Genetic Profiling of PHKA2 Gene and its Association with Udder Type Traits in Indian Dairy Cattle

PHK, the prototype of protein kinases, acts as in charge in cascade of enzymatic reactions regulating glycogen breakdown (Hendrickx et al., 1999). Cytogenetic and molecular Location of PHKA2 gene is Xp22.13; from base pairs 18,892,298 to 18,984,362 (Homo sapiens Annotation Release 109, GRCh38.p12) (NCBI). Mutations in gene cause X-linked recessive liver-specific PHK deficiency leading to glycogen accumulation in cell resulting in hepatomegaly and cirrhosis (Choi, 2016). If liver is overwhelmed, it is unable to “clear” or metabolize fat coming in and becomes infiltrated with fat. There are chances of fatty liver condition turning into subclinical/clinical ketosis. Liver reaching this state is not able to perform and one defence mechanism is a reduction in milk production in an attempt to reduce the metabolic energy demand. Milk production is directly and indirectly related to the udder morphometry and health. Phosphorylase b kinase actuates glycogen phosphorylase b by transforming it to glycogen phosphorylase a. When active, this enzyme breaks down glycogen (Newgard et al., 1989). Since the significance of gene is in regulation of glycogen, thus, gene expression is directly associated with milk production and it is justifiable to consider it as a good candidate gene for MAS.

Udder configuration is of prime importance when it comes to predict production performance of animal. Indeed, PHKA2 gene polymorphisms have been significantly associated with udder attachment, stature, strength and body depth, rump width, fore udder attachment and udder height (Cole et al., 2011). Udder traits are crucial while selecting animals, directly or indirectly influence milk production, culling and longevity decisions and thus, there are great benefits to considering most of the udder traits in the study. The information on genetic polymorphisms of PHKA2 and their association with glycogen disorder has been reported in Homo sapiens (Tsilianidis et al., 2013) but so far, no research has been carried out to check the genetic effect of PHKA2 gene variants with udder configuration in Bos indicus.

Sahiwal (Bos indicus) breed of cattle is the dominant milch breed of Indian origin having native tract in North-Western region but a much broader breeding tract in the country (Chopra et al., 2020). Of all the zebu milch breeds, it is the heaviest displaying well-developed udder and is popular for higher milk production, remarkable power of endurance for hot climate of subtropics, comparatively resistant to diseases and low maintenance cost (Ratwan et al., 2019a). The study aims to identify the polymorphisms in the PHKA2 gene exon aII and flanking region and perform association analysis of identified SNPs with udder type traits in Indian Dairy cattle.

Ethics statement
 
All the animal experiments had prior approval of Institutional Animal Ethics Committee (IAEC) of ICAR-NDRI and the experiments were performed in accordance with the guidelines of Committee for the Purpose of Control and Supervision of Experimentation in Animals (CPCSEA), Ministry of Environment, Forest and Climate Change, Government of India.
 
Location and subject of study
 
Blood samples from random 100 lactating Sahiwal cows maintained at Livestock Research Centre, ICAR-National Dairy Research Institute, Karnal, India, were collected. Location of NDRI cattle farm is between 29° 420N latitude and 72° 020E longitude at an altitude of 250 m above the mean sea level (MSL). Subtropical climate prevails with range of temperature varying from 45°C to 2°C. Annual rainfall is 760 to 960 mm and relative humidity of the region ranges from 40 to 85%. It can be said that cows are exposed to a vivid range of climatic conditions typically subtropical in nature. 
 
DNA isolation
 
Genomic DNA isolated from blood samples using a blood DNA Kit (Wizard Genomic DNA Purification Kit (Promega, cat no # 1620A, USA). Integrity of isolated DNA was checked by 0.8% agarose gel electrophoresis and purity of DNA was assessed by UV-vis spectrophotometer (Biophotometer Plus, Eppendorf) immediately after extraction. Samples having 1.7-2.0 ratio of absorbance at 260 and 280 nm were considered as pure DNA and were aliquoted to 50 ng/μL before PCR amplification.
 
