volume 58 issue 3 (march 2024) : 376-380,   Doi: 10.18805/IJAR.B-4479

Characterization of 24bp Insertion Polymorphism of Prolactin Gene and its Association with Quantitative Traits in Tellicherry Native Chicken Breed

A
Azhaguraja Manoharan1,*
S
S. Sankaralingam2
P
P. Anitha2
B
Binoj Chacko2
T
T.V. Aravindakshan2
1ICAR- Indian Veterinary Research Institute, Izzatnagar, Bareilly-243 122, Uttar Pradesh, India.
2Department of Poultry Science, College of Veterinary and Animal Sciences, Mannuthy, Thrissur-680 651, Kerala, India.
Cite article:- Manoharan Azhaguraja, Sankaralingam S., Anitha P., Chacko Binoj, Aravindakshan T.V. (2024). Characterization of 24bp Insertion Polymorphism of Prolactin Gene and its Association with Quantitative Traits in Tellicherry Native Chicken Breed . Indian Journal of Animal Research. 58(3): 376-380. doi: 10.18805/IJAR.B-4479.
Background: Over many centuries, the conventional methods of poultry breeding is based on the phenotypic selection of the birds with superior trait in a particular population. Prolactin is a physiological candidate gene that has significant effects on production traits in poultry. The objective of this study was to investigate 24 bp insertion (I) polymorphism of prolactin gene and its association with quantitative traits in Tellicherry native chicken.

Methods: A total of 200 blood samples were collected from the randomly selected birds of All India Co-ordinated Research Project (AICRP) on Poultry Breeding, Mannuthy. The isolated DNA samples were subjected to polymerase chain reaction (PCR) by using specific set of primers to amplify the 24 bp insertion polymorphism. PCR amplicons were sequenced to study the polymorphism at nucleotide level.

Result: PCR amplification revealed the presence of a specific DNA fragment with 130/154 bp contained 24 bp insertion polymorphism. Based on the polymorphic patterns birds were designated with three genotypes as II, ID and DD. The frequency of I (0.6975) allele was found higher than D (0.3025) allele. Our experimental results revealed that 24bp insertion polymorphism of prolactin did not have a significant association with production traits viz, age at sexual maturity, egg weight and egg number in Tellicherry native chicken.
In birds, prolactin hormone is involves in various physiological functions viz. crop sac development, induction and maintenance of broody behavior and regulation of gonadal function (Kulibaba et al., 2012). Also, it has a crucial effect on egg production in chicken (Cui et al., 2006). It has been observed that most prolactin gene polymorphism occurs at the 5' flanking region, 3' flanking region and coding region of a signal peptide (Li et al., 2009). Additionally, the 5' flanking region of the avian prolactin gene has been regarded as a magnificent experimental model for studying both tissue-specific and hormonally regulated activation of gene transcription (Wilkanowska et al., 2014). The sequence variation at the 5' flanking region of prolactin gene possibly will consequence in alters the transcription factor binding sites and contribute to the release of prolactin hormone (Rashidi et al., 2012). A 24 bp insertion at the promoter region of the chicken prolactin gene is associated with suppression of the prolactin gene expression causing non-broodiness in hens, it could be used as a genetic marker against broodiness in chicken (Jiang et al., 2005). Research studies showed the correlation of different allelic variants of the prolactin gene with egg production for the different breeds of chicken (Begli et al., 2010). Modern commercial poultry production is mainly aimed at increase in egg production by inhibition of broody behavior (Xu et al., 2010). Over the past few years, new DNA technologies have been invented in poultry science which gave rise to marker-assisted and genome selection (Wolc et al., 2016). The combination of modern DNA technologies and classic selection approaches paved the way for the creation of highly productive competitive lines and breeds of poultry (Sodhi et al., 2013). Based on the studies carried out over the few decades, it has been reported that the prolactin gene has a direct and indirect association with various production traits in poultry. Hence, it could be used as a potential marker for the production traits (Wilkanowska et al., 2014). The main objective of the present study was identification of 24bp insertion-deletion polymorphism at the promoter region of the prolactin gene and to find out its association with quantitative traits in Tellicherry native chicken of Kerala, India.
Experimental birds
 
A total of 200 birds of Tellicherry native chicken which had undergone five generations of continuous selection were randomly selected from All India Research Co-ordinated Project (AICRP) Farm on Poultry Breeding, Mannuthy, Thrissur, Kerala. The present study was carried out during the period of September 2016 to October 2017 at Avian Biotechnology Laboratory, Department of Poultry Science, Kerala Veterinary and Animal Sciences University, Mannuthy, Thrissur, Kerala.
 
Collection of blood samples
 
From each bird, 0.5-1 ml of blood was collected from the wing vein under aseptic conditions and transferred an EDTA vial. The samples were brought to the laboratory at 4°C in an ice pack.
 
Isolation of genomic DNA
 
Genomic DNA was isolated from the whole blood using the ODP304 Origin Genomic DNA isolation kit. The yield and quality of the DNA was checked on Nano drop spectrophotometer. The DNA samples showing the OD260/OD280 value between 1.7 and 1.9 were used for further investigation.
 
