Efficacy of Green Silver Nanoparticles (GAbNPs) against Multidrug Resistance in Staphylococcus aureus from Mastitis-infected Cows

Mastitis in dairy animals is one of the most significant diseases costing the nation substantially in terms of economic output. Mastitis represents around 38% of the total direct costs of common industrial infections globally (Kossaibati and Esslemont, 1997). In India, mastitis-related economic losses have increased by roughly 115 times during the past five decades (Dua, 2001). Bacteria are more likely accountable and most frequently enter the teat canal through the teat opening, multiply quickly and then generate toxins and other enzymes, which trigger an inflammatory response. Staphylococcus is one of the main bacterial genera that cause mastitis in dairy cattle. S. aureus is one of the leading sources of intramammary infections in dairy cows (Dufour et al., 2012), which has a severe negative impact on the health of animals and the level of production as a whole. Antimicrobials have been used extensively and will continue to be utilized in veterinary and human medicine to treat bacterial ailments. However, drug-resistant bacteria are one of the emerging threats in the world today. Multidrug-resistant bacteria spreading into the community is a critical trend that is linked to higher morbidity, death, healthcare expenses and antibiotic use. To overcome the crisis of drug resistance, other alternatives are being researched and one of them is the use of nanoparticles. However, nanoparticles of metal origin come with certain risks to health and the environment. Hence, the quick, environmentally safe, nonpathogenic and economical protocol of using plants to produce green nanoparticles has gained interest in recent years, since it offers a single-step technique for the biosynthetic process. The simplest and least expensive method to make nanoparticles is to reduce and stabilize metal silver ions using a mixture of biomolecules that are already present in plant extracts, such as proteins, amino acids, polysaccharides, terpenes, alkaloids, phenolics, saponins and vitamins (Roy et al., 2017). Plant-assisted reduction is the primary mechanism for this process because of phytochemicals. The relatively high concentrations of the reducing agents (steroids, saponins, carbohydrates and flavonoids) and capping agents (phytoconstituents) ensure the stability of the green nanoparticles (Sondi and Salopek-Sondi, 2004).

A total number of 250 HF-cross breed cows belonging to different unorganized farms located in and around Shirwal town, Dist. Satara, Maharashtra, India, were screened for the presence of mastitis by California Mastitis Test (CMT). CMT-positive samples were considered for further processing. Samples were brought to the laboratory on ice and processed immediately. Collected mastitic milk samples were subjected to the isolation of organisms as per the standard methods described in Bergey’s Manual of Systematic Bacteriology, 1986. The samples were inoculated on media such as Blood agar and Nutrient agar and other selective and differential media such as Mannitol salt agar (MSA), MacConkey agar and Eosin methylene blue (EMB) agar. Inoculated plates were incubated aerobically at 37°C for 24 hours and examined for growth, pigmentation, hemolysis and colonial morphology. Yellow, round colonies presumptive of S. aureus were further confirmed by biochemical tests and PCR assay. Extraction and purification of DNA of S. aureus was carried out by snap chill method (Alwan and Talak, 2015). Briefly, pure colonies were selected from the Mannitol Salt agar and mixed with 150 µl of nutrient broth. Then this mixture was boiled for 10 min at 91°C and immediately kept in crushed ice for snap chilling for about 10 min. After chilling tubes were centrifuged at 10000 rpm for 10 min. The supernatant was used as template DNA. Purified DNA were processed for S. aureus-specific 16s-rRNA gene (Akindolire et al., 2015) as well as species-specific nuc gene PCR (Zhang et al., 2004). The primer sequences employed were 16s-rRNA F 5'GTAGGTG GCAAGCGTTACC3' 16s-rRNA R 5’CGCACATCAGCG TCAG3' and nuc F 5'GCGATTGATGGTGATACGGTT3' nuc R 5'AGCCAAGCCTTGACGAACTAAAGC3', respectively. The reaction was carried out in 25 µL volumes. Each PCR reaction mixture comprised 12.5 µL Himedia PCR mix, 1 µL each of forward and reverse primers, 3 µL of DNA and volume was made up to 25 µL using nuclease-free water. PCR amplification conditions for 16s-rRNA consisted of: Initial denaturation at 94°C for 05 min; followed by 30 amplification cycles of denaturation at 94°C for 30 sec, annealing at 64°C for 30 sec and extension at 72°C for 1 min, final extension step at 72°C for 5 min, before cooling to 4°C. To carry out PCR amplification for nuc gene, the master mix was the same as described above, The PCR conditions were as follows: Initial denaturation at 94°C for 05 min; followed by 30 amplification cycles of denaturation at 94°C for 1 min, annealing at 50°C for 1 min and extension at 72°C for 2 min, final extension step at 72°C for 10 min, before cooling to 4°C (Table 1).