Primer designing and SNP identification
 
According to the exon II of PHKA2 gene bovine sequence (NCBI Ref Seq: NC_037357.1) and flanking regions of, the following PCR primer was designed: Forward: 5'- GTGGTAGCAGGGCAAGGATT -3' and Reverse: 5'- GCCTCCCCCAAATAGCCTAC -3', using Primer 3 software (Rozen and Skaletsky, 2000). PCR amplification was performed in a total volume of 25 µl with 100 ng DNA template, 1x PCR buffer, 1.5 mM MgCl2, 200 µM of each dNTPs, 20 pmol of each primer and 1 unit of Taq DNA polymerase. Amplification process was executed in thermal cycler in following stages-initial denaturation at 92°C for 5 min., followed by 34 cycles of 94°C for 30 s, annealing at 54.6°C for 30 s, 72°C for 30 s and a final extension at 72°C for 5 min. The PCR products were separated on 1.5% agarose gel including 0.5 µg/ml of ethidium bromide and documented under UV light. The amplified PCR products were sent to 1st base sequencing for purification and custom sequencing from both ends (5’ and 3’ ends). The sequences were analysed using Bioedit software for the confirmation of variants. The reference sequence (NC_037357.1 for Bos taurus PHKA2 gene) was aligned with sequencing results for each animal and each target region using Clustal W multiple alignment programme.
 
Udder type traits
 
Udder type traits were measured for each animal, spanning over period from August, 2018 to July, 2019. The traits consist of nine udder type traits viz. Fore udder attachment (FUA), rear udder height (RUH), udder depth (UD), udder balance (UB), rear udder width (RUW), central ligament (CL), udder length (UL), udder width (UW), udder circumference (UC) and five teat type traits viz. Teat thickness (TT), teat length (TL), teat circumference (TC), average distance between teats (DBT), average shortest distance from teat ends to floor (DFF). Procedure of International committee of animal recording (2012) were followed for measurement and scoring of traits. All traits were measured on centimetre scale except FUA, measured in degrees.
 
Statistical analysis
 
Genotype frequency, gene frequency and Hardy-Weinberg equilibrium (HWE) were calculated through c2 test via POPGENE 1.32 software. General linear model (GLM) procedure of SAS (Statistical Analysis System 9.3, SAS Institute, Cary, NC) including genotype as fixed effect was used to find association among genotypes and traits under study. The model used was:
 

Y_ij= µ +G_i + e_ij
 

Where,
Y_ij is the observed value of targeted traits, µ is overall mean, G_i is the fixed effect of i^th genotype and e_ijk is the random residual error NID (0, σ²_e).  Data were presented as mean ± SE and significance was declared at P<0.05. 

According to the presumption made for this study, an attempt was made to study the variants of exon II region of PHKA2   gene present on X chromosome and to associate with udder traits in Bos Indicus for the first time. Primers for exon 2 and its flanking region of bovine PHKA2 gene were used for amplification of genomic DNA of 100 Sahiwal cows. A 437 bp band was successfully amplified by PCR in all DNA samples providing a clear band with good specificity (Fig 1). This gene is present on bovine X chromosome. Various studies on X chromosome polymorphic regions associated with udder traits have been reported (Yan et al., (2020), Devani et al., (2020), Ogorevc et al., (2009). In Charolais cattle, myostatin gene (GDF8) was significantly associated with udder volume and teat size (Vallee et al., 2016). According to Cole et al., (2011), the X chromosome was highly variable and the most significant X chromosome SNP effects were associated with udder attachment, rear teat placement, specifically in context of udder traits.