PCR assay and agarose gel electrophoresis
 
Polymerase chain reaction was done using specific set of forward (F-5’ TTTAATATTGGTGGGTGAAGAGACA3’) and reverse primer (R-5 ATGCCACTGATCCTCGAAAACTC3’) to amplify the 130/154bp fragment of prolactin gene containing 24bp in(s) polymorphism at the promoter region. PCR was done in Bio-Rad thermal cycler and standardization was done for each reaction by mild adjustment of the concentration of ingredients and annealing temperature with the following profile: initial denaturation of 5 min at 94°C; 35 cycles of 94°C for 30 s, annealing at 58°C for 30 s and 72°C for 30 s with a final elongation of 5 min at 72°C. PCR amplicon was subjected to 2% agarose gel. The PCR products were loaded along with a molecular weight marker (50bp) for relative sizing. Electrophoresis was carried out at 5V/cm until the bromophenol blue dye migrated more than two by the third length of the gel and was photographed in a Gel Doc System (Bio-Rad, USA). The amplicons of prolactin gene 130/154bp were sequenced using respective forward and reverse primers in an automated sequencer using Sanger’s dideoxy chain termination method at Agri Genome Labs Pvt. Ltd., Cochin. Based on the polymorphic patterns, birds were categorized into three different genotypes and, the allelic and genotypic frequency was calculated accordingly. 
 
Production traits
 
The production traits viz., age at sexual maturity (ASM), egg weight (EW) at 28th, 32nd and 40th weeks of age and egg number (EN) up to 40 weeks age were measured in the randomly selected birds of Tellicherry native chicken of AICRP on Breeding, Mannuthy. Birds were assigned various genotypes based on polymorphic patterns and allelic and genotypic frequency were estimated.
 
Statistical analysis
 
The association of a 24bp in(s) polymorphism at the promoter region of prolactin gene with production traits (ASM, EW and EN) were analyzed by one way ANOVA by using the software SPSS (Version 21.0).
PCR amplification of 130/154 bp fragment (24 bp indel) of the promoter region of prolactin gene
 
On 0.8 per cent agarose gel, a single clear band was obtained without shearing which indicates that the DNA was good in quality and concentration (Fig 1). The size of the amplicons was 130/154 and the polymorphic patterns of promoter region were observed with 24 bp insertion using PCR with 2 percent agarose gel (Fig 2). Similarly, 24 bp indel polymorphism was identified in different breeds of chicken (Cui et al., 2006; Liang et al., 2006; Bagheri Sarvestani et al., 2010; Rashidi et al., 2012).

Fig 1: DNA isolated by Origin Genomic DNA isolation kit (0.8% agarose gel). Lane 1-8: DNA isolated from blood.



​

Fig 2: PCR amplification of 130/154bp fragment (24bp indel) of promoter region of prolactin gene on 2% agarose gel. Lane 1, 2: 130 and 154bp fragments of ID genotype. Lane 3, 5: 154bp fragments of II genotype. Lane 4, 6, 7, 8: 130bp fragments of DD genotype. Lane 9: 50bp ladder.



Based on the polymorphic patterns, all 200 birds were designated with three different genotypes II (insertion-insertion), ID (insertion-deletion) and (deletion-deletion) DD, accordingly. The size of the amplicons were 154, 130/154 and 130 bp representing the II, ID and DD genotypes, respectively. Out of 200 birds of Tellicherry native chicken, 130 birds were produced II genotype, 19 birds were observed with ID genotype and 51 birds were observed with DD genotype.
 
Genotype and allele frequency
 
The genotypic frequency of II, ID and DD of 24 bp indel polymorphism were 0.650, 0.095 and 0.255, respectively. The allelic frequency of I and D was 0.6975 and 0.3025, correspondingly. According to these results, it has been observed the frequency of I allele was found high in Tellicherry native chicken population.
 
Association of 24 bp insertion polymorphism of prolactin gene with quantitative traits in Tellicherry native chicken
 
Age at sexual maturity
 
In Tellicherry native chicken, the mean age at sexual maturity was 157.1±8.15, 153.47±14.49 and 154.18±15.61 (days) for the genotypes II, ID and DD, respectively. There was no significant difference (P>0.05) among the genotypes. Though, birds with ID genotype had shown early sexual maturity. Similarly, Begli et al., (2010) observed no association between the genotypes of a 24 bp indel site and ASM in native chicken of Yazd province in Iran (Fig 3,4).

​

Fig 3: Sequence analysis of a 24bp insertion (I) at the promoter region of prolactin gene (154bp).



​

Fig 4: Sequence analysis of s 24bp deletion (D) at the promoter region of prolactin gene (130bp).


 
Mean egg weight at 28th week
 
For birds with genotypes II, ID and DD, the mean egg weight at 28 weeks of age was 41.64±5.12, 41.01±3.28 and 41.19±3.00 g, respectively. There was no significant difference (P>0.05) among the genotypes.
 
