Published In
Indian Journal of Animal Research
Article Metrics

95
Views
0
Citations
Reviewed By
In this Article
APC
APC cover the cost of turning a manuscript into a published manuscript through peer-review process, editorial work as well as the cost of hosting, distributing, indexing and promoting the manuscript.
Publish With US
Submit your manuscript through user friendly platform and acquire the maximum impact for your research by publishing with ARCC Journals.
Become a Reviewer/Member
Join our esteemed reviewers panel and become an editorial board member with international experts in the domain of numerous specializations.
Open Access
Filling the gap between research and communication ARCC provide Open Access of all journals which empower research community in all the ways which is accessible to all.
Products and Services
We provide prime quality of services to assist you select right product of your requirement.
Support and Policies
Finest policies are designed to ensure world class support to our authors, members and readers. Our efficient team provides best possible support for you.
Follow us
Research Article
Isolation and Molecular Characterization of Newcastle Disease Virus in Layers
1Department of Veterinary Microbiology, College of Veterinary Science and Animal Husbandry, NDVSU, Jabalpur.
2Animal Biotechnology Centre, Jabalpur,College of Veterinary Science and Animal Husbandry, NDVSU, Jabalpur.
3Department of Veterinary Public Health and Epidemiology, College of Veterinary Science and Animal Husbandry, NDVSU, Jabalpur.
4Department of Veterinary Pathology, College of Veterinary science and Animal Husbandry, NDVSU, Jabalpur.
5Indian Veterinary Research Institute, Bareilly- 243 122, Uttar Pradesh, India.
Submitted08-03-2021|
Accepted24-04-2021|
First Online 27-05-2021|
ABSTRACT
Background: Newcastle disease (ND) in spite of the availability of vaccines remains a constant threat to poultry producers worldwide. It is prevalent in Indian subcontinent and leads to economic losses. The present study was aimed with isolate and identify virulent Newcastle disease virus (NDV) in layer poultry from field outbreaks.
Methods: Total 47 samples consisting of nasal (05), oropharyngeal (13) and cloacal swabs (11) and tissue samples consisting of trachea (07), lungs (06), larynx (05) were collected from layer birds. For isolation of NDV swab and tissue samples were inoculated in 9-11 days old embryonated eggs via allantoic cavity route. After preparing the viral inoculum, 47 suspected samples (29 swab and 18 tissue samples) were inoculated in 141 embryonated eggs to isolate the virus.
Result: Out of 47 samples 10 (21.27%) samples were positive for HA activity. All the 10 isolates showing HA activity subjected to Reverse-Transcriptase PCR of F gene and 6 were found positive in RT-PCR for F1 gene. The PCR amplified product showed amplicon at 356 bp and 254 bp positive for F1 and F2 gene, respectively. On basis of F gene, 06 (50%) isolates were considered as virulent Newcastle Disease Virus. One isolate sequence was submitted at NCBI with accession MT890653 On phylogenetic analysis MT890653 designated as Class II/ genotype II/ virulent strain and had the motif 112R-R-R-K-R-F117 at the cleavage site of the fusion protein.
Methods: Total 47 samples consisting of nasal (05), oropharyngeal (13) and cloacal swabs (11) and tissue samples consisting of trachea (07), lungs (06), larynx (05) were collected from layer birds. For isolation of NDV swab and tissue samples were inoculated in 9-11 days old embryonated eggs via allantoic cavity route. After preparing the viral inoculum, 47 suspected samples (29 swab and 18 tissue samples) were inoculated in 141 embryonated eggs to isolate the virus.
Result: Out of 47 samples 10 (21.27%) samples were positive for HA activity. All the 10 isolates showing HA activity subjected to Reverse-Transcriptase PCR of F gene and 6 were found positive in RT-PCR for F1 gene. The PCR amplified product showed amplicon at 356 bp and 254 bp positive for F1 and F2 gene, respectively. On basis of F gene, 06 (50%) isolates were considered as virulent Newcastle Disease Virus. One isolate sequence was submitted at NCBI with accession MT890653 On phylogenetic analysis MT890653 designated as Class II/ genotype II/ virulent strain and had the motif 112R-R-R-K-R-F117 at the cleavage site of the fusion protein.