DNA sequence analysis revealed three-point mutations i.e g.124497381C>T in exon 2, X:124497248G>A and X: 124497189 C>T in our targeted population. Chromatogram changes in PHKA2 gene in targeted regions are shown in Fig 2-4. Genetic architecture of targeted loci in resource population exhibited very low ranging frequency of mutant allele (from 0.02 to 0.08). Detailed genotypic and allelic frequencies are presented in Table 1. Chi-square test showed that SNP X: 124497248G>A; X: 124497189 C>T were not in Hardy-Weinberg equilibrium (p<0.05) due to the kind of genetic architecture. The recessive homozygotes were negligible and therefore the variant could be seen in the heterozygote genotypes only. This specific kind of selection for dominant homozygotes in the present population against recessive gene might be an example of directional selection. The unfavourable form (recessive allele) might probably have been present in the previous generations, which now is in process of removal by selection. Also, selection against recessive alleles must have been very efficient initially, which generally becomes slower as larger proportion of the latter is protected in heterozygotes. Also, these variants in non-coding region might have role in the gene activity, protein assembly etc. Noncoding DNA has wide implications for a range of phenotypic traits such as cell size, growth rate, metabolism and life history and is an important yet often neglected part of the genotype-phenotype link (Hessen, 2017).

​

​

​



However, an association analysis was performed and least square means of udder traits grouped based on genotype at different loci were analysed (Table 2). It was observed that SNP g.124497381C>T was significantly (p<0.05) associated with DBT and CL. It is inferred that selection of heterozygote genotype will help to select the animal having more distance between teats and shallower CL than homozygote animals. The homozygote animals were having closely placed teats and deeper udder cleft which is a very desirable udder conformation. Widely placed teats are undesirable as is evident by various reports. Turkyilmaz et al., (2018) found a negative relationship between distance between udder teat places and milk components in sheep. Berry et al., (2004) stated that teats at either extremity of the scale in cows increases the likelihood of being culled while long CL stipulates a strong median suspensory ligament.

​

Additionally, SNP X: 124497248G>A was significantly (p<0.05) associated with RUW, FUA, UD, UL and TL. Homozygote genotype were having higher values for RUW, UL, FUA and TL than heterozygote animals except UD. Furthermore, SNP X: 124497189C>T was significantly (p<0.05) associated with UL and RUH.

Homozygote genotype were selected and favoured in the population. Higher the RUW, higher is the udder capacity. Medium range positive phenotypic correlation was reported between RUW and 305-day milk yield and between UL and Milk yield by Khan and Khan (2016). FUA indicates how strongly the fore udder is attached to the body wall via lateral ligaments. The strong and tight fore udder attachment is the most desirable (Godara et al., 2015). In context of TL, intermediate values of TL are preferred over smaller TL agreeing with the findings of study. Short teats cause problem for milking machines (Icar, 2001) while more longer teats are genetically predisposed to a higher incidence of mastitis. Klein et al. (2005) and Paulrud and Rasmussen (2004) stated that teat length and thickness play an important role in preventing mastitis, since the longer the canal length, the more pronounced the keratin cap, acting as a natural barrier, prevents contamination with the pathogens causing mastitis. Therefore, it is crucial to establish a balance between functionality and health for this trait, given that extremes are undesirable (Panetto et al., 2017). However, lower value of UD which is not advantageous. This condition might have happened in the resource population because of selection of high milk producing cows eventually resulting in deep udders. Shallow udder depth is most desirable. Cows with deeper udders have more chances of udder injury and mastitis (Rogers, 1993). Cows with deeper udders and less udder clearance are more susceptible to high SCS (Carlstrom et al., 2016; Dadpasand et al., 2012; Stefani et al., 2018). Similar to RUW, high rear udder attachment is also an index of more udder capacity, so higher values are beneficial.

The current study is the first to show a connection between the PHKA2 gene and udder traits in Sahiwal cattle. The results show that the population is not in HW equilibrium with respect to the identified SNPs i.e., X:124497248G>A and X: 124497189C>T. Association analysis uncovered that these SNPs in PHKA2 gene can be used as a candidate marker in Bos indicus to select animals with claimed udder conformation for enhancing milk producing ability.

Facilities provided by Director, Indian Council of Agricultural Research-National Dairy Research Institute, Karnal, India to conduct this research is duly acknowledged.