First Report of Two Bacterial Diseases from the Freshwater Fishes of the Andaman Islands, India

The Andaman and Nicobar Group of Islands (ANI) is a union territory of India, comprising 572 islands located in the Southeast of the Bay of Bengal, close to South East Asia. These Islands are known for their rich biodiversity containing unique, endemic flora and fauna. Biogeographically andaman and Nicobar Islands are very rich, harbouring unique endemic life forms. The islands are unique compared to mainland India in terms of the scope they offer for integrated development of all sectors of culture fisheries namely, freshwater, brackish water and mariculture (Saravanan et al., 2015). Freshwater aquaculture is one of the agro-allied activities in the Andaman group of Islands, which chiefly involves farming Indian major carp, Catfishes, Chinese carp and freshwater prawns (Kiruba Sankar et al., 2018).
       
There is an increasing demand for freshwater fish in the local market, due to which the food fish are also being imported from mainland India for consumption purposes.
       
At present, approximately 2500 minor irrigation ponds are available in the Andaman and Nicobar Islands which are used for irrigation purposes as well as for aquaculture. In recent times, ornamental fishes have also been imported into the Andaman Islands, especially in the capital city Port Blair due to the demand among aquarium hobbyists and for recreational purposes. Government and other agencies are planning to intensify aquaculture activity in these Islands; however, it is known that diseases are the major and primary constraints for any aquaculture activity (Assefa and Abunna, 2018). Worldwide Aeromonas sp. such as A. hydrophila and A. veronii are known to cause bacterial hemorrhagic septicemia, motile aeromonad septicemia and epizootic ulcerative syndrome (Özcan, 2023; Sharma et al., 2013). Similarly, Pseudomonas spp. has also been identified as the primary pathogen of several diseases causing septicaemia and haemorrhagic lesions on skin, fins and tail in farmed fish (Mishra et al., 2017; Duman et al., 2021). The very first fish disease reported from the freshwater fishes from Andaman Island is abdominal dropsy in Indian major carp (Cirrhinus mrigala) from South Andaman caused by a highly virulent strain of Aeromonas hydrophila (Shome et al., 1996); subsequently, Shome (1999) reported milder and chronic form of disease with thinning of musculature, fluid accumulation in the abdomen without hemorrhagic ulcers and erosion of the scales in Catla catla caused by A. hydrophila. Apart from these two earlier reports, there exists no report of bacterial diseases recorded in the freshwater fishes from the Andaman Islands. In this work, two bacterial diseases causing emaciation, scale loss and abdominal dropsy in Barbonymus gonionotus and Cyprinus carpio var. Koi is reported, constituting the first new report from these Islands.

During May 2022, twenty-five specimens of Barbonymus gonionotus showing emaciation and tail rot syndrome (ETS) and three specimens of Cyprinus carpio var. Koi showing big belly syndrome (BBS) disease symptoms were collected from a fish pond and an aquarium outlet located in the South Andaman district, respectively. The diseased fishes were packed in a polythene bag filled with aerated water and transported to fisheries science division laboratory of ICAR-CIARI, Port Blair for investigation.
       
The clinical signs and symptoms were noted. The fishes were subjected to bacteriological investigation; organs like spleen, liver and kidney were used for bacterial isolation. TSA broth and agar (tryptic soy broth and agar) were employed for bacteria isolation for 24 h at 28°C and the dominant uniform bacterial colonies were purified by streaking onto the TSA agar plates twice. A single bacterial colony was selected and inoculated in TSA broth for 14 hr at 28°C, then preserved at -80°C in the TSA medium containing 20% (v/v) sterile glycerol.
       