INTRODUCTION
Newcastle disease (ND) or Ranikhet disease is a highly contagious viral disease that affects over 250 species of birds of all age groups. It is caused by Newcastle disease virus (NDV) which is a linear, non-segmented single stranded, enveloped, negative sense RNA virus belonging to the order Mononegavirales, family Paramyxoviridae and genus Avulavirus are contained in one serotype and are also known as avian paramyxovirus serotype-1 (APMV-1). RNA genome predicted to have three genome lengths 15,186; 15,192 and 15,198 nucleotides and encodes six genes in the order of 32 -NP-P-M-F-HN-L-52 coding for the nucleocapsid protein (NP), phosphoprotein (P), matrix protein (M), fusion protein (F), an attachment protein, the haemagglutinin-neuraminidase (HN) and a large polymerase protein (L) (Kapczynski et al., 2013). NDV differs in virulence and has been grouped into 5 pathotypes: viscerotropic velogenic, neurotropic velogenic, mesogenic, lentogenic and asymptomatic enteric. ND is mostly (Alexander, 2003). In India according to Oie (2015) a total of 6,93,840 cases with 198 outbreaks were recorded. While, higher seroprevalence of ND in Kuroilers that is 81.4% (Ghosh et al., 2017) was reported in India. The most important component of controlling ND is the need to monitor flock immune response after vaccination. Consequently, the World Organisation for Animal Health (OIE) has included it among the list of diseases that require immediate notification upon recognition (Oie 2012). Present study aimed on isolate and identify the virulent Newcastle disease virus from layer birds. A total of 47 samples of layers from field outbreaks, consisting of 29 swab samples viz. nasal, oropharyngeal and cloacal swabs and 18 tissue samples viz. lung pieces, trachea and larynxfro Jabalpur district of Madhya Pradesh were incorporated in this study.
MATERIALS AND METHODS
Location of work
The work was conducted in the Department of Veterinary Microbiology, College of Veterinary Science and Animal Husbandry, Nanaji Deshmukh Veterinary Science University, Jabalpur, Madhya Pradesh.
Duration of work
The study was conducted for 2 years from June 2018 to June 2020.
Haemagglutination Test and determination of 4HA unit virus for HI test
0.025 ml of PBS was dispensed into each well of a plastic V-bottomed microtitre plate. 0.025 ml of the allantoic fluid was placed in the first well. Two fold dilutions of 0.025 ml volumes of the virus suspension were made across the plate. A further 0.025 ml of PBS was dispensed to each well. 0.025 ml of 1% (v/v) chicken RBCs was dispensed to each well. The solution was mixed by tapping the plate gently. The RBCs were allowed to settle for about 40 minutes at room temperature. HA was determined by tilting the plate and observing the presence or absence of tear-shaped streaming of the RBCs.
Haemagglutination Inhibition (HI) Test (OIE, 2012)
0.025ml of PBS was dispensed into each well of a plastic V-bottomed microtitre plate. 0.025 ml of serum was placed into the first well of the plate. Two fold dilutions of 0.025 ml volumes of the serum was done across the plate. 4 HAU virus/ antigen in 0.025 ml were added to each well and the plate was left for a minimum of 30 minutes at room temperature. 0.025 ml of 1% (v/v) chicken RBCs was added to each well and after gentle mixing, the RBCs was allowed to settle for about 40 minutes at room temperature. The HI was the highest dilution of serum causing complete inhibition of 4 HAU of antigen.
Isolation of Newcastle Disease Virus in embryonated eggs (OIE, 2012 and Alexander and Senne, 2008)
For isolation of virus suspected samples were processed to prepare viral inoculums treated with antibiotics and lastly inoculums were filtered with 0.22µm filter before inoculation in embryo. A volume of 0.2 ml of supernatant was injected into the nine day old embryonated chicken eggs in triplicate by allantoic cavity route and was incubated at 37ºC for 7 days. Candling was performed daily and observed the mortality for 7 days. Allantoic fluid was harvested and subjected to HA test for presence of virus. Determination of thermostable property of Newcastle disease virus was done by exposing infected allantoic fluid to 56°C in water bath for 10, 15, 30 and 60 min. The titre and viability of the virus was detected by HA test. The organs (lungs, intestine, spleen, caecal tonsils and proventriculus) were collected at the time of post mortem examination. The inoculated embryos were examined for any gross abnormal changes.
RNA extraction and cDNA synthesis
The total RNA extraction from allantoic fluid, swab or tissue samples was done by using TRIZOL reagent (Sambrook and Russell, 2001) with some minor modification and quantified in Nanodrop OD at 260. The cDNA synthesis was done using PrimeScript™1st strand cDNAsynthesis kit (Takara) as per manufacturer’s instructions.
Reverse transcriptase polymerase chain reaction (RTPCR)
RT-PCR was carried out using NDV genome-specific primers for Fusion protein gene using two (F1 and F2) primer (F5 ‘GCAGCTCGAGGGATTGTGGT3’ & R5’TCTTTGAGCAGG AGGATGTTG3' for F1 (F5’CCTTGGTGACTCTATCCGCAG 3' & R5’CTGCCACTGCTAGTTGTGATAATCC 3' for F2); (Mohamed et al., 2005 and Guan et al., 2001).