Antibiogram sensitivity patterns of target organism S. aureus isolates (n=170) from mastitis milk were interpreted using the Kirby Bauer disc diffusion method (Bauer, 1966) using commercially available antibiotic discs of M/s HiMedia Laboratories Pvt. Ltd., India, as per Clinical and Laboratory Institute (CLSI, 2018) guidelines (Table 2). Studies were aimed at the detection of AMR in S. aureus isolated from mastitis against multiple classes of antibiotics hence, analysis of multiple antibiotic resistance and the genes expressing it in S. aureus was performed by PCR with multiple oligonucleotide sequence primers (Table 3). AMR genes like mecA gene for methicillin, tetK, tetM for Tetracycline, ermA, ermC for Macrolide, Lincosamide, aacA for Aminoglycosides, vanA, vanB genes for Vancomycin resistance, mrsA, mrsB genes for Macrolide resistance were evaluated in three different sets of Multiplex PCR. In set I Multiplex PCR of mecA, ermA, ermC, tetK, tetM, aacA, While Set II Multiplex PCR was performed for vanA and vanB and Set III for mrsA and mrsB genes. For efficacy studies of GAgNP 10 isolates of exhibiting resistance to more than three antibiotics identified as MDRSA were randomly chosen having CFU much above permissible reference range (Mean range of 7.161±0.00866 to 9.083333±0.025783) for efficacy studies of GAgNPs.





For this study preparation of green silver nanoparticles were synthesized from Silver Nitrate reduced with Azadirachta indica leaf extract as per Roy et al., (2017) with slight modifications (Fig 1). Fresh green fully grown leaves were collected and thoroughly washed, twenty grams of it were finely chopped, added to 100 ml of double-distilled water and boiled for 10 min. The extract was cooled, filtered and stored in the refrigerator at 4°C-8°C until further use. Silver nitrate solution 0.1N (HiMedia Pvt. Ltd., India) was used for the green synthesis of GAgNPs. A set of 05 clean sterile test tubes were taken and labelled. Then 1 mL, 2 mL, 3 mL, 4 mL and 5 mL of neem extract respectively, were added to test tubes and 1ml of silver nitrate solution was added to each test tube. The test tubes were covered with silver foil and the entire set was incubated in the dark chamber to minimize the photo-activation of silver nitrate at room temperature for 48 hours. The color change from colorless to brown confirmed the reduction of silver ions. The optical density of the extract was measured to determine the concentration of GAgNPs formed by taking 50 µL of each in an ELISA plate and using an ELISA reader at different wavelengths of 405 nm, 420 nm and 450 nm, to record peak absorbance. The synthesis of GAgNP, their size and their antimicrobial activity against random ten isolates with MDRSA was evaluated with the Agar well diffusion method, MIC. Also Transmission Electron microscopy (TEM) images of GAgNP were taken by an Electron Microscope (JEOL JEM- 1011 100 kV model) (Fig 2).





To determine the effective GAgNP prepared from the suitable ratio of silver nitrate to neem leaf extract for implementation in the actual efficacy studies, it was first assessed for its efficacy by agar well diffusion test as per Roy et al., (2017) in five different ratios of neem extract to silver nitrate: N1 (1:1), N2 (2:1), N3(3:1), N4(4:1), N5(5:1).