Suspected bacterial colonies were identified and purified and the following biological and biochemical tests were carried out using a kit (Hiimedia): 1) Gram stain, shape, motility and colony pigmentation; 2) Growth in 0.00-3.00% NaCl; 3) Biochemical tests including catalase, oxidase, indole, H₂S, lysine decarboxylase, ornithine decarboxylase, methyl red, Voges-Proskauer, nitrate reduction, utilization of dextrose, maltose, sucrose, trehalose, mannitol, galactose, mannose. Bacterial DNA was extracted from the pure colonies using DNAZOL reagent (Thermo Fisher Scientific) following manufacturer protocol. The bacterial DNA was subjected to the PCR amplification of the 16S ribosomal RNA (16S rRNA) using the primers set (16S-F: AGAGTTTGATCCTGGCTCAG; 16S-R: TACGGCTACC TTGTTACGACTT) PCR cycling conditions of Weisburg et al., (1991). The amplified PCR products were sequenced using the same primers mentioned above using an ABI 3500DNA analyzer (Eurofins Pvt. Ltd., Banglore, India). The homology of the generated sequence was analyzed using the Basic Local Alignment Search Tool (BLAST) program in the National Center for Biotechnology Information (Altschul et al., 1990) to find the closest sequences available in GenBank (www.ncbi.nlm.nih.gov). The generated sequences were submitted to GenBank under the accession numbers OK602698 (Aeromonas veronii), OK602699 (Aeromonas sp.), OP081425 (Pseudomonas alcaligenes). Additional sequences of the 16S rRNA gene sequences of bacteria were downloaded from GenBank to construct a phylogenetic tree using MEGA X (Kumar et al., 2018) (Appendix 1). The best-fit nucleotide substitution model was selected from 24 models based on the lowest Bayesian information criterion (BIC) score, which was considered to describe the best substitution pattern (Nei and Kumar, 2000). Model tests suggested the best-fit nucleotide substitution model be a general time reversible (GTR) model with maximum likelihood value (lnL) and gamma distribution (G) [BIC =4868.9, lnL = -2396.3, (+G) = 0.2]. The phylogenetic tree was constructed based on the maximum likelihood fits in MEGA X. Reliability of the phylogenetic tree was estimated using bootstrap values based on 1000 iterations.


       
The organs from infected fishes were preserved in neutral buffered formalin (NBF) for histopathological studies before being transferred into 70% ethanol. Embedding and sectioning of paraffin blocks were then carried out. The obtained slides were stained with hematoxylin and eosin (H and E). To fulfil Koch’s postulate a re-infectivity study was also conducted in Catla catla fingerlings by intraperitoneal inoculation of live A. veronii and P. alcaligenes whole cell suspension (12 hr old) at a concentration of 1.5×10⁹ CFU/0.2 ml/fish and PBS as a control. The bacteria was further isolated from dead and surviving fishes.

The 25 specimens of B. gonionotus appeared emaciated with hazy eyes, ulcerated fins and loss of scales. The sick fishes isolated themselves from the crowd and also appeared pale. Dissection of the fish revealed a greenish fluid-filled abdomen, congested intestine, pale kidney and liver (Fig 1A). The fish underwent slow mortality over 8 days. The C. carpio var. Koi had scale loss and a bulged abdomen (Fig 1B). Dissection of the fish revealed a clear, fluid-filled abdominal cavity, pale kidney and liver. Two live specimens of BBS fish underwent mortality after 15 days. The tissue smears from both the host fishes resulted in three dominant colonies on BHI plates, viz., two colonies from ETS fishes and one colony from BBS fishes. The colony characteristics and biochemical results are provided in Table 1. Sequencing of the amplified PCR product revealed the two isolates from ETS fish to be Aeromonas veronii and an unknown Aeromonas sp. and one isolate from BBS fish to be Pseudomonas alcaligenes showing 100% BLAST similarity with the existing GenBank sequences. Phylogenetic analysis of the generated sequences further confirmed the species and genus identity of the isolated pathogen (Fig 2). The histology of ETS fish revealed hyperplastic and congested secondary gill lamellae with leuckocytic infiltration (Fig 3A); the liver tissue had hepatocyte vacuolar degeneration and granuloma (Fig 4A), the kidney tissue had dilated tubule and damage of basal lamina (Fig 5A); the heart tissue revealed vacuolization of cardiomyoctes (Fig 6A). The intestinal section revealed edema and hemorrhage of gastric submucosa with macrophage infiltration. The gill of BBS fish had edema of secondary gill lamellae (Fig 3B). The liver section revealed the disorganization of hepatic tissue architecture in perivascular region (Fig 4B). The kidney tissue had coagulative necrosis and haemorrhage (Fig 5B); the heart tissue had necrosis of cardiomyocytes and aggregation of inflammatory cells (Fig 6B). Brain section revealed degeneration of meninges and granular layer. Re-infectivity studies in C. catla fingerlings demonstrated the A. veronii and P. alcaligenes to cause 50% and 20% mortality after 5 to 6 days post-inoculation, respectively. The C. catla fingerlings injected with A. veronii demonstrated mild hemorrhagic septicaemia on the flanks and caudal peduncle, whereas in fishes injected with P. Alcaligenes mild dropsy was observed. The pathogens could also be re-isolated from the internal organs of both the dead and the surviving fishes.
 