Amplification was performed usingDreamTaqTM Green PCR Master mix 12.5 µl; 2 µl each of primers (10 pmol), 2 µl cDNA (2 µg/20 µl) and nuclease free water up to 25 μl in PCR tubes.
Cycling conditions were set as shown in Table 01. The amplified products were checked for the presence of the desired bands on 1.2% agarose gel.
Sequencing of PCR product
The RT-PCR products of one isolate (L/JBP/OS-3) was subjected to nucleotide sequencing through outsourcing at Eurofins Genomics India Pvt Ltd., Bangalore by Sanger sequencing method using forward and reverse primers for F1 gene.
Phylogenetic analysis
The sequence of F1 genes of Newcastle disease virus was analyzed for evolutionary lineages among themselves and with various Indian and World isolates of NDV. The sequences were analyzed using BLAST (Basic Local Alignment Search Tool) and the Clustal-W (CLUSTAL 2.1 multiple sequence alignment) and Molecular Evolutionary Genetic Analysis (MEGA X) version was used for construction of phylogenetic tree.
Analysis of cleavage site of F gene
The sequence data were compiled with the EditSeq Module of Molecular Evolutionary Genetic Analysis (MEGA X) software. Nucleotide and deduced amino acid sequences of the F gene corresponding to the N terminus of the fusion protein (amino acid residues1-118) of NDV were aligned using the Clustal-W (CLUSTAL 2.1 multiple sequence alignment) of MEGA X software. The nucleotide sequence data of the fusion protein gene used in this study were obtained from GenBank database (Gen Bank, 2004).
The work was conducted in the Department of Veterinary Microbiology, College of Veterinary Science and Animal Husbandry, Nanaji Deshmukh Veterinary Science University, Jabalpur, Madhya Pradesh.
Duration of work
The study was conducted for 2 years from June 2018 to June 2020.
Haemagglutination Test and determination of 4HA unit virus for HI test
0.025 ml of PBS was dispensed into each well of a plastic V-bottomed microtitre plate. 0.025 ml of the allantoic fluid was placed in the first well. Two fold dilutions of 0.025 ml volumes of the virus suspension were made across the plate. A further 0.025 ml of PBS was dispensed to each well. 0.025 ml of 1% (v/v) chicken RBCs was dispensed to each well. The solution was mixed by tapping the plate gently. The RBCs were allowed to settle for about 40 minutes at room temperature. HA was determined by tilting the plate and observing the presence or absence of tear-shaped streaming of the RBCs.
Haemagglutination Inhibition (HI) Test (OIE, 2012)
0.025ml of PBS was dispensed into each well of a plastic V-bottomed microtitre plate. 0.025 ml of serum was placed into the first well of the plate. Two fold dilutions of 0.025 ml volumes of the serum was done across the plate. 4 HAU virus/ antigen in 0.025 ml were added to each well and the plate was left for a minimum of 30 minutes at room temperature. 0.025 ml of 1% (v/v) chicken RBCs was added to each well and after gentle mixing, the RBCs was allowed to settle for about 40 minutes at room temperature. The HI was the highest dilution of serum causing complete inhibition of 4 HAU of antigen.
Isolation of Newcastle Disease Virus in embryonated eggs (OIE, 2012 and Alexander and Senne, 2008)
For isolation of virus suspected samples were processed to prepare viral inoculums treated with antibiotics and lastly inoculums were filtered with 0.22µm filter before inoculation in embryo. A volume of 0.2 ml of supernatant was injected into the nine day old embryonated chicken eggs in triplicate by allantoic cavity route and was incubated at 37ºC for 7 days. Candling was performed daily and observed the mortality for 7 days. Allantoic fluid was harvested and subjected to HA test for presence of virus. Determination of thermostable property of Newcastle disease virus was done by exposing infected allantoic fluid to 56°C in water bath for 10, 15, 30 and 60 min. The titre and viability of the virus was detected by HA test. The organs (lungs, intestine, spleen, caecal tonsils and proventriculus) were collected at the time of post mortem examination. The inoculated embryos were examined for any gross abnormal changes.
RNA extraction and cDNA synthesis
The total RNA extraction from allantoic fluid, swab or tissue samples was done by using TRIZOL reagent (Sambrook and Russell, 2001) with some minor modification and quantified in Nanodrop OD at 260. The cDNA synthesis was done using PrimeScript™1st strand cDNAsynthesis kit (Takara) as per manufacturer’s instructions.
Reverse transcriptase polymerase chain reaction (RTPCR)
RT-PCR was carried out using NDV genome-specific primers for Fusion protein gene using two (F1 and F2) primer (F5 ‘GCAGCTCGAGGGATTGTGGT3’ & R5’TCTTTGAGCAGG AGGATGTTG3' for F1 (F5’CCTTGGTGACTCTATCCGCAG 3' & R5’CTGCCACTGCTAGTTGTGATAATCC 3' for F2); (Mohamed et al., 2005 and Guan et al., 2001).
