Virulence Determinants of Escherichia coli Isolated from Buffalo Subclinical Mastitis

Buffaloes are the second largest source of milk but mastitis is a major impediment for milk production.  The multiplicity of the cause and emergence of resistance due to indiscriminate and prolonged use of antibiotics in absence of antibiogram is a major hurdle in the control of mastitis (Khan et al., 2004).

The bovine udder is an ideal environment for microbial growth. The point sources of coliform bacteria include contaminated environment, bedding materials, soil, manure and other organic matter in the environment or the animal itself (Waseem et al., 2020). Necrosis of the mammary epithelium occurs during severe, naturally occurring clinical E. coli mastitis (Bradley and Green, 2001). The most common mastitis causing bacterial pathogens are Staphylococcus aureus, Escherichia coli, streptococci, etc. (Gao et al., 2017; Yang et al., 2020).

Mastitis-causing E. coli strains may also have virulence factors, to support their colonization, adherence and survival in the udder, like toxins, adhesins, proteins secreted into host cells, polysaccharide capsules and O-antigens and other mechanisms to resist killing by complement or to scavenge iron. The genes for virulence factors may be present in the bacterial genome or may reside extra chromosomally on plasmids (Harel and Martin, 1999). Considering above factors, the study has been planned to isolate E. coli from buffalo mastitic milk samples and determination of its associated virulence factors.

The study was carried out in the Department of Veterinary Microbiology, College of Veterinary Sciences and Animal Husbandry, Mhow (M.P.) in the year 2019.

Sample collection
 
Total 300 milk samples were collected from buffaloes that were found positive for clinical mastitis and subclinical mastitis, belonging to various organized and unorganized dairy farms situated in and around Mhow and Indore cities.
 
California mastitis test (CMT)
 
The test was performed as per method described by Schalm et al., (1971). Formation of gel was recorded as a positive reaction and grades were scored as trace +, ++, +++, depending upon the degree of gel formation.
 
Isolation and identification of E. coli
 
Samples found positive in CMT were enriched in brain heart infusion (BHI) broth with incubation at 37°C for 24 hrs followed by subculture on nutrient agar, MacConkey agar and selective media eosin methylene blue (EMB) agar. The organisms were confirmed on the basis of bacterial morphology, cultural characteristics and biochemical tests (Barrow and Feltham, 1993). All the E. coli strains isolates producing purple-black colour colonies with black centre and greenish metallic sheen on EMB agar considered as positive (Fig 1). All the E. coli isolates were sent to Central Research Institute, Kasauli (H.P.) for serotyping of somatic (O) antigen.


 
Haemolysis
 
Haemolytic activity of E. coli was demonstrated on blood agar plate as per the method of Agarwal et al., (2003). The plates were exhibiting “greening” or clearing of the agar around areas of bacterial growth as an indication of alpha or beta hemolytic activity.
 
Biofilm formation
 
A qualitative assessment of biofilm formation by tube and Congo red agar methods was determined as per method described by Mathur et al., (2006), Ludarkar (2011) and Nachammai et al., (2016). In tube method, all the samples were inoculated in 5 ml tryptose soya broth (TSB) and after 12 hrs incubation 50% media were replaced with the TSB containing 0.25% sucrose followed by staining with 0.1% safranin solution. A visible film lined the inner wall and bottom of the tube was considered positive for biofilm formation. Congo red agar was prepared by using blood agar, glucose and congo-red dye as described by Nachammai et al., (2016). Black colonies with a dry crystalline consistency indicated biofilm production; non-biofilm producers usually remained pink.
 
Congo red dye binding assay
 
The test was performed to determine the congo red binding ability of the E. coli isolates as an indicative of invasiveness following the method of Ishiguro et al., (1985). The isolates were streaked on tryptone soya agar media containing 0.03% congo red dye and incubated for 48 hrs at both 37ºC and 25°C. A positive reaction was indicated by appearance of intense orange or brick red colonies (Fig 2). A negative result was evidenced by pale or white colonies.


