Published In
Indian Journal of Animal Research
Article Metrics

105
Views
0
Citations
Reviewed By
In this Article
APC
APC cover the cost of turning a manuscript into a published manuscript through peer-review process, editorial work as well as the cost of hosting, distributing, indexing and promoting the manuscript.
Publish With US
Submit your manuscript through user friendly platform and acquire the maximum impact for your research by publishing with ARCC Journals.
Become a Reviewer/Member
Join our esteemed reviewers panel and become an editorial board member with international experts in the domain of numerous specializations.
Open Access
Filling the gap between research and communication ARCC provide Open Access of all journals which empower research community in all the ways which is accessible to all.
Products and Services
We provide prime quality of services to assist you select right product of your requirement.
Support and Policies
Finest policies are designed to ensure world class support to our authors, members and readers. Our efficient team provides best possible support for you.
Follow us
Research Article
Effect of Growth Hormone-releasing Hormone Gene Polymorphism (GHRH/HAEIII) on First Lactation Milk Yield and Milk Composition Traits in Sahiwal Cattle
1Krishi Vigyan Kendra, Banda-210 001, Uttar Pradesh, India.
2CSSS (PG) College, Machhra, Meerut-250 106, Uttar Pradesh, India.
3Krishi Vigyan Kendra, Ajmer-305 206, Rajasthan, India.
4Division of Animal Genetics and Breeding, ICAR-National Dairy Research Institute, Karnal-132 001, Haryana, India.
5Division of Animal Nutrition, ICAR-National Dairy Research Institute, Karnal-132 001, Haryana, India.
Submitted26-08-2020|
Accepted21-12-2020|
First Online 29-01-2021|
Cite article:- Singh Manvendra, Arya Ashwani, Singh Pratap Arun, Gupta A.K., Dixit Sonam (2022). Effect of Growth Hormone-releasing Hormone Gene Polymorphism (GHRH/HAEIII) on First Lactation Milk Yield and Milk Composition Traits in Sahiwal Cattle
. Indian Journal of Animal Research. 56(5): 531-535. doi: 10.18805/IJAR.B-4296.
ABSTRACT
Background: Growth hormone-releasing hormone (GHRH), also known as somatoliberin is a releasing hormone of growth hormone (GH). GHRH is a peptide hormone found mainly in the hypothalamus. The gene is significantly associated with increase milk yield in cattle. The objective of this study was to identify the polymorphism in the GHRH gene (GHRH/HaeIII) and to evaluate the relationship between the polymorphism with the breeding values for first lactation milk production and composition traits of Sahiwal cattle reared using PCR-RFLP.
Methods: A total of 130 animals were included in the study. PCR-RFLP analysis of each 297bp PCR product was carried out using HaeIII restriction enzyme. The single trait animal model was considered for the estimation of breeding values using WOMBAT software. To study the effect of genotype on the individual trait, PROC GLM (SAS 4.3) was used.
Result: PCR-RFLP analysis of GHRH gene revealed three genotypes with genotypic frequencies as; 0.05 (AA), 0.42 (AB) and 0.53 (BB). The allelic frequencies for A and B allele were 0.26 and 0.74, respectively. Sahiwal cows with AA genotype have significantly higher (p<0.017) fat percentage in milk while the cows with BB genotype; while the BB genotype cows characterized by significantly higher (p<0.025) first lactation 305 day milk yield. Among the three genotypes, BB was most abundant while AA genotype was rarest in the screened Sahiwal samples. The identified potential genetic marker could be used for the development of Marker Assisted Selection (MAS) strategy for higher milk yield and milk composition traits in Sahiwal cattle.
Methods: A total of 130 animals were included in the study. PCR-RFLP analysis of each 297bp PCR product was carried out using HaeIII restriction enzyme. The single trait animal model was considered for the estimation of breeding values using WOMBAT software. To study the effect of genotype on the individual trait, PROC GLM (SAS 4.3) was used.