Mean egg weight at 32nd week
 
The mean egg weight at 32 weeks of age was 41.30±4.98, 41.18±3.50 and 41.65±3.71 g for the genotypes II, ID and DD, respectively. There was no significant difference (P>0.05) among the genotypes.

Mean egg weight at 40th week
 
The mean egg weight at 40 weeks of age was 42.02±4.49, 41.70±3.48 and 41.29±3.76 g for the genotypes II, ID and DD, respectively. There was no significant difference (P>0.05) among the genotypes.

In comparison, similar findings were reported in Kadaknath and Aseel birds (Yadav et al., 2016; Yadav et al., 2018). Additionally, Begli et al., (2010) compared different genotypes of 24 bp indel site and found no association with mean egg weight in native fowl of Yazd province. Furthermore, the genotypes of 24 bp indel polymorphism did not show significant association with mean egg weight at 2nd, 4th, 6th weeks of laying period in Japanese quail (Lotfi et al., 2013).
 
Egg number up to 40 weeks of age
 
In Tellicherry native chicken, the mean egg number up to 40 weeks of age were 86.26±18.98, 87.24±20.28 and 80.25±20.31 for the genotypes II, ID and DD, respectively.

Although there were no significant differences among the genotypes of 24bp indel polymorphism of prolactin gene, birds with II and ID genotypes produced more eggs than DD genotype. Hence, it could be assumed that a 24bp nucleotide sequence insertion at the promoter region of the prolactin gene may influences the intensity of egg-laying in birds. In comparison, Kulibaba et al., (2012) researched prolactin and growth hormone gene polymorphisms in chicken lines of Ukrainian selection and reported that increased frequency of I allele corresponds to an egg-laying direction of chicken productivity. Cui et al., (2006) reported that the ID genotype of the 24 bp indel (insertion-deletion) site had significantly (p<0.05) higher egg production compared to II and DD contrary to the present results. In addition, Begli et al., (2010) found that birds with II and ID genotype had shown a significant association (P<0.01) on egg production than DD in native fowl of Yazd province. Also, Bagheri Sarvestani et al., (2013) reported that chicken with II and ID genotypes for the 24 bp insertion/deletion had significantly (P<0.01) greater egg production and laying rate than DD genotype. These findings were contrary to the results of the present study. This may possibly due to small number of sample size and the artificial selection done at AICRP farm. In addition, the frequency I (0.6975) allele was found higher than D (0.3025) allele. This could be due to genetic drift viz, bottle neck effect and founder effect.

It has been reported that due to insertion of a 24 bp nucleotide sequence at the promoter region of the prolactin gene, a possible ecotropic viral integration site-1 encoded factor (Evi-1) binding site is located in the 52 flanking region of the chicken prolactin gene (Cui et al., 2005). Evi-1 was shown to be involved as a repressor in the transcription of many genes (Vinatzer et al., 2001; Izutsu et al., 2002). Additionally, Evi-1 represses the expression of the prolactin gene in chickens through binding the Evi-1 binding site which prevents broodiness that can improve egg production to some extent (Jaing et al., 2005). In accordance with these results, in the present study frequency of I (insertion) allele, was found to be high in the Tellicherry chicken population based on the obtained results of allelic frequency estimation. In general, annual egg production of indigenous chicken breeds are comparatively less than commercial layers. For example, an average egg production is about 60 to 80 numbers in Tellicherry chicken breed that are reared under backyard system. In the present study, the average egg production of Tellicherry chicken is around 168 numbers up to 72 weeks age which is higher than backyard chicken. This may due to the artificial selection and controlled breeding followed in All India Co-ordinated Research Project Farm on Poultry Breeding, Mannuthy, Thrissur, Kerala. It has been observed that broodiness is less pronounced in native chickens reared under the caged system which may improve the egg production (intensity of laying) to some extent. Also, broodiness and egg production are negatively correlated traits in poultry. Similarly, based on the day-to-day observation and production data maintenance at AICRP farm, we have observed that Tellicherry chicken had shown decreased number of broody days with an increased egg number. Furthermore, it has been found that the presence of a 24 bp insertion (I) at the promoter region of the prolactin gene has a positive effect on egg production. Hence, a 24bp insertion polymorphism of the prolactin gene could be used as a molecular marker to improve the egg production in native chickens.  
In the present study, we have identified a 24bp insertion polymorphism at the promoter region of prolactin gene. The allele frequency for the I (0.6975) allele was found higher than D (0.3025) allele. However, no significant association (p>0.05) were observed among different genotypes (II, ID and DD) with age at sexual maturity, egg weight at 28, 32 and 40 weeks of age and egg number up to 40 weeks of age in Tellicherry chicken. Hence, further studies could be carried out with large number of samples to confirm the association of 24bp insertion polymorphism of prolactin gene with production traits in other breeds of native chicken.
The present study was funded by the Kerala state plan project with the collaboration of Kerala Veterinary and Animal Sciences University (KVASU). I would like to express my deep gratitude to the Professors, staffs of the Department of Poultry Science and the Department of Animal Breeding and Genetics. Also to the Dean, College of Veterinary and Animal Sciences, Mannuthy, Thrissur, Kerala for providing the necessary infrastructure required for the investigation of the current research.
All authors declared that they have no conflict of interest.