 
Molecular detection of Virulence gene (fimH and Pap gene) DNA extraction
 
DNA was extracted from all 27 E. coli isolates. Bacterial pellet was formed from 1.5 ml of an overnight bacterial culture of each isolate and DNA was extracted from each pellet as per manufacturer instructions supplied with the kit (HipurA Bacterial genomic DNA purification kit, Hi Media). DNA was stored at -20°C till further use. The PCR amplification was carried out for detection of two genes viz. fimH and pap gene of E. coli using specific published primers (Fernandes et al., 2011). The nucleotide sequences of the forward and reverse primers for amplification of 508 bp product of fimH gene were as-forward (5'- GCAACAGCAACGCTGCATCAT-3') and reverse (5'- GCAGTCACCTGCCCTCCGGTA-3') . The nucleotide sequences of the forward and reverse primers were pap F (5'-CAGTTAATGTGGTGGCGAAG-3') and pap R (5'- AGAGAGAGCCACTCTTATACGGACA -3') for amplification of 336 bp product of pap gene. The PCR reaction was optimized for both amplification by adding 12.5 µl of 2X master mix, 1.0 µl of forward and reverse primer (20 pm/µl) each, 5 µl of extracted DNA (150-200ng) and the reaction was made up to 25 µl using nuclease free water. The amplification cycles for fimH gene were initial denaturation at 95°C for 3 min, 35 cycles of denaturation at 95°C for 45 sec, annealing at 60°C for 45 sec, extension at 72°C for 1 min and final extension at 72°C for 10 min. Annealing temperature for pap gene was 63°C for 30 sec and rest of the cycles were same as fimH gene The negative control consisted of sterile water instead of DNA template. The amplified products were electrophoresed in 1.5% agarose gel and visualized in gel documentation system.

Worldwide, reports have documented increasing incidence of bovine subclinical and clinical mastitis including reports from India (Sharma et al., 2012, Nalband et al., 2020, Waseem et al., 2020). In present study total 300 milk samples of buffaloes were screened for mastitis and 157 samples (52.33%) were found positive for mastitis. Similarly, Bhanot et al., 2012 who reported high (78.1%) prevalence of buffalo mastitis but very low prevalence was recorded by Farooq et al., 2008. In the current study, the prevalence of mastitis in buffaloes was found 42.14% and 59.21% on organized farm and unorganized farms, respectively. Ali et al., (2011) also reported the higher prevalence at individual holding buffalo farms (52%) as compared with small holdings (48%) and organized (32%) farms. Variations may be due to differences in farm management practices and hygienic conditions breed and age of animals, geographic location, production status and stage of lactation, season, etc.  Predisposing factors for subclinical mastitis in buffaloes include, level of milk production, body weight, calving period, udder type and hygiene conditions for milking (Hussain et al., 2013).

E. coli is the major pathogen causing environmental mastitis and exhibit a wide range of systemic disease severity.  The incidence of E. coli in buffalo mastitic milk samples observed in present study was 17.19% being in close agreement with Ali et al., 2011; Bhanot et al., 2012; El-Sayed Lamey et al., 2013; Waseem et al., 2020 who observed 16.18%, 16.3%, 18.47%, 14.4% frequency of E. coli, respectively in buffalo milk samples. However, Kumar, 2009, Shawky et al., 2013, Charaya et al., 2014 reported high frequency of E. coli i.e. 50%, 25.92%, 20.10%, respectively in buffalo milk samples Beyond that various factors such as bactericidal action of bovine sera, opsonisation by IgM with subsequent phagocytosis and killing by neutrophils, non availability of iron due to its binding by lactoferrin, etc. Prevent multiplication or establishment of E. coli. These inherent properties of udder defense against E. coli infection might be responsible for low incidences of E. coli mastitis (Gyles and Thoen, 1993).