Result: PCR-RFLP analysis of GHRH gene revealed three genotypes with genotypic frequencies as; 0.05 (AA), 0.42 (AB) and 0.53 (BB). The allelic frequencies for A and B allele were 0.26 and 0.74, respectively. Sahiwal cows with AA genotype have significantly higher (p<0.017) fat percentage in milk while the cows with BB genotype; while the BB genotype cows characterized by significantly higher (p<0.025) first lactation 305 day milk yield. Among the three genotypes, BB was most abundant while AA genotype was rarest in the screened Sahiwal samples. The identified potential genetic marker could be used for the development of Marker Assisted Selection (MAS) strategy for higher milk yield and milk composition traits in Sahiwal cattle.
INTRODUCTION
The main aim of an animal breeder is to increase the frequency of desirable genes in the population so that the traits governed by those genes show their optimal performance. Conventionally, selective breeding with superior phenotypes is the main tool for the genetic improvement of livestock which includes progeny testing and various selection programs. Advances in the field of molecular genetics have opened the gateway for the identification of many potential genetic markers. The study of these genetic markers has enabled us to identify the genomic regions related to markers and will eventually allow the identification of QTLs (quantitative trait loci). The accuracy of selection increases with the use of information provided by the markers underlying a QTL and hence, will increase responses to selection (Beuzen et al., 2000). The hypothalamus is a portion of the brain that contains many small nuclei with a variety of functions. One of the most important functions of the hypothalamus is to link the nervous system to the endocrine system via the pituitary gland. It is connected to the pituitary gland by a stalk in which there is a portal venous system and axons of the nerve cells of the hypothalamus that connect these two glands. Growth hormone or somatotropin is secreted by the anterior portion of the hypothalamus, which is an endocrine gland and the hypothalamus controls the secretion of the growth hormone via the GHRH (growth hormone-releasing hormone) and the SRIF inhibiting hormone (somatostatin). Growth hormone-releasing hormone (GHRH), also known as somatoliberin is a releasing hormone of growth hormone (GH). GHRH acts on somatotrophs of the anterior pituitary to stimulate their growth (Billestrup et al., 1986) and the synthesis and release of growth hormone (Tuggle and Trenkle, 1995). The bovine GHRH gene has been mapped to chromosome 13 (Barendse et al., 1994). Bovine GHRH gene consists of five exons separated by four introns (Zhou et al., 2000) and spans over 10 kb and encodes 106 aa (NCBI Accession Number AC-000176.1 and Gene ID 282375). Association between the GHRH gene with an increased milk yield was confirmed by Baile and Buonomo (1987), who found that that administering the GHRH hormone increased the metabolic activity of mammary gland cells. Moody et al., (1995) were the first to study the GHRH gene locus using the PCR-RFLP method and the enzyme HaeIII in Holstein Friesian cattle. They observed that the rare (7.7%) genotype AA, identified with PCR-RFLP was associated with an increase in fat percentage and fat yield. Here, the purpose of the present study was to estimate the allelic frequencies at GHRH-Hae III locus and to investigate the relationship of this polymorphism with milk production and composition traits in Sahiwal cattle.
MATERIALS AND METHODS
Ethical approval
The present study was approved by Institutional Animal Ethics Committee of ICAR-National Dairy Research Institute, Karnal, Haryana, India.
Sample collection
The study was conducted by using the blood samples of 130 Sahiwal cattle, maintained at Livestock Research Centre (LRC) of ICAR-National Dairy Research Institute, Karnal. The study area (Karnal) is situated at an altitude of 250 meters above the mean sea level in the Indo-Gangetic alluvial plains on 29°42'N latitude and 72°02'E longitude. The climate of the farm is subtropical.
DNA isolation and quality checking
Phenol-chloroform method, as suggested by Sambrook and Russel (2001) with minor modifications was used for the isolation of genomic DNA from the blood samples of Sahiwal cattle. The quality and the quantity of DNA was assessed using agarose gel electrophoresis and nanodrop spectro photometer, respectively. The stock solutions of DNA were stored at -20°C and used for further analysis.
Primer used
The targeted region of the GHRH gene was exon 2 and 3 and the following primers designed by Dybus et al., (2003) were applied: F 5' TTCCCAAGCCTCTCAGGTAA3' and R 5' GCGTACCGTGGAATCCTAGT 3'.