Amplification was performed usingDreamTaqTM Green PCR Master mix 12.5 µl; 2 µl each of primers (10 pmol), 2 µl cDNA (2 µg/20 µl) and nuclease free water up to 25 μl in PCR tubes.
Cycling conditions were set as shown in Table 01. The amplified products were checked for the presence of the desired bands on 1.2% agarose gel.
Sequencing of PCR product
The RT-PCR products of one isolate (L/JBP/OS-3) was subjected to nucleotide sequencing through outsourcing at Eurofins Genomics India Pvt Ltd., Bangalore by Sanger sequencing method using forward and reverse primers for F1 gene.
Phylogenetic analysis
The sequence of F1 genes of Newcastle disease virus was analyzed for evolutionary lineages among themselves and with various Indian and World isolates of NDV. The sequences were analyzed using BLAST (Basic Local Alignment Search Tool) and the Clustal-W (CLUSTAL 2.1 multiple sequence alignment) and Molecular Evolutionary Genetic Analysis (MEGA X) version was used for construction of phylogenetic tree.
Analysis of cleavage site of F gene
The sequence data were compiled with the EditSeq Module of Molecular Evolutionary Genetic Analysis (MEGA X) software. Nucleotide and deduced amino acid sequences of the F gene corresponding to the N terminus of the fusion protein (amino acid residues1-118) of NDV were aligned using the Clustal-W (CLUSTAL 2.1 multiple sequence alignment) of MEGA X software. The nucleotide sequence data of the fusion protein gene used in this study were obtained from GenBank database (Gen Bank, 2004).
RESULTS AND DISCUSSION
Isolation of virus in embryonated chicken eggs from swab and tissue samples of layers
Overall from live bird 04 HA positive sample, 03 samples HA titre was equal to or higher than 24 while 01 samplesshowed 23 titre. All the nasal swabs samples of layer birds showed no HA activity. 3 HA positive oropharyngeal swab samples showed higher HA titre, equal to or higher than 24 that is 1:16 or above. Similarly, from one HA positive cloacal swabs samples of layer birds HA titre was 26 as shown in Table 2 Fig 1.
A total of 18 tissue samples viz. 06 lung, 07 trachea, 05 larynx were collected at the time of necropsy from layer birds, which were clinically showing drowsiness and respiratory signs and at necropsy haemorrhage in proventriculus, congestion in larynx, trachea and lung were suspected for Newcastle disease virus infection. All the 18 samples were inoculated in 54 embryonated eggs in triplicates via allantoic cavity route. Embryonated eggs that showed mortality after 24 hours of incubation and presence of haemorrhagic lesion were selected for harvesting of allantoic fluid and HA test. All HA positive (03) NDV suspected samples were having HA titre equal to or higher than 23. While, from 05 lyranx sample mortality was recorded in 07 embryonated eggs and 02 sample allontoic fluids showed HA activity. From both HA positive larynx samples of layer birds the HA titre was equal to or higher than 24. From 07 trachea sample mortality was recorded in 06 embryonated eggs and 01 samples allontoic fluid showed HA activity. Whereas, from 02 NDV suspected trachea samples of layer, embryonic mortality was recorded but the HA activity was not determined. From tissues overall NDV isolation rate in layer birds was 33.33% (6/18). Individually from tissues, larynx 40% (2/5), trachea 14.28% (1/7) and lungs 50% (3/6) samples were suspected for Newcastle disease virus as shown in Table 02. A total of 47 suspected samples (29 swab and 18 tissue samples) were inoculated in 141 embryonated eggs to isolate the virus. The overall isolation of virus from layer poultry was 10/47 (21.27%).
Gowthaman et al., 2013 isolated NDV form all the pooled samples from natural outbreak of Newcastle disease in turkeys, Japanese quails and chicken in a multi–species poultry farm in northern India and they found mean HA titer varied between 4 (22) to 8(23) in chickens, whereas it remained high in turkeys and quails and varied between 32(25) to 1024 (210). Balachandran et al., (2014) isolated and characterized Newcastle disease virus from vaccinated commercial layer chicken and the incidence of ND was most commonly noticed in 20-50 week of age and between the months of September to November. Kianizadeh et al., (1999) recovered 12 isolates of NDV from different outbreaks in Iran and found ICPI varying from 1.7 to 1.96 and described them as characteristic velogenic NDV. Leow et al., (2011) reported outbreaks during extreme hot months of April to June in layer flocks. In the present study the occurrence was seen in winter months also.