  1. Bagheri Sarvestani, A.S., Niazi, A., Zamiri, M.J. and Dadpasand Taromsari, M. (2013). Polymorphisms of prolactin gene in a native chicken population and its association with egg production. Iranian Journal of Veterinary Research. 14: 113-119.

  2. Begli, H.E., Zerehdaran, S., Hassani, S., Abbasi, M.A. and Ahmadi, A.K. (2010). Polymorphism in prolactin and PEPCK-C genes and its association with economic traits in native fowl of Yazd province. Iranian Journal of Biotechnology. 8: 172-177.

  3. Cui, J.X., Du, H.L., Liang, Y., Deng, X.M., Li, N. and Zhang, X.Q. (2006). Association of polymorphisms in the promoter region of chicken prolactin with egg production. Poultry Science Journal. 85: 26-31.

  4. Cui, J.X., Du, H.L., Zhang, X.Q. (2005). Polymorphisms and bioinformatics analysis of chicken prolactin gene. Yi chuan Hereditas. 27: 208-214.

  5. Izutsu, K., Kurokawa, M., Imai, Y., Ichikawa, M., Asai, T., Maki, K. and Hirai, H. (2002). The t (3; 21) fusion product, AML1/ Evi-1 blocks AML1-induced transactivation by recruiting CtBP. Oncogene. 2.1: 2695-2703.

  6. Jiang, R.S., Xu, G.Y., Zhang, X.Q. and Yang, N. (2005). Association of polymorphisms for prolactin and prolactin receptor genes with broody traits in chickens. Poultry Science Journal. 84: 839-845.

  7. Kulibaba, R.A. and Podstreshnyi, A.P. (2012). Prolactin and growth hormone gene polymorphisms in chicken lines of Ukrainian selection. Cytology and Genetics. 46: 390-395.

  8. Li, H.F., Zhu, W.Q., Chen, K.W., Zhang, T.J. and Song, W.T. (2009). Association of polymorphisms in the intron 1 of duck prolactin with egg performance. Turkish Journal of Veterinary and Animal Sciences. 33(3): 193-197.

  9. Liang, Y., Cui, J., Yang, G., Leung, F.C. and Zhang, X. (2006). Polymorphisms of 52 flanking region of chicken prolactin gene. Domestic Animal Endocrinology. 30: 1-16.

  10. Lotfi, E., Zerehdaran, S., Ahani, M. and Dehnavi, E. (2013). Genetic polymorphism in prolactin gene and its association with reproductive traits in Japanese quail (Coturnix japonica). Poultry Science Journal. 1: 79-85.

  11. Rashidi, H., Rahimi-Mianji, G., Farhadi, A. and Gholizadeh, M. (2012). Association of prolactin and prolactin receptor gene polymorphisms with economic traits in breeder hens of indigenous chickens of Mazandaran province. Iranian Journal of Biotechnology. 10: 129-135.

  12. Sodhi, S.S., Jeong, D.K., Sharma, N., Lee, J.H., Ki, J.H., Kim, S.H. and Oh, S.J. (2013). Marker assisted selection-applications and evaluation for commercial poultry breeding. Korean Journal of Poultry Science. 40: 223-234.

  13. Vinatzer, U., Taplick, J., Seiser, C., Fonatsch, C. and Wieser, R. (2001). The leukaemia associated transcription factors EVI 1 and MDS1/EVI1 repress transcription and interact with histone deacetylase. British Journal of Haematology. 114: 566-573.

  14. Wilkanowska, A., Mazurowski, A., Mroczkowski, S. and Kokoszyñski, D. (2014) Prolactin (PRL) and prolactin receptor (PRLR) genes and their role in poultry production traits. Folia Biologica. 62: 1-8.

  15. Wolc, A., Kranis, A., Arango, J., Settar, P., Fulton, J.E., O’Sullivan, N.P. and Dekkers, J.C.M. (2016). Implementation of genomic selection in the poultry industry. Animal Frontiers. 6(1): 23-31.

  16. Xu, H., Shen, X., Zhou, M., Fang, M., Zeng, H., Nie, Q. and Zhang, X. (2010). The genetic effects of the dopamine D1 receptor gene on chicken egg production and broodiness traits. BMC Genetics. 11: 17.

  17. Yadav, B.M., Mayura, S.K, Yadav, A., Yadav, S.M. (2018). Polymorphism at prolactin promoter region and its relation with production performance in Aseel birds. International Journal of Current Microbiology and Applied Sciences. 7: 1367-1370.

  18. Yadav, S.K., Maurya, S.K., Yadav, A.K., Yadav, K. and Singh, K.D. (2016). Polymorphism of prolactin gene in relation to egg production performance in Kadaknath hens. Indian Journal Animal Research. 52: 208-211. doi: 10.18805/ijar.11327.