PCR amplification of targeted region
Targeted region of GHRH gene (66876899-66877195) was amplified by standardizing the PCR program with the help of thermal cycler. The PCR reaction was performed in a final volume of 25 µl containing 100 ng of template DNA, 10 pmole of each primer, 10X PCR buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 1 mM MgCl2, 2.0 mM of dNTPs and 1 µl of Taq-polymerase (Amnion Biosciences Pvt. Ltd. India). This solution was initially denatured at 94°C for 5 min, followed by 35 cycles of denaturation (94°C for 1 min), annealing (57°C for 1min), elongation (72°C for 1 min) and a final extension at 72°C for 5 min. the amplified product was checked using agarose gel electrophoresis using 1.7% agarose.
Restriction fragment length polymorphism
The amplified PCR product was subjected to restriction fragment length polymorphism (RFLP) with restriction endonuclease enzyme to generate a unique restriction polymorphic profile. The 297 bp amplified PCR product was digested with HaeIII. The restricted PCR products were checked on 2.5% agarose gel with ethidium bromide staining. The agarose gels were visualized and photographed under UV light (312 nm) in the gel documentation system and were then scored for their respective genotypes.
Estimation of genotype and gene frequency
The genotype and gene frequencies were calculated by Gene counting method, as suggested by Falconer and Mackay (1996).
Phenotypic traits of sahiwal cattle
The data of first lactation production records of 328 Sahiwal cows sired by 64 bulls spread over 27 years (1989-2016), collected from Record Cell, Animal Genetics and Breeding Division of ICAR-National Dairy Research Institute, Karnal. Data were analyzed for first lactation milk production and composition traits viz. First lactation 305-day milk yield (FL305DMY-kg), Average test day milk yield (ATDMY-kg), Average test day fat percentage (ATDFP-%), Average test day fat yield (ATDFY-g) and Lactation fat yield (LFY-kg).
Statistical analysis
The effect of non-genetic factors on normalized production traits was studied by the least-squares analysis for non-orthogonal data, using a fixed linear model (Harvey, 1990). The estimation of breeding values of Sahiwal animals for milk production and composition traits was done using WOMBAT software (Meyer, 2007). The effect of genotype on individual trait was explored using, PROC GLM (SAS 4.3) with the help of the following model:
Where
Yij- The breeding value of jth trait under effect ith genotype of SNP.
µ- Overall mean.
Gi- The fixed effect of the ith genotype of SNPs.
eij- Random error, assumed to be normally and independently distributed with mean zero and constant variance i.e. NID (0,σ2e).
The present study was approved by Institutional Animal Ethics Committee of ICAR-National Dairy Research Institute, Karnal, Haryana, India.
Sample collection
The study was conducted by using the blood samples of 130 Sahiwal cattle, maintained at Livestock Research Centre (LRC) of ICAR-National Dairy Research Institute, Karnal. The study area (Karnal) is situated at an altitude of 250 meters above the mean sea level in the Indo-Gangetic alluvial plains on 29°42'N latitude and 72°02'E longitude. The climate of the farm is subtropical.
DNA isolation and quality checking
Phenol-chloroform method, as suggested by Sambrook and Russel (2001) with minor modifications was used for the isolation of genomic DNA from the blood samples of Sahiwal cattle. The quality and the quantity of DNA was assessed using agarose gel electrophoresis and nanodrop spectro photometer, respectively. The stock solutions of DNA were stored at -20°C and used for further analysis.
Primer used
The targeted region of the GHRH gene was exon 2 and 3 and the following primers designed by Dybus et al., (2003) were applied: F 5' TTCCCAAGCCTCTCAGGTAA3' and R 5' GCGTACCGTGGAATCCTAGT 3'.
PCR amplification of targeted region
Targeted region of GHRH gene (66876899-66877195) was amplified by standardizing the PCR program with the help of thermal cycler. The PCR reaction was performed in a final volume of 25 µl containing 100 ng of template DNA, 10 pmole of each primer, 10X PCR buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 1 mM MgCl2, 2.0 mM of dNTPs and 1 µl of Taq-polymerase (Amnion Biosciences Pvt. Ltd. India). This solution was initially denatured at 94°C for 5 min, followed by 35 cycles of denaturation (94°C for 1 min), annealing (57°C for 1min), elongation (72°C for 1 min) and a final extension at 72°C for 5 min. the amplified product was checked using agarose gel electrophoresis using 1.7% agarose.