Reverse Transcriptase - Polymerase Chain Reaction (RT- PCR) of F gene
The F glycoprotein is responsible for fusion between the cellular and viral membranes and subsequent virus genome penetration and infectivity. The F gene of 10 HA positive NDV isolates were amplified by RT-PCR using NDV-F1 and F2 primers with the expected band size of 356 and 254, respectively. Out of 10 isolates 08 isolates were showing positive for molecular identification. For Fusion protein gene of Newcastle disease virus F1, F2, 06 and 04 isolates were positive showing amplification band at 356bp and 254 bp, respectively (Table 3, Fig 2 and 3).
The conserved amino acid sequence “RRQKR” of F gene segment can be amplified by the primer F1 and F2 indicating that the isolates were velogenic NDV (Aldous and Alexander, 2001) whereas LaSota being a lentogenic strain having an amino acid sequence as “GRQGRL” (Nanthakumar et al., 2000) could not be amplified with this primer pair.
Guan et al. (2001) subjected field isolate to RT-PCR of the fusion (F) gene amplified by gene specific primers into 254 bp product except in case of LaSota vaccine. The F glycoprotein is responsible for fusion between the cellular and viral membranes and subsequent virus genome penetration and infectivity. The primer F1 and F2 could amplify the conserved amino acid sequence ‘’112 RRQKR 116’’ of F gene segment in viral genome indicating that the isolates were velogenic NDV (Aldous and Alexander, 2001) whereas, LaSota being a lentogenic strain having an amino acid sequence as “GRQGRL” (Nanthakumar et al., 2000b) could not be amplified with this primer pair. Mohammed et al., (2013) isolated viral RNA from 34 field samples and 26 HA positive allantoic fluid for the detection of NDV genome by RTPCR using NDV specific primers and amplified F gene at 387 bp.
Nucleotide sequencing and blast search
The RT-PCR products of two isolates of layers (L/JBP/OS-3) was subjected to nucleotide sequencing through outsourcing at Eurofins Genomics India Pvt Ltd., Bangalore by Sanger sequencing method using forward and reverse primers for F gene. The sequence (MT 890653) were subjected to NCBI blast search.
The results of the blast search revealed that the isolate L/JBP/OS-3 had close similarity with the isolates from India had 99.35%, 99.02%, 98.69%, 98.05% and 98.04% identity (Table 4).
Multiple alignment of nucleotide sequences and phylogenetic analysis
The coding region of F gene of (L/JBP/OS-3) was aligned with the corresponding region of the F gene of different NDV strains belonging to 18 different genotypes from worldwide, downloaded from the GenBank. A phylogenetic tree was constructed (Fig 4). In the phylogenetic tree, L/JBP/OS-3 isolate clustered with the velogenic strain (Texas GB) under genotype II.
The phylogenetic tree based on the similarity of isolate L/JBP/OS-3 with different isolates worldwide respectively. Sequence analysis of the F protein of isolate L/JBP/OS-3 is 99.11% amino acid identity with that of strain BC (Table 4). Phylogenetic analysis showed that L/JBP/OS-3 isolate closely related with the virulent NDV strain Texas GB and Beaudette C in genotype II of class II viruses, respectively (Fig 5). The findings of present study are resembled with the findings of (Mohamed et al., 2011). The F protein cleavage site sequence is a well-characterized determinant of NDV pathogenicity in chickens (Panda et al., 2004). Virulent NDV strains typically contain a polybasic cleavage site (R-X-K/R-R¯F), which is recognized by intracellular proteases present in most cell types. The cleavage site of all Egyptian strains contained four basic amino acids at positions 112-116 (112R-R-Q-K-R¯F-I118). The presence of the phenylalanine (F) residue at position 117 also a possible contributor to the neurological effects (Lamb and Parks, 2007).
Analysis of the fusion protein cleavage site
The amino acid sequences of the fusion protein cleavage site (amino acid residue 112 to 118) of different strains belonging to different genotypes are shown in Table 5. The isolate (L/JBP/OS-3) possessed the amino acid sequences 112R-R-R-K-R-F117at F0 cleavage site, which was identical to the motif of velogenic type of NDV; presence of multiple basic amino acid sequence indicates the virulent strain. There are no changes in the single nucleotides of representative amino acids; hence no mutation occurred (Fig 3). The sequence was submitted at NCBI with accession MT890653. On phylogenetic analysis MT890653 was designated as Class II/ genotype II/ velogenic strain (Fig 6).