Characterization of 24bp Insertion Polymorphism of Prolactin Gene and its Association with Quantitative Traits in Tellicherry Native Chicken Breed

A
Azhaguraja Manoharan1,*
S
S. Sankaralingam2
P
P. Anitha2
B
Binoj Chacko2
T
T.V. Aravindakshan2
1ICAR- Indian Veterinary Research Institute, Izzatnagar, Bareilly-243 122, Uttar Pradesh, India.
2Department of Poultry Science, College of Veterinary and Animal Sciences, Mannuthy, Thrissur-680 651, Kerala, India.
Cite article:- Manoharan Azhaguraja, Sankaralingam S., Anitha P., Chacko Binoj, Aravindakshan T.V. (2024). Characterization of 24bp Insertion Polymorphism of Prolactin Gene and its Association with Quantitative Traits in Tellicherry Native Chicken Breed . Indian Journal of Animal Research. 58(3): 376-380. doi: 10.18805/IJAR.B-4479.
Background: Over many centuries, the conventional methods of poultry breeding is based on the phenotypic selection of the birds with superior trait in a particular population. Prolactin is a physiological candidate gene that has significant effects on production traits in poultry. The objective of this study was to investigate 24 bp insertion (I) polymorphism of prolactin gene and its association with quantitative traits in Tellicherry native chicken.

Methods: A total of 200 blood samples were collected from the randomly selected birds of All India Co-ordinated Research Project (AICRP) on Poultry Breeding, Mannuthy. The isolated DNA samples were subjected to polymerase chain reaction (PCR) by using specific set of primers to amplify the 24 bp insertion polymorphism. PCR amplicons were sequenced to study the polymorphism at nucleotide level.

Result: PCR amplification revealed the presence of a specific DNA fragment with 130/154 bp contained 24 bp insertion polymorphism. Based on the polymorphic patterns birds were designated with three genotypes as II, ID and DD. The frequency of I (0.6975) allele was found higher than D (0.3025) allele. Our experimental results revealed that 24bp insertion polymorphism of prolactin did not have a significant association with production traits viz, age at sexual maturity, egg weight and egg number in Tellicherry native chicken.
In birds, prolactin hormone is involves in various physiological functions viz. crop sac development, induction and maintenance of broody behavior and regulation of gonadal function (Kulibaba et al., 2012). Also, it has a crucial effect on egg production in chicken (Cui et al., 2006). It has been observed that most prolactin gene polymorphism occurs at the 5' flanking region, 3' flanking region and coding region of a signal peptide (Li et al., 2009). Additionally, the 5' flanking region of the avian prolactin gene has been regarded as a magnificent experimental model for studying both tissue-specific and hormonally regulated activation of gene transcription (Wilkanowska et al., 2014). The sequence variation at the 5' flanking region of prolactin gene possibly will consequence in alters the transcription factor binding sites and contribute to the release of prolactin hormone (Rashidi et al., 2012). A 24 bp insertion at the promoter region of the chicken prolactin gene is associated with suppression of the prolactin gene expression causing non-broodiness in hens, it could be used as a genetic marker against broodiness in chicken (Jiang et al., 2005). Research studies showed the correlation of different allelic variants of the prolactin gene with egg production for the different breeds of chicken (Begli et al., 2010). Modern commercial poultry production is mainly aimed at increase in egg production by inhibition of broody behavior (Xu et al., 2010). Over the past few years, new DNA technologies have been invented in poultry science which gave rise to marker-assisted and genome selection (Wolc et al., 2016). The combination of modern DNA technologies and classic selection approaches paved the way for the creation of highly productive competitive lines and breeds of poultry (Sodhi et al., 2013). Based on the studies carried out over the few decades, it has been reported that the prolactin gene has a direct and indirect association with various production traits in poultry. Hence, it could be used as a potential marker for the production traits (Wilkanowska et al., 2014). The main objective of the present study was identification of 24bp insertion-deletion polymorphism at the promoter region of the prolactin gene and to find out its association with quantitative traits in Tellicherry native chicken of Kerala, India.
Experimental birds
 
A total of 200 birds of Tellicherry native chicken which had undergone five generations of continuous selection were randomly selected from All India Research Co-ordinated Project (AICRP) Farm on Poultry Breeding, Mannuthy, Thrissur, Kerala. The present study was carried out during the period of September 2016 to October 2017 at Avian Biotechnology Laboratory, Department of Poultry Science, Kerala Veterinary and Animal Sciences University, Mannuthy, Thrissur, Kerala.
 
Collection of blood samples
 
From each bird, 0.5-1 ml of blood was collected from the wing vein under aseptic conditions and transferred an EDTA vial. The samples were brought to the laboratory at 4°C in an ice pack.
 
Isolation of genomic DNA
 
Genomic DNA was isolated from the whole blood using the ODP304 Origin Genomic DNA isolation kit. The yield and quality of the DNA was checked on Nano drop spectrophotometer. The DNA samples showing the OD260/OD280 value between 1.7 and 1.9 were used for further investigation.
 