Restriction fragment length polymorphism
The amplified PCR product was subjected to restriction fragment length polymorphism (RFLP) with restriction endonuclease enzyme to generate a unique restriction polymorphic profile. The 297 bp amplified PCR product was digested with HaeIII. The restricted PCR products were checked on 2.5% agarose gel with ethidium bromide staining. The agarose gels were visualized and photographed under UV light (312 nm) in the gel documentation system and were then scored for their respective genotypes.
Estimation of genotype and gene frequency
The genotype and gene frequencies were calculated by Gene counting method, as suggested by Falconer and Mackay (1996).
Phenotypic traits of sahiwal cattle
The data of first lactation production records of 328 Sahiwal cows sired by 64 bulls spread over 27 years (1989-2016), collected from Record Cell, Animal Genetics and Breeding Division of ICAR-National Dairy Research Institute, Karnal. Data were analyzed for first lactation milk production and composition traits viz. First lactation 305-day milk yield (FL305DMY-kg), Average test day milk yield (ATDMY-kg), Average test day fat percentage (ATDFP-%), Average test day fat yield (ATDFY-g) and Lactation fat yield (LFY-kg).
Statistical analysis
The effect of non-genetic factors on normalized production traits was studied by the least-squares analysis for non-orthogonal data, using a fixed linear model (Harvey, 1990). The estimation of breeding values of Sahiwal animals for milk production and composition traits was done using WOMBAT software (Meyer, 2007). The effect of genotype on individual trait was explored using, PROC GLM (SAS 4.3) with the help of the following model:
Yij = µ + Gi +eij
Where
Yij- The breeding value of jth trait under effect ith genotype of SNP.
µ- Overall mean.
Gi- The fixed effect of the ith genotype of SNPs.
eij- Random error, assumed to be normally and independently distributed with mean zero and constant variance i.e. NID (0,σ2e).
RESULTS AND DISCUSSION
Restriction patterns with HaeIII endonuclease
Polymerase chain reaction (PCR) gave an amplified product of 297 bp fragment of exon 2, intron 2 and exon 3 of the GHRH gene at the annealing temperature of 57°C for 1 min (Fig 1). The PCR-RFLP for 297 bp fragment of the GHRH gene using HaeIII was designed to screen all the Sahiwal cattle for genotyping. Three genotypes namely, AA, AB and BB were identified in the 297 bp fragment. The genotype AA had 242 and 55 bp fragments; AB genotype had 242, 194, 55 and 48 bp fragments, whereas the genotype BB had 194, 55 and 48 bp fragments (Fig 2). The genotype and gene frequencies were estimated by the Gene Counting method. The gene frequencies for A and B allele were 0.26 and 0.74, whereas; the genotypic frequencies of AA, AB and BB were 0.05, 0.42 and 0.53, respectively (Table 1). Similar frequencies of rare GHRHA allele, 0.2480 and 0.2400 were reported by Dybus and Grzestak (2006) and Klauzinska et al., (2004), respectively. Further, frequencies for the GHRHA and GHRHB allele vary considerably between breeds, GHRHA allele was found to be lowest in cattle breeds such as the Hereford (Moody et al., 1995), Holstein (Kmiec et al., 2007; Szatkowska et al., 2009; Rini et al., 2013), Jersey (Szatkowska et al., 2009), Simmental and Limousin (Rini et al., 2013; Dybus et al., 2003). In contrast to those breeds, GHRHA allele frequency was found to highest in Angus cattle (Moody et al.,1995; Rini et al., 2013), whereas the GHRHB allele was found with a maximum frequency in Brahman breed which originates from Bos indicus (Rini et al., 2013). Among the three genotypes, BB was most abundant while AA genotype was rarest in the screened Sahiwal samples. Similar results were reported by Dybus and Grzestak (2006) in Polish Black-and-White breed with the most prevalent genotype as BB (63.22%) followed by AB (31.33%) while the AA (5.45%) genotype was least in number. Szatkowska et al., (2009) observed similar genotypes in the Polish Holstein and Jersey cattle, the BB genotype was the most frequent (0.583 and 0.541), followed by the AB (0.339 and 0.427), whereas, the AA was the least frequent (0.078 and 0.032), frequencies of GHRHA allele for two cattle breeds were 0.248 and 0.246, respectively, these results were in close agreement with the findings of the present study. Afshar et al., (2014) in Sarabi cattle of Iran reported three (AA, AB and BB) possible genotypes with frequencies 0.0357, 0.3037 and 0.6607, respectively. The allelic frequencies were 0.19 for the GHRHA allele and 0.81 for the GHRHB allele.