The amino acid sequence at fusion protein cleavage site is a major determinant of NDV virulence (Millar et al., 1986). Presence of multiple amino acids at neucleotide position from 112 to 117 indicates the velogenic strains (Vegad and Katiyar, 2017). Virulent NDV strains typically contain a polybasic cleavage site (R-X-K/R-R¯F), which is recognized by intracellular proteases present in most cell types. In a study Mohamed et al., (2011) found the cleavage site of all Egyptian strains contained four basic amino acids at positions 112-116 (112R-R-Q-K-R¯F-I118). In addition, the presence of the phenylalanine (F) residue at position 117 has been described as being a possible contributor to the neurological effects (Lamb and Parks, 2007).
Overall from live bird 04 HA positive sample, 03 samples HA titre was equal to or higher than 24 while 01 samplesshowed 23 titre. All the nasal swabs samples of layer birds showed no HA activity. 3 HA positive oropharyngeal swab samples showed higher HA titre, equal to or higher than 24 that is 1:16 or above. Similarly, from one HA positive cloacal swabs samples of layer birds HA titre was 26 as shown in Table 2 Fig 1.
A total of 18 tissue samples viz. 06 lung, 07 trachea, 05 larynx were collected at the time of necropsy from layer birds, which were clinically showing drowsiness and respiratory signs and at necropsy haemorrhage in proventriculus, congestion in larynx, trachea and lung were suspected for Newcastle disease virus infection. All the 18 samples were inoculated in 54 embryonated eggs in triplicates via allantoic cavity route. Embryonated eggs that showed mortality after 24 hours of incubation and presence of haemorrhagic lesion were selected for harvesting of allantoic fluid and HA test. All HA positive (03) NDV suspected samples were having HA titre equal to or higher than 23. While, from 05 lyranx sample mortality was recorded in 07 embryonated eggs and 02 sample allontoic fluids showed HA activity. From both HA positive larynx samples of layer birds the HA titre was equal to or higher than 24. From 07 trachea sample mortality was recorded in 06 embryonated eggs and 01 samples allontoic fluid showed HA activity. Whereas, from 02 NDV suspected trachea samples of layer, embryonic mortality was recorded but the HA activity was not determined. From tissues overall NDV isolation rate in layer birds was 33.33% (6/18). Individually from tissues, larynx 40% (2/5), trachea 14.28% (1/7) and lungs 50% (3/6) samples were suspected for Newcastle disease virus as shown in Table 02. A total of 47 suspected samples (29 swab and 18 tissue samples) were inoculated in 141 embryonated eggs to isolate the virus. The overall isolation of virus from layer poultry was 10/47 (21.27%).
Gowthaman et al., 2013 isolated NDV form all the pooled samples from natural outbreak of Newcastle disease in turkeys, Japanese quails and chicken in a multi–species poultry farm in northern India and they found mean HA titer varied between 4 (22) to 8(23) in chickens, whereas it remained high in turkeys and quails and varied between 32(25) to 1024 (210). Balachandran et al., (2014) isolated and characterized Newcastle disease virus from vaccinated commercial layer chicken and the incidence of ND was most commonly noticed in 20-50 week of age and between the months of September to November. Kianizadeh et al., (1999) recovered 12 isolates of NDV from different outbreaks in Iran and found ICPI varying from 1.7 to 1.96 and described them as characteristic velogenic NDV. Leow et al., (2011) reported outbreaks during extreme hot months of April to June in layer flocks. In the present study the occurrence was seen in winter months also.
Reverse Transcriptase - Polymerase Chain Reaction (RT- PCR) of F gene
The F glycoprotein is responsible for fusion between the cellular and viral membranes and subsequent virus genome penetration and infectivity. The F gene of 10 HA positive NDV isolates were amplified by RT-PCR using NDV-F1 and F2 primers with the expected band size of 356 and 254, respectively. Out of 10 isolates 08 isolates were showing positive for molecular identification. For Fusion protein gene of Newcastle disease virus F1, F2, 06 and 04 isolates were positive showing amplification band at 356bp and 254 bp, respectively (Table 3, Fig 2 and 3).
The conserved amino acid sequence “RRQKR” of F gene segment can be amplified by the primer F1 and F2 indicating that the isolates were velogenic NDV (Aldous and Alexander, 2001) whereas LaSota being a lentogenic strain having an amino acid sequence as “GRQGRL” (Nanthakumar et al., 2000) could not be amplified with this primer pair.
Guan et al. (2001) subjected field isolate to RT-PCR of the fusion (F) gene amplified by gene specific primers into 254 bp product except in case of LaSota vaccine. The F glycoprotein is responsible for fusion between the cellular and viral membranes and subsequent virus genome penetration and infectivity. The primer F1 and F2 could amplify the conserved amino acid sequence ‘’112 RRQKR 116’’ of F gene segment in viral genome indicating that the isolates were velogenic NDV (Aldous and Alexander, 2001) whereas, LaSota being a lentogenic strain having an amino acid sequence as “GRQGRL” (Nanthakumar et al., 2000b) could not be amplified with this primer pair. Mohammed et al., (2013) isolated viral RNA from 34 field samples and 26 HA positive allantoic fluid for the detection of NDV genome by RTPCR using NDV specific primers and amplified F gene at 387 bp.