PCR assay and agarose gel electrophoresis
 
Polymerase chain reaction was done using specific set of forward (F-5’ TTTAATATTGGTGGGTGAAGAGACA3’) and reverse primer (R-5 ATGCCACTGATCCTCGAAAACTC3’) to amplify the 130/154bp fragment of prolactin gene containing 24bp in(s) polymorphism at the promoter region. PCR was done in Bio-Rad thermal cycler and standardization was done for each reaction by mild adjustment of the concentration of ingredients and annealing temperature with the following profile: initial denaturation of 5 min at 94°C; 35 cycles of 94°C for 30 s, annealing at 58°C for 30 s and 72°C for 30 s with a final elongation of 5 min at 72°C. PCR amplicon was subjected to 2% agarose gel. The PCR products were loaded along with a molecular weight marker (50bp) for relative sizing. Electrophoresis was carried out at 5V/cm until the bromophenol blue dye migrated more than two by the third length of the gel and was photographed in a Gel Doc System (Bio-Rad, USA). The amplicons of prolactin gene 130/154bp were sequenced using respective forward and reverse primers in an automated sequencer using Sanger’s dideoxy chain termination method at Agri Genome Labs Pvt. Ltd., Cochin. Based on the polymorphic patterns, birds were categorized into three different genotypes and, the allelic and genotypic frequency was calculated accordingly. 
 
Production traits
 
The production traits viz., age at sexual maturity (ASM), egg weight (EW) at 28th, 32nd and 40th weeks of age and egg number (EN) up to 40 weeks age were measured in the randomly selected birds of Tellicherry native chicken of AICRP on Breeding, Mannuthy. Birds were assigned various genotypes based on polymorphic patterns and allelic and genotypic frequency were estimated.
 
Statistical analysis
 
The association of a 24bp in(s) polymorphism at the promoter region of prolactin gene with production traits (ASM, EW and EN) were analyzed by one way ANOVA by using the software SPSS (Version 21.0).
PCR amplification of 130/154 bp fragment (24 bp indel) of the promoter region of prolactin gene
 
On 0.8 per cent agarose gel, a single clear band was obtained without shearing which indicates that the DNA was good in quality and concentration (Fig 1). The size of the amplicons was 130/154 and the polymorphic patterns of promoter region were observed with 24 bp insertion using PCR with 2 percent agarose gel (Fig 2). Similarly, 24 bp indel polymorphism was identified in different breeds of chicken (Cui et al., 2006; Liang et al., 2006; Bagheri Sarvestani et al., 2010; Rashidi et al., 2012).

Fig 1: DNA isolated by Origin Genomic DNA isolation kit (0.8% agarose gel). Lane 1-8: DNA isolated from blood.



​

Fig 2: PCR amplification of 130/154bp fragment (24bp indel) of promoter region of prolactin gene on 2% agarose gel. Lane 1, 2: 130 and 154bp fragments of ID genotype. Lane 3, 5: 154bp fragments of II genotype. Lane 4, 6, 7, 8: 130bp fragments of DD genotype. Lane 9: 50bp ladder.



Based on the polymorphic patterns, all 200 birds were designated with three different genotypes II (insertion-insertion), ID (insertion-deletion) and (deletion-deletion) DD, accordingly. The size of the amplicons were 154, 130/154 and 130 bp representing the II, ID and DD genotypes, respectively. Out of 200 birds of Tellicherry native chicken, 130 birds were produced II genotype, 19 birds were observed with ID genotype and 51 birds were observed with DD genotype.
 
Genotype and allele frequency
 
The genotypic frequency of II, ID and DD of 24 bp indel polymorphism were 0.650, 0.095 and 0.255, respectively. The allelic frequency of I and D was 0.6975 and 0.3025, correspondingly. According to these results, it has been observed the frequency of I allele was found high in Tellicherry native chicken population.
 
Association of 24 bp insertion polymorphism of prolactin gene with quantitative traits in Tellicherry native chicken
 
Age at sexual maturity
 
In Tellicherry native chicken, the mean age at sexual maturity was 157.1±8.15, 153.47±14.49 and 154.18±15.61 (days) for the genotypes II, ID and DD, respectively. There was no significant difference (P>0.05) among the genotypes. Though, birds with ID genotype had shown early sexual maturity. Similarly, Begli et al., (2010) observed no association between the genotypes of a 24 bp indel site and ASM in native chicken of Yazd province in Iran (Fig 3,4).

​

Fig 3: Sequence analysis of a 24bp insertion (I) at the promoter region of prolactin gene (154bp).



​

Fig 4: Sequence analysis of s 24bp deletion (D) at the promoter region of prolactin gene (130bp).


 
Mean egg weight at 28th week
 
For birds with genotypes II, ID and DD, the mean egg weight at 28 weeks of age was 41.64±5.12, 41.01±3.28 and 41.19±3.00 g, respectively. There was no significant difference (P>0.05) among the genotypes.
 
