5 µl of 2X PCR master-mix and 9.5 µl of distilled water to make final reaction mixture of 25 µl. Amplification was accomplished in Eppendorf thermal cycler using Touch- down program having 13 cycles of denaturation at 95°C for 30 sec, annealing temperature at 65°C (-1°C per cycle) for 30 sec and extension at 72°C for 45 sec followed by constant annealing temperature of 52°C for 30 sec for the remaining 23 cycles. Initial denaturation was carried out at 94°C for 5 min, while the final extension was performed at 72°C for 7 min. The PCR product (5 µl) from each tube was methodically mixed with 1 µl of 6× loading dye buffer and loaded on 2% agarose gel containing ethidium bromide (1% solution @ 5 µl/100 ml) along with 100 bp DNA ladder at a constant voltage of 80 V for 45 min in 0.5 × TBE buffer. For confirmation of the amplification of the targeted gene, the amplified PCR product was visualized as a single compact band under a UV transilluminator and documented by gel photography.
 
Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method
 
PCR products of GH 1 and 2 locus were further digested with restriction enzyme HaeIII (GG↓CC) for perceiving the PCR-RFLP band patterns. The total reaction mixture of 30 µl consisting of 10 µl PCR product and the rest 20 µl consisting of HaeIII, 10x buffer and nuclease-free water was taken into a microcentrifuge tube. For uniform mixing, the reaction mixture was spun for a few seconds and then kept for 15 min at room temperature. The digested products were electrophoresis on 2.5% agarose gel comprised of 1% ethidium bromide (5 µl/100 ml) at a constant voltage of 80V for 60 min using 0.5× TBE buffer till the dye front reached the last third of the gel. For visualization of DNA ladder (molecular size marker) and digested products UV transilluminator was used afterward photographed with gel documentation system. Genotyping was carried out according to the band pattern of respective genotypes.
 
Statistical analysis
 
Based on the outcome of genotyping: genotypic frequencies, allelic frequencies, Hardy-Weinberg equilibrium (HWE) as well as population genetic indexes such as gene homozygosity (Ho), gene heterozygosity (He), effective allele numbers (ne), Shannon’s Information index (I) and fixation index (Fis) were analyzed by POPGENE 32 version 1.32 software (Yeh et al., 1999).
       
The polymorphism information content (PIC) was calculated as per Botstein et al., (1980). The data on growth traits (0, 3, 6, 9 and 12 months of age) were analyzed with the help of the Statistical Package for Animal Breeding (SPAB2) programme (Sethi, 2006). The following model was used for this purpose:
Where,
Y_ij = Performance traits of ith genotype;                                  µ = Overall performance;
G_i = Effect of ith genotype                                                        e_ij = Random effect of error.

The amplified PCR product of GH 1 and 2 locus revealed a single compact band of 422 bp and 116 bp size respectively in Beetal goat. The PCR product of the 422 bp size was also reported for GH1 locus by Hua et al., (2009) in Boer goats, Marini et al., (2015) in Savanna goats, Gitanjli et al., (2020) in Gaddi goats, Aradhana et al., (2021) in Ganjam and Baigani goats and Pandya et al., (2021) in Surti goats. Whereas, for GH 2 locus PCR product of 116 bp size was obtained, the same was reported by Hua et al., (2009) in Boer goats, Bayan et al., (2018) in Surti and Mehsani goats, Mahrous et al., (2018) in three goat breeds of Egypt, Gitanjli et al., (2020) in Gaddi goats and Abbas et al., (2022) in five goat breeds of Iraq.
       
Restriction digestion of PCR product of GH1 locus with HaeIII enzyme revealed three types of genotypic band patterns as shown in Fig 1. The RFLP patterns were AA (422 bp), BB (366 bp, 56 bp) and AB (422 bp, 366 bp, 56 bp) genotypes. Out of the total products (n=60) for GH1 locus, 03 homozygous (AA), 48 heterozygous (AB) and 09 homozygous (BB) genotypes were found. Similar RFLP patterns were reported in native goat breed of Kerala (Radhika et al., 2016), Gaddi goat (Gitanjli et al., 2020) and Surti goats (Pandya et al., 2021). On the contrary, AA genotype of 422 bp was not found in Kacang goat (Ilham et al., 2016), Surti and Mehsana goat (Bayan et al., 2018), Lakor goat (Kunda et al., 2020) and female goats from different herds i.e., native, Shami, Meriz, Kamori and wild mountain goat (Abbas et al., 2022).
 