Nucleotide sequencing and blast search
The RT-PCR products of two isolates of layers (L/JBP/OS-3) was subjected to nucleotide sequencing through outsourcing at Eurofins Genomics India Pvt Ltd., Bangalore by Sanger sequencing method using forward and reverse primers for F gene. The sequence (MT 890653) were subjected to NCBI blast search.
The results of the blast search revealed that the isolate L/JBP/OS-3 had close similarity with the isolates from India had 99.35%, 99.02%, 98.69%, 98.05% and 98.04% identity (Table 4).
Multiple alignment of nucleotide sequences and phylogenetic analysis
The coding region of F gene of (L/JBP/OS-3) was aligned with the corresponding region of the F gene of different NDV strains belonging to 18 different genotypes from worldwide, downloaded from the GenBank. A phylogenetic tree was constructed (Fig 4). In the phylogenetic tree, L/JBP/OS-3 isolate clustered with the velogenic strain (Texas GB) under genotype II.
The phylogenetic tree based on the similarity of isolate L/JBP/OS-3 with different isolates worldwide respectively. Sequence analysis of the F protein of isolate L/JBP/OS-3 is 99.11% amino acid identity with that of strain BC (Table 4). Phylogenetic analysis showed that L/JBP/OS-3 isolate closely related with the virulent NDV strain Texas GB and Beaudette C in genotype II of class II viruses, respectively (Fig 5). The findings of present study are resembled with the findings of (Mohamed et al., 2011). The F protein cleavage site sequence is a well-characterized determinant of NDV pathogenicity in chickens (Panda et al., 2004). Virulent NDV strains typically contain a polybasic cleavage site (R-X-K/R-R¯F), which is recognized by intracellular proteases present in most cell types. The cleavage site of all Egyptian strains contained four basic amino acids at positions 112-116 (112R-R-Q-K-R¯F-I118). The presence of the phenylalanine (F) residue at position 117 also a possible contributor to the neurological effects (Lamb and Parks, 2007).
Analysis of the fusion protein cleavage site
The amino acid sequences of the fusion protein cleavage site (amino acid residue 112 to 118) of different strains belonging to different genotypes are shown in Table 5. The isolate (L/JBP/OS-3) possessed the amino acid sequences 112R-R-R-K-R-F117at F0 cleavage site, which was identical to the motif of velogenic type of NDV; presence of multiple basic amino acid sequence indicates the virulent strain. There are no changes in the single nucleotides of representative amino acids; hence no mutation occurred (Fig 3). The sequence was submitted at NCBI with accession MT890653. On phylogenetic analysis MT890653 was designated as Class II/ genotype II/ velogenic strain (Fig 6).
The amino acid sequence at fusion protein cleavage site is a major determinant of NDV virulence (Millar et al., 1986). Presence of multiple amino acids at neucleotide position from 112 to 117 indicates the velogenic strains (Vegad and Katiyar, 2017). Virulent NDV strains typically contain a polybasic cleavage site (R-X-K/R-R¯F), which is recognized by intracellular proteases present in most cell types. In a study Mohamed et al., (2011) found the cleavage site of all Egyptian strains contained four basic amino acids at positions 112-116 (112R-R-Q-K-R¯F-I118). In addition, the presence of the phenylalanine (F) residue at position 117 has been described as being a possible contributor to the neurological effects (Lamb and Parks, 2007).
CONCLUSION
The study concluded that conventionally 10/47 (21.27%) were positive for NDV and molecular identification showing 8/10 (80%) positive for F gene. On basis of F gene, 06 (50%) isolates were considered as velogenic Newcastle Disease Virus and 02(20%) isolates may have mixed infection can be velogenic/mesogenic/lentogenic. One isolate sequence is submitted at NCBI with accession MT890653 On phylogenetic analysis MT890653 designated as Class II/ genotype II/ velogenic strain and had the motif 112R-R-R-K-R-F117 at the cleavage site of the fusion protein, which was typical of velogenic NDV isolates.
REFERENCES
- Aldous, E.W. and Alexander, D.J. (2001). Detection and differentiation of Newcastle disease virus (avian paramyxovirus type 1). Avian Pathology. 30: 1-10.
- Alexander, D.J. (2003). Newcastle disease and other Paramyxoviridae infections, Diseases of poultry, 11th Edn., Iowa State University Press, Ames, USA. pp. 63-87.