Mean egg weight at 32nd week
 
The mean egg weight at 32 weeks of age was 41.30±4.98, 41.18±3.50 and 41.65±3.71 g for the genotypes II, ID and DD, respectively. There was no significant difference (P>0.05) among the genotypes.

Mean egg weight at 40th week
 
The mean egg weight at 40 weeks of age was 42.02±4.49, 41.70±3.48 and 41.29±3.76 g for the genotypes II, ID and DD, respectively. There was no significant difference (P>0.05) among the genotypes.

In comparison, similar findings were reported in Kadaknath and Aseel birds (Yadav et al., 2016; Yadav et al., 2018). Additionally, Begli et al., (2010) compared different genotypes of 24 bp indel site and found no association with mean egg weight in native fowl of Yazd province. Furthermore, the genotypes of 24 bp indel polymorphism did not show significant association with mean egg weight at 2nd, 4th, 6th weeks of laying period in Japanese quail (Lotfi et al., 2013).
 
Egg number up to 40 weeks of age
 
In Tellicherry native chicken, the mean egg number up to 40 weeks of age were 86.26±18.98, 87.24±20.28 and 80.25±20.31 for the genotypes II, ID and DD, respectively.

Although there were no significant differences among the genotypes of 24bp indel polymorphism of prolactin gene, birds with II and ID genotypes produced more eggs than DD genotype. Hence, it could be assumed that a 24bp nucleotide sequence insertion at the promoter region of the prolactin gene may influences the intensity of egg-laying in birds. In comparison, Kulibaba et al., (2012) researched prolactin and growth hormone gene polymorphisms in chicken lines of Ukrainian selection and reported that increased frequency of I allele corresponds to an egg-laying direction of chicken productivity. Cui et al., (2006) reported that the ID genotype of the 24 bp indel (insertion-deletion) site had significantly (p<0.05) higher egg production compared to II and DD contrary to the present results. In addition, Begli et al., (2010) found that birds with II and ID genotype had shown a significant association (P<0.01) on egg production than DD in native fowl of Yazd province. Also, Bagheri Sarvestani et al., (2013) reported that chicken with II and ID genotypes for the 24 bp insertion/deletion had significantly (P<0.01) greater egg production and laying rate than DD genotype. These findings were contrary to the results of the present study. This may possibly due to small number of sample size and the artificial selection done at AICRP farm. In addition, the frequency I (0.6975) allele was found higher than D (0.3025) allele. This could be due to genetic drift viz, bottle neck effect and founder effect.

It has been reported that due to insertion of a 24 bp nucleotide sequence at the promoter region of the prolactin gene, a possible ecotropic viral integration site-1 encoded factor (Evi-1) binding site is located in the 52 flanking region of the chicken prolactin gene (Cui et al., 2005). Evi-1 was shown to be involved as a repressor in the transcription of many genes (Vinatzer et al., 2001; Izutsu et al., 2002). Additionally, Evi-1 represses the expression of the prolactin gene in chickens through binding the Evi-1 binding site which prevents broodiness that can improve egg production to some extent (Jaing et al., 2005). In accordance with these results, in the present study frequency of I (insertion) allele, was found to be high in the Tellicherry chicken population based on the obtained results of allelic frequency estimation. In general, annual egg production of indigenous chicken breeds are comparatively less than commercial layers. For example, an average egg production is about 60 to 80 numbers in Tellicherry chicken breed that are reared under backyard system. In the present study, the average egg production of Tellicherry chicken is around 168 numbers up to 72 weeks age which is higher than backyard chicken. This may due to the artificial selection and controlled breeding followed in All India Co-ordinated Research Project Farm on Poultry Breeding, Mannuthy, Thrissur, Kerala. It has been observed that broodiness is less pronounced in native chickens reared under the caged system which may improve the egg production (intensity of laying) to some extent. Also, broodiness and egg production are negatively correlated traits in poultry. Similarly, based on the day-to-day observation and production data maintenance at AICRP farm, we have observed that Tellicherry chicken had shown decreased number of broody days with an increased egg number. Furthermore, it has been found that the presence of a 24 bp insertion (I) at the promoter region of the prolactin gene has a positive effect on egg production. Hence, a 24bp insertion polymorphism of the prolactin gene could be used as a molecular marker to improve the egg production in native chickens.  
In the present study, we have identified a 24bp insertion polymorphism at the promoter region of prolactin gene. The allele frequency for the I (0.6975) allele was found higher than D (0.3025) allele. However, no significant association (p>0.05) were observed among different genotypes (II, ID and DD) with age at sexual maturity, egg weight at 28, 32 and 40 weeks of age and egg number up to 40 weeks of age in Tellicherry chicken. Hence, further studies could be carried out with large number of samples to confirm the association of 24bp insertion polymorphism of prolactin gene with production traits in other breeds of native chicken.
The present study was funded by the Kerala state plan project with the collaboration of Kerala Veterinary and Animal Sciences University (KVASU). I would like to express my deep gratitude to the Professors, staffs of the Department of Poultry Science and the Department of Animal Breeding and Genetics. Also to the Dean, College of Veterinary and Animal Sciences, Mannuthy, Thrissur, Kerala for providing the necessary infrastructure required for the investigation of the current research.
All authors declared that they have no conflict of interest.