       
Restriction digestion of PCR product of GH 2 locus with HaeIII restriction enzyme revealed only one type of genotype band pattern as shown in Fig 2. The RFLP pattern (88 bp, 28 bp) was symbolized as BB type whereas; genotypes AA and AB were absent. Similar, RFLP patterns were revealed by Bayan et al., (2018) in Surti and Mehsani goat, Shareef et al., (2018) in Beetal goat and Abbas et al., (2022) in female goats from different herds. Contrary to the present findings, Mahrous et al., (2018) in three goat breeds of Egypt reported two homozygous genotypes AA (116 bp) and BB (88 bp and 28bp) and Gitanjli et al., (2020) in Gaddi goats of Western Himalayas reported AB (116 bp, 88 bp and 28 bp) and BB (88 bp and 28bp) genotype. Likewise, Susilorini et al., (2017) in Etawah goats reported two genotypes CC (116 bp and 88 bp) and CD (116 bp and 88 bp and 28 bp) however; they have used different nomenclature.
 

       
The genotypic frequencies for GH1 locus were found to be 0.05 for AA genotype, 0.80 for AB genotype, 0.15 for BB genotype, the gene frequencies were found to be 0.45 for A allele, 0.55 for B allele. The highly significant (P<0.01) Chi-square (χ^²)-test value for GH1 locus showed that the population was not in  HWE (Table 1) which might be due to selection or small population. For GH 2 locus, only one genotype BB was observed. Similar results for GH 1 locus were reported by Bayan et al., (2018) in Surti and Mehsana goats, Gooki et al., (2018) in Raini Cash mere goats and Pandya et al., (2021) in Surti goats. Contradicted findings are reported by Gitanjli et al., (2020) in Gaddi goats of Himalayas and Rahijane et al., (2022) in Boer goat.
 

 
Population genetic indexes
 
Population genetic indexes such as Ho, He, ne, I, Fis and PIC values for GH1 locus are shown in Table 1. It was observed that Ho (0.501) value was more than He (0.499) value. It indicates that the homozygosity was more in the Beetal goat population. Similar finding was reported by Gooki et al., (2018) in Raini Cashmere goat. In contrast the results obtained in the study were not in concord with the result of Gitanjli et al., (2020) in Gaddi goats and Abbas et al., (2022) in female goats from different herds in which Ho was less than He. Effective number of alleles (ne) for GH1 locus was found to be 1.980. Similar finding was reported by Gooki et al., (2018) in Raini Cashmere goat and Gitanjli et al., (2020) in Gaddi goats. Shannon index (I) is an information statistic index, was found to be 0.688. FIS were found to be -0.616. The result obtained in this study was in agreement with those reported by Gooki et al., (2018) in Raini Cashmere goat and Gitanjli et al., (2020) in Gaddi goats. The estimated PIC value showed median level polymorphism of 0.37. Similar result was reported by Kunda et al., 2020 in Lakor goat. PIC for co-dominant markers, the estimated value was median polymorphism (0.37) for GH1 locus. Thus, 37 per cent of the off spring should be informative.
 
Association of GH 1 and 2 locus polymorphic variants with growth traits
 
Least squares analysis of variance among the growth traits for different genotypes of GH1 locus revealed non-significant differences at 0, 3 and 6 month of age whereas, highly significant (P<0.01) differences were observed at 9 and 12 month of age in Beetal goat (Table 2). The values of least square means of growth traits at 9 month for GH1 locus were found significantly (P<0.01) higher in BB genotype (17.178±0.491 kg) and was least in AB genotype (15.110±0.212 kg) with intermediate value for AA genotype (16.500±0.850 kg). But at 12 month, values of least square means of growth traits were found significantly (P<0.01) higher in BB genotype (23.667±0.555 kg) followed by AA genotype (21.667±0.961 kg) and lowest in AB genotype (19.785±0.240 kg) for GH1 locus. Similar finding was reported by Gitanjli et al., (2020) and Pandya et al., (2021) reported superiority of BB genotypes at 9 month of age (Gaddi goats) and 6 months of age (Surti goats), respectively. Non-significant association among genotypes with body weight, growth and morphometric traits was reported by Radhika et al., (2016) in native goat breed of Kerala, Aradhana et al., (2021) in Ganjam and Baigani goats and Rahijane et al., (2022) in Boer goat respectively. Deviation in the results obtained in the study may be due to population size, breed, environmental condition, complex genotype-environment interactions, difference in the managemental practices and area specific breeding polices.
 

In this study, PCR-RFLP investigation revealed that GH1 was found to be polymorphic and GH2 was monomorphic in Beetal goat by using restriction enzyme HaeIII. The BB genotype has significant association with higher body weight followed by AA and AB genotype at 9 and 12 month of age that might be a putative genetic marker for early selection of goat for improving body weight through marker-assisted selection.

We are thankful to the Director, Department of Sheep Husbandry, Officer and staff members of Goat Dairy Farm, Rajbagh, Jammu, India for providing blood samples and data of Beetal goat.

All authors declare that they have no conflicts of interest.