Association of genotypes with breeding values for milk yield and milk composition traits
The results of the association study are presented in Table 2. RFLP genotype revealed a significant association (p<0.017) with ATDFP and (p<0.025) FL305DMY. The AA genotype was having a positive effect on ATDFP with a mean of 5.23±0.15 while the BB genotype showed a positive effect on FL305DMY with a mean of 2054.89±27.54. However, in the present study, there was no significant association of these polymorphisms with the breeding values for ATDMY and LFY. Moody et al., (1995) in Holstein Friesian cattle observed that the rare (7.7%) genotype AA, was significantly associated with an increase in fat percentage is in accordance with the present finding. Higher breeding values for ATDFP of the AA genotype than those of AB/BB are in agreement with the findings of Szatkowska et al., (2009). Contrary to the present investigation, Szewczuk et al., (2008) observed that the highest fat yield (kg) and fat content (%) were achieved by the BB cows (330 kg and 4.20%), the AB cows were in the middle (326.8 kg and 4.14%), whereas the AA genotype showed the poorest results (299.6 kg and 3.77%). Dybus and Grzestak (2006) reported polymorphism in Polish Black-and-White breed with all three possible genotypes; the cows with one or two GHRHA alleles might produce the milk of a higher fat percentage, although this was not statistically significant. Studies of Beswick and Kennelly (1998) may confirm the role of GHRH in the regulation of milk fat synthesis. These authors reported that bovine GHRH significantly increases the concentration of acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) enzymes in the mammary gland and significantly decreased the concentration in adipose tissue. Given these results, it is alluring where the region of GHRH/HaeIII mutation is located, especially since the rare AA genotype of GHRH was significantly favourable for milk fat percentage (Moody et al., 1995). Investigations conducted by several researchers did not specify the precise location of the discussed mutation. Comparing the sequence published by Moody et al., (1995) with the complete sequence of the bovine GHRH (GenBank accession number AF242855) suggest that the amplified fragment does not correspond to exon 3, but it covers a part of exon 2, the complete intron 2 and a part of exon 3. Recent studies indicate that polymorphic site is located in intron 2 at position 34 (Dybus and Grzestak, 2006; Zych et al., 2007).