  1. Bagheri Sarvestani, A.S., Niazi, A., Zamiri, M.J. and Dadpasand Taromsari, M. (2013). Polymorphisms of prolactin gene in a native chicken population and its association with egg production. Iranian Journal of Veterinary Research. 14: 113-119.

  2. Begli, H.E., Zerehdaran, S., Hassani, S., Abbasi, M.A. and Ahmadi, A.K. (2010). Polymorphism in prolactin and PEPCK-C genes and its association with economic traits in native fowl of Yazd province. Iranian Journal of Biotechnology. 8: 172-177.

  3. Cui, J.X., Du, H.L., Liang, Y., Deng, X.M., Li, N. and Zhang, X.Q. (2006). Association of polymorphisms in the promoter region of chicken prolactin with egg production. Poultry Science Journal. 85: 26-31.

  4. Cui, J.X., Du, H.L., Zhang, X.Q. (2005). Polymorphisms and bioinformatics analysis of chicken prolactin gene. Yi chuan Hereditas. 27: 208-214.

  5. Izutsu, K., Kurokawa, M., Imai, Y., Ichikawa, M., Asai, T., Maki, K. and Hirai, H. (2002). The t (3; 21) fusion product, AML1/ Evi-1 blocks AML1-induced transactivation by recruiting CtBP. Oncogene. 2.1: 2695-2703.

  6. Jiang, R.S., Xu, G.Y., Zhang, X.Q. and Yang, N. (2005). Association of polymorphisms for prolactin and prolactin receptor genes with broody traits in chickens. Poultry Science Journal. 84: 839-845.

  7. Kulibaba, R.A. and Podstreshnyi, A.P. (2012). Prolactin and growth hormone gene polymorphisms in chicken lines of Ukrainian selection. Cytology and Genetics. 46: 390-395.

  8. Li, H.F., Zhu, W.Q., Chen, K.W., Zhang, T.J. and Song, W.T. (2009). Association of polymorphisms in the intron 1 of duck prolactin with egg performance. Turkish Journal of Veterinary and Animal Sciences. 33(3): 193-197.

  9. Liang, Y., Cui, J., Yang, G., Leung, F.C. and Zhang, X. (2006). Polymorphisms of 52 flanking region of chicken prolactin gene. Domestic Animal Endocrinology. 30: 1-16.

  10. Lotfi, E., Zerehdaran, S., Ahani, M. and Dehnavi, E. (2013). Genetic polymorphism in prolactin gene and its association with reproductive traits in Japanese quail (Coturnix japonica). Poultry Science Journal. 1: 79-85.

  11. Rashidi, H., Rahimi-Mianji, G., Farhadi, A. and Gholizadeh, M. (2012). Association of prolactin and prolactin receptor gene polymorphisms with economic traits in breeder hens of indigenous chickens of Mazandaran province. Iranian Journal of Biotechnology. 10: 129-135.

  12. Sodhi, S.S., Jeong, D.K., Sharma, N., Lee, J.H., Ki, J.H., Kim, S.H. and Oh, S.J. (2013). Marker assisted selection-applications and evaluation for commercial poultry breeding. Korean Journal of Poultry Science. 40: 223-234.

  13. Vinatzer, U., Taplick, J., Seiser, C., Fonatsch, C. and Wieser, R. (2001). The leukaemia associated transcription factors EVI 1 and MDS1/EVI1 repress transcription and interact with histone deacetylase. British Journal of Haematology. 114: 566-573.

  14. Wilkanowska, A., Mazurowski, A., Mroczkowski, S. and Kokoszyñski, D. (2014) Prolactin (PRL) and prolactin receptor (PRLR) genes and their role in poultry production traits. Folia Biologica. 62: 1-8.

  15. Wolc, A., Kranis, A., Arango, J., Settar, P., Fulton, J.E., O’Sullivan, N.P. and Dekkers, J.C.M. (2016). Implementation of genomic selection in the poultry industry. Animal Frontiers. 6(1): 23-31.

  16. Xu, H., Shen, X., Zhou, M., Fang, M., Zeng, H., Nie, Q. and Zhang, X. (2010). The genetic effects of the dopamine D1 receptor gene on chicken egg production and broodiness traits. BMC Genetics. 11: 17.

  17. Yadav, B.M., Mayura, S.K, Yadav, A., Yadav, S.M. (2018). Polymorphism at prolactin promoter region and its relation with production performance in Aseel birds. International Journal of Current Microbiology and Applied Sciences. 7: 1367-1370.

  18. Yadav, S.K., Maurya, S.K., Yadav, A.K., Yadav, K. and Singh, K.D. (2016). Polymorphism of prolactin gene in relation to egg production performance in Kadaknath hens. Indian Journal Animal Research. 52: 208-211. doi: 10.18805/ijar.11327.
In this Article
Published In
Indian Journal of Animal Research

Editorial Board

View all (0)