The antimicrobial activity of the prepared GAgNP was assessed by performing the MIC using the method described by Loo et al., (2018) with slight modification. The MIC was performed in a 96-well flat-bottom micro-titer plate using the broth micro-dilution method. The bacterial inoculums were adjusted to the concentration of 105 CFU/mL samples as described in the manual of the American Society for Microbiology (2016). The 100 µL stock solution of GAgNPs were added in duplicate plates, one for RPMI and other for MBC. The drug was further diluted two-fold in 100 µL of NB starting from the highest concentration in column 12 to the lowest in column 03 while, column 01 served as the negative control (only medium) and column 02 served as the positive control (medium and bacterial inoculums). Each well of the microtiter plate was added with 100 µL of bacterial inoculums except negative control. Every well was added with 30 µL of the Resazurin solution and readings were taken after incubation at 37°C for 3 h, 6 h, 9 h, 12 h and 24 h, respectively. The mixture in every well was observed for visible change in color as per protocol of test, wherein, blue /purple color indicated no bacterial growth while the pink color or no change in color indicated bacterial growth in the well. Simultaneously, MBC (minimum bactericidal concentration) was checked by inoculating the mixtures of drug dilutions and bacterial inoculum mixtures in every wells of ELISA plate by inoculating it on agar plates and observing plates for any growth of MDRSA after incubation of 24 h. The lowest effective broth dilution of GAgNPs was considered as effective MBC value. The synthesized GAgNPs were also comparatively tested for antibacterial properties against commercially available nanoparticles procured from GreenVision Life Sciences Pvt. Ltd., Pune, India, against MDRSA.  

Bacterial isolation and identification
 
From the suspected cases of symptomatically mastitis positive 250 cows screened, 170 were found CMT-positive out of which 30 cows had clinical mastitis with +++ reaction and the remaining 140 showed a reduction in average milk production with samples being ++ and + CMT reaction. The gram-positive organisms isolated were S. aureus 145/170 (85.29%), Bacillus spp. 40/170 (23.52%), coagulase-negative Staphylococci spp. 25/170 (14.70%), unidentified gram-positive bacillus 10/170 (5.88%) and Streptococcus spp. 02/170 (1.17%). Major gram-negative organisms isolated from mastitis milk samples of cows were E. coli 100/170 (58.82%). S. aureus being the target organism of the present investigation, all 145 isolates identified phenotypically and biochemically were reconfirmed by conventional with 16S-rRNA gene PCR showing 228 bp product (Fig 3A) on similar lines with Andrade et al., (2021) and species-specific 279 bp product of nuc gene (Fig 3B). 


 
Antimicrobial susceptibility of S. aureus organisms isolated from cow mastitis
 
In the present research only MDRSA were considered for the antimicrobial efficacy studies against GAgNP hence, the results of 60 MDRSA isolates detected showing resistance against different classes of antibiotics were analyzed. Out of 145 isolates of S. aureus, 60 isolates were found to have AMR by ABST as shown in Table 2. Further, 60 MDRSA isolates demonstrating multi-drug resistance were subjected to genotypic characterization of resistance genes (Fig 4). As shown in Table 4, overall, ermA gene was found in the highest number of samples, followed by aaca-D, tetK, ermC, mecA, vanB and mrsB. The genes tetA, mrsA and vanA were not present in any of the isolates tested. It was thus interpreted that in MDRSA highest resistance was displayed to ß lactam group of antibiotics followed by the macrolide group of antibiotics. This could be due to ß lactam group of antibiotics being commonly used to treat mastitis and subclinical mastitis and macrolide antibiotics are preferred to treat penicillin-resistant infections in the area. Significant resistance was noted for the tetracycline group could be because of the indiscriminate use of this antibiotic against mastitis prophylaxis along with other non-specific infections, parasitic/haemo-protozoan infections in ruminants in the study area in animals. Because glycopeptides are not frequently utilized in veterinary services, there are very few reports on the prevalence of Vancomycin-Resistant S. aureus (VRSA) in animals. Although, the possibility of VRSA contamination of the surrounding environment or pastureland and subsequent colonization of domestic animals cannot be completely ruled out (Bhattacharyya et al., 2016) which could be the reason for the considerable resistance to vancomycin found in the current study. Overall moderate resistance was recorded against aminoglycosides and quinolones although streptomycin and norfloxacin showed higher degree of resistance. The least resistance was observed for the phenicol group of antibiotics as the use of chloramphenicol is not very common in the treatment of animals in study area (Fig 5). Similar findings were noted by Sharma et al., (2015), with 100% Penicillin resistance in S. aureus isolated from mastitis-affected cows whereas, Ramasamy et al., (2021) and Shrestha et al., (2021) had noted 100% resistance to Ampicillin in S. aureus isolated from mastitic cows. Chandrasekaran et al., (2014) had detected 100% Methicillin resistance in S. aureus isolated from mastitic cows, which was higher, while resistance to penicillin detected by them was lower than the current findings. In concurrence to our study Ramasamy et al., (2021) and Ali et al., (2021) reported complete to very high resistance to oxytetracycline. Similar to our findings Siddiki et al., (2019) and Pu et al., (2014), had found 70% resistance to Streptomycin and 11.17% resistance to Gentamicin in S. aureus isolated from bovine milk. In the ABST pattern for Gentamicin, higher resistance rates than those seen in the current study were reported by Brahma et al., (2022). In correlation with the results of our study Mushtaq et al., (2019) had reported 100% sensitivity to Enrofloxacin. The sensitivity to Chloramphenicol for S. aureus reported by Nelli et al., (2022) was closely similar to the present study. As compared to results of our studies Sharma et al., (2014) had documented higher resistance while Singh et al., (2016) had noted slightly less resistance to Vancomycin earlier.