Six isolates of E. coli were typed as O8 and 4 as O157. Three isolates of each were O83, O88, O120 and two isolates of O11. Two isolates one each belonged to serogroup O86 and O128, while four isolates were untypable for ‘O’ antigen (Table 1). Total eight types of serotypes were found in buffalo milk. Out of which serotype O8 (22.22%) was predominant.



Hemolytic activity could be used a phenotypic marker of virulence factor of E. coli. Hemolytic activity was detected in 23 (85.18%) out of 27 examined E. coli strains recovered from buffalo mastitis milk samples. This is in agreement with the findings (81.25%) of Gad El-Said, 2005. Although records of low haemolytic activity i.e. 5.6%, 12.5% and 13.5% by  Sayed (2014), Zaki et al., (2004) and El-Sayed Lamey et al., (2013), respectively are also available. Out of total 23 serotyped E. coli  only 3 isolates (13.04%) belonging each to O8, O83 and O157 serotypes and out of 4 only 1 (0.25%) untypable E. coli were nonhemolytic.

Congo red agar dye binding assay (CRBA) was performed to differentiate invasive and noninvasive E. coli isolates. The ability of CR dye has been proposed as a marker for the invasive property of several enteropathogens (Payne and Finkelstien, 1977). Studies have shown that CR binding ability is due to presence of an outer membrane protein, which is absolutely required for virulence (Ishiguro et al., 1985). Out of the total 27 E. coli isolates, 12 (44.44%) were positive for congo red dye binding (CR+). El-Sayed Lamey et al., 2013 reported 24 (38.1%) E. coli isolates had Congo red binding activity, 20 (31.75%) was invasive which is in close agreement with present findings. Out of total 23 serotyped E. coli 10 isolates belonging to 6 serotypes and out of 4 two untypable isolates were positive for CR+. Two serotypes O86 and O120 were found negative for CR. Sharma et al., (2006) reported that congo red dye binding test was 100% specific and this test can be used for primary screening of noninvasive E. coli from potentially invasive E. coli. On the other side, some authors found that congo red binding activity did not correlate well with pathogenicity (Zaki et al., 2004).

The biofilm potentially place an important role in the development of persistent infections and are associated with antimicrobial treatment failure (Melchior et al., 2009). In present study, higher percentage of isolates were found positive for biofilm production by CRA (70.37%) than by tube (33.33%) method. Contrary to our findings, Deka (2014) reported higher percentage in tube method (57%) than by CRA (20%) method. Lower per cent in CRA (48.03%) was reported by Dhanawade et al., (2010). Our finding is contradictory to Deka, 2014 who recommended tube method is better than CRA and Knobloch et al., 2002 who also not recommended the CRA method for biofilm detection. Asfour and Darwish, 2014 reported lower sensitivity and specificity of CRA biofilm detection

Out of total 23 serotyped E. coli 10 isolates (43.47%) and 2 (50%) untypable isolates out of 4 were positive for CRA. Only one serotype O120 was found negative for CRA. Out of total 23 serotyped E. coli, 6 and 16 isolates were positive for tube method and Modified CRA methods, respectively.

The organism produces a large number of potential virulence factors which have important roles in the pathogenesis and colonization in mammary gland these include capsule, flagella and fimbriae. Type 1 fimbriae of E. coli mediates the adhesion of the organism to the host’s mannose containing glycoprotein. Presence of virulence genes affects the severity of mastitis. In present study fimH gene (508bp) was detected in 8 isolates (29.62%) (Fig 3), which indicate the adhesion properties of bacteria (Memon et al., 2016). The fimH gene is an important virulence associated gene associated with the expression of curli fimbriae and cellulose and has influence on biofilm formation (Dubravka et al., 2015).  In isolates pap gene was not detected, similar to the result reported by Fernandes et al., (2011).

Thus, the present result indicates that the pathogenicity of E. coli in buffalo mastitis is not a consequence of specific virulence factors. Only isolates with successful combinations of virulence factors will be capable of causing disease.

The authors are thankful to College and NDVSU University officials for providing necessary facilities for research.