 

 

 

 

 

 

       
Shome et al., (1996) recorded many sporadic cases of death in  C. mrigala having symptoms of thinning of musculature giving a big head appearance, fluid accumulation in the abdomen without haemorrhagic ulcers and erosion of the scales; subsequently, it was concluded that the causative agent of the disease to be a different strain of A. hydrophila.In the present work, probably the same disease case manifesting an emaciated body, thinning of the musculature, erosion of scales and fluid-filled abdomen is recorded in B. gonionotus with the main causative agent being A. veronii and an unknown Aeromonas sp. The pathogenic potential of these two isolates was further confirmed by the histopathological evidence on the host tissues.
       
Shome et al., (1999), reported A. hydrophila causing acute infectious abdominal dropsy and ulcerative diseases in Indian major carps from South and Middle Andaman Islands, however, in the present work, abdominal dropsy is reported in C. carpio var. koi, a cyprinid imported into Andaman for the aquarium trade and the pathogen isolated being P. alcaligenes. Pseudomonas alcaligenes was also isolated from Betta splendens having big belly syndrome from Thailand (Dong et al., 2018). Worldwide, Aeromonas and Pseudomonas infections were known to be the causative agent for ulcerative syndrome, bacteria hemorrhagic septicemia, tail and fin rot; bacteria gill rot and dropsy (Snieszko and Bullock, 1968; Kazimierczak et al., 2019). Shome et al., (2005) also reported heavy dropsy outbreaks in the Indian major carp from Andaman, Meghalaya and Assam. The present record of A. veronii, Aeromonas sp. and P. alcaligenes in the two exotic cyprinids confirms that these pathogens are capable of causing infections in Indian major carps as evidenced in the re-infectivity studies in C. catla fingerlings. The present study also alerts fish farmers and aquarium hobbyists to take appropriate control and preventive measures for the management of ETS and BBS in fish. This study also offers scope for exploration of treatment protocols against these isolated pathogens.

The present work offers scope for the development of better management practices and treatment protocols for controlling ETS and BBS in freshwater fishes. The figures, test results and DNA sequences generated in the work will enable future researchers to work on the isolated pathogens.

The work was carried out under external funded project on “National Surveillance Programme for Aquatic Animal Diseases (NSPAAD)” in which ICAR-National Bureau of Fish Genetic Resources (NBFGR), Lucknow served as the coordinating agency. The funding support to NSPAAD under Pradhan Mantri Matsya Sampada Yojana from the Department of Fisheries, Ministry of Fisheries, Animal Husbandry and Dairying, Government of India is thankfully acknowledged. The authors would like to thank National Fisheries Development Board (NFDB) and Indian Council of Agricultural Research (ICAR) for the support. The authors also express their gratitude to the Director, ICAR-CIARI for providing the necessary support to conduct the present study.