 
Biosynthesis and characterization of GAgNPs
 
Green silver nanoparticles were synthesized successfully for the present research from Silver Nitrate reduced with Azadirachta indica leaf extract on the similar lines with Roy et al., (2017). Characterization studies of GAgNP were done by assessment of OD values of every sample prepared and the results of absorbance obtained of N1, N2, N3, N4 and N5 at 405 nm wavelength were 0.533, 0.84, 1.146, 1.444 and 1.531, respectively. At 420 nm the absorbance recorded was 0.192, 0.273, 0.357, 0.517 and 0.604. And at 450 nm the absorbance was found to be 0.147, 0.187, 0.233, 0.279 and 0.477. Thus, the maximum absorbance values were recorded at 405 nm. Characterization of GAgNP for their shape size and appearance was carried out with Transmission Electron microscopy (TEM) which revealed general spherical shape with the images showing agglomerates of microscopic granules and a few dispersed particles while their size measured ranging between 10 to 70 nm in diameter (Fig 2). The TEM images obtained of the broths used during MIC studies reveled the nanoparticles adhered over the surface of MDRSA cells resulting in the disintegration of cell wall and lysis of bacterial cells.
 
Antimicrobial efficacy of GAgNP against MDRSA
 
As a prerequisite for determining the optimum effective antimicrobial concentration of nanoparticle drug for further antibiotic sensitivity assay studies against MDRSA, 50 µl of the green nanoparticles prepared and labeled as N1, N2, N3, N4 and N5 were added in five wells prepared in agar plates inoculated with MDRSA in well diffusion technique. The plates were incubated overnight and the diameters of zones of inhibition were measured. The biggest zone of inhibition (23 nm) was observed around the well containing N5 followed by N4 (21 nm), N3 (18 nm) and N2 (13 nm) while negligible inhibition was noted around N1. Hence, for further studies of MIC, drug N5 was selected on line with the observations made by Roy et al., (2017).
 
Result of MIC of GAgNP against MDRSA in vitro
 
The drug concentrations of N5 used in MIC were 4, 3, 2, 1, 0.5, 0.25, 0.125, 0.06, 0.03 and 0.015 µl/Ml, respectively. The appreciable antibacterial efficacy against MDRSA was noted for all these concentrations used. When compared with the results of the efficacy of commercially available nanoparticles (NW: 50) against MDRSA antibacterial efficacy comparable results were observed for all these drug concentrations used. The confirmation of the efficacy of drugs was also carried out by doing MBC of all the wells added with MDRSA and treated with different drug dilution mixtures, wherein visible growth was not observed even in the lowest concentration of GAgNPs of 0.015 µl/mL, thus, confirming the potential candidature of GAgNPs for its antibacterial activity against MDRSA present in mastitis samples of cows.

It was concluded that S. aureus was the predominant bacteria responsible for mastitis in dairy cows in the study area. These isolates showed the highest resistance to ß lactamase group of antibiotics followed by macrolide group of antibiotics. However Green silver nanoparticles GAgNPs synthesized by reducing with Azaderichta indica leaf extract provided significant antibacterial properties against MDRSA indicating its potential for future applications against MDRSA.

All authors declare that they have no conflicts of interest.