- Balachandran, P., Srinivasan, P., Sivaseelan, S., Balasubramaniam, G.A. and Murthy, G.K. (2014). Isolation and characterization of Newcastle disease virus from vaccinated commercial layer chicken. Veterinary World. 7(7): 457-462.
- GenBank (2004). National Library of Medicine (US), National Center for Biotechnology Information; https://www.ncbi.nlm.nih.gov/gene/.
- Gowthaman, V., Singh, S.D., Barathidasan, R., Ayanur, A. and Dhama, K. (2013). Natural outbreak of Newcastle disease in turkeys and japanese quails housed along with chicken in a multi–species poultry farm in Northern India. Advances in Animal and Veterinary Sciences. 1(3): 17-20.
- Guan, M.K., Hung, J.L., Maw, Y.L., Jen, H.C. and Tsai, S.S. (2001). Molecular characterization of Newcastle disease viruses isolated from recent outbreak in Taiwan. Journal of Virology Methods. 97: 1-11.
- Kapczynski, D.R., Afonso, C.L. and Miller, P.J. (2013). Immune responses of poultry to Newcastle disease virus. Developmental and Comparative Immunology. 3: 447-453.
- Kianizadeh, M., Ideris, A., Shahrabadi, M.S., Kargar, R., Pourbakhsh, S.A., Omar, A.R. and Yusof, K. (1999). Biological and molecular characterization of Newcastle disease virus isolated from Iran. Archives of Razi Institute. 50: 1-9.
- Lamb, R. and Parks, G. (2007). Paramyxoviridae: the viruses and their replication. In Fields Virology. 5th Edn., Philadelphia, USA, pp. 1449-1496.
- Leow, B.L., Shajarutulwardah, M.Y. and Ramlan, M. (2011). Newcastle disease in Malaysia: diagnostic cases in veterinary research institute (VRI) IPOH from 2004-2009. Malaysian Journal of Veterinary Research. 2(1): 45-51.
- Millar, N.S., Chambers, P. and Emmerson, P.T. (1986). Nucleotide sequence analysis of the haemagglutinin-neuraminidase gene of Newcastle disease virus. Journal of General Virology. 67: 1917-1927.
- Mohamed, A.M., Yousuf, Aradaib, I.E., Khairalla, K.M.S., Abdalla, M.A., Karrar, A.R.E. and Hussein, A.R.M. (2005). Evaluation of RT-PCR for rapid detection of Sudanese Isolates and Vaccine strains of Newcastle disease virus. Pakistan Journal of Biological Sciences. 8(3): 418-420.
- Mohamed, M.H.A., Kumar, S., Paldurai, A. and Samal, S.K. (2011). Sequence analysis of fusion protein gene of Newcastle disease virus isolated from outbreaks in Egypt during 2006. Virology Journal. 8: 237.
- Mohammed, M.H., Zahid, A.H., Kadhim, L.I. and Hasoon, M.F. (2013). Conventional and molecular detection of Newcastle disease and infectious bursal disease in chickens. Journal of World’s Poultry Research. 3(1): 05-12.
- Nanthakumar, T., Kataria, R.S., Tiwari, A.K., Butchaiah, G. and Kataria, J.M. (2000).Pathotyping of Newcastle disease virus by RT-PCR and restriction enzyme analysis. Veterinary Research Communication. 24(4): 275-286.
- Panda, A., Huang. Z., Elankumaran, S., Rockemann, D.D. and Samal, S.K. (2004).Role of fusion protein cleavage site in the virulence of Newcastle disease virus. Microbial Pathogenesis. 36: 1-10.
- Sambrook, J.F. and Russell, D.W. (2001). Molecular cloning: a laboratory manual, 3rd Edn., Cold Spring Harbor Laboratory Press, New York, 2100 p.
- Vegad, J. and Katiyar, A.K. (2017). Textbook of Veterinary Systemic Pathology.International Book Distributing Company, Lucknow, U.P., Edn., 460p.
Disclaimer :
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.
Copyright :
This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
In this Article
APC
APC cover the cost of turning a manuscript into a published manuscript through peer-review process, editorial work as well as the cost of hosting, distributing, indexing and promoting the manuscript.
Publish With US
Submit your manuscript through user friendly platform and acquire the maximum impact for your research by publishing with ARCC Journals.
Become a Reviewer/Member
Join our esteemed reviewers panel and become an editorial board member with international experts in the domain of numerous specializations.
Open Access
Filling the gap between research and communication ARCC provide Open Access of all journals which empower research community in all the ways which is accessible to all.
Products and Services
We provide prime quality of services to assist you select right product of your requirement.
Support and Policies
Finest policies are designed to ensure world class support to our authors, members and readers. Our efficient team provides best possible support for you.
Follow us
Published In
Indian Journal of Animal Research