Polymerase chain reaction (PCR) gave an amplified product of 297 bp fragment of exon 2, intron 2 and exon 3 of the GHRH gene at the annealing temperature of 57°C for 1 min (Fig 1). The PCR-RFLP for 297 bp fragment of the GHRH gene using HaeIII was designed to screen all the Sahiwal cattle for genotyping. Three genotypes namely, AA, AB and BB were identified in the 297 bp fragment. The genotype AA had 242 and 55 bp fragments; AB genotype had 242, 194, 55 and 48 bp fragments, whereas the genotype BB had 194, 55 and 48 bp fragments (Fig 2). The genotype and gene frequencies were estimated by the Gene Counting method. The gene frequencies for A and B allele were 0.26 and 0.74, whereas; the genotypic frequencies of AA, AB and BB were 0.05, 0.42 and 0.53, respectively (Table 1). Similar frequencies of rare GHRHA allele, 0.2480 and 0.2400 were reported by Dybus and Grzestak (2006) and Klauzinska et al., (2004), respectively. Further, frequencies for the GHRHA and GHRHB allele vary considerably between breeds, GHRHA allele was found to be lowest in cattle breeds such as the Hereford (Moody et al., 1995), Holstein (Kmiec et al., 2007; Szatkowska et al., 2009; Rini et al., 2013), Jersey (Szatkowska et al., 2009), Simmental and Limousin (Rini et al., 2013; Dybus et al., 2003). In contrast to those breeds, GHRHA allele frequency was found to highest in Angus cattle (Moody et al.,1995; Rini et al., 2013), whereas the GHRHB allele was found with a maximum frequency in Brahman breed which originates from Bos indicus (Rini et al., 2013). Among the three genotypes, BB was most abundant while AA genotype was rarest in the screened Sahiwal samples. Similar results were reported by Dybus and Grzestak (2006) in Polish Black-and-White breed with the most prevalent genotype as BB (63.22%) followed by AB (31.33%) while the AA (5.45%) genotype was least in number. Szatkowska et al., (2009) observed similar genotypes in the Polish Holstein and Jersey cattle, the BB genotype was the most frequent (0.583 and 0.541), followed by the AB (0.339 and 0.427), whereas, the AA was the least frequent (0.078 and 0.032), frequencies of GHRHA allele for two cattle breeds were 0.248 and 0.246, respectively, these results were in close agreement with the findings of the present study. Afshar et al., (2014) in Sarabi cattle of Iran reported three (AA, AB and BB) possible genotypes with frequencies 0.0357, 0.3037 and 0.6607, respectively. The allelic frequencies were 0.19 for the GHRHA allele and 0.81 for the GHRHB allele.
Association of genotypes with breeding values for milk yield and milk composition traits
The results of the association study are presented in Table 2. RFLP genotype revealed a significant association (p<0.017) with ATDFP and (p<0.025) FL305DMY. The AA genotype was having a positive effect on ATDFP with a mean of 5.23±0.15 while the BB genotype showed a positive effect on FL305DMY with a mean of 2054.89±27.54. However, in the present study, there was no significant association of these polymorphisms with the breeding values for ATDMY and LFY. Moody et al., (1995) in Holstein Friesian cattle observed that the rare (7.7%) genotype AA, was significantly associated with an increase in fat percentage is in accordance with the present finding. Higher breeding values for ATDFP of the AA genotype than those of AB/BB are in agreement with the findings of Szatkowska et al., (2009). Contrary to the present investigation, Szewczuk et al., (2008) observed that the highest fat yield (kg) and fat content (%) were achieved by the BB cows (330 kg and 4.20%), the AB cows were in the middle (326.8 kg and 4.14%), whereas the AA genotype showed the poorest results (299.6 kg and 3.77%). Dybus and Grzestak (2006) reported polymorphism in Polish Black-and-White breed with all three possible genotypes; the cows with one or two GHRHA alleles might produce the milk of a higher fat percentage, although this was not statistically significant. Studies of Beswick and Kennelly (1998) may confirm the role of GHRH in the regulation of milk fat synthesis. These authors reported that bovine GHRH significantly increases the concentration of acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) enzymes in the mammary gland and significantly decreased the concentration in adipose tissue. Given these results, it is alluring where the region of GHRH/HaeIII mutation is located, especially since the rare AA genotype of GHRH was significantly favourable for milk fat percentage (Moody et al., 1995). Investigations conducted by several researchers did not specify the precise location of the discussed mutation. Comparing the sequence published by Moody et al., (1995) with the complete sequence of the bovine GHRH (GenBank accession number AF242855) suggest that the amplified fragment does not correspond to exon 3, but it covers a part of exon 2, the complete intron 2 and a part of exon 3. Recent studies indicate that polymorphic site is located in intron 2 at position 34 (Dybus and Grzestak, 2006; Zych et al., 2007).
CONCLUSION
The results of the present investigation suggest that the observed polymorphism has a significant association with milk yield and production traits. The genotypes having one or more GHRHA alleles yield more fat in their milk, while the genotypes having the GHRHB allele showed a positive effect on FL305DMY. The association of genotypes with ATDMY and LFY was non-significant. On the other hand, it is interesting to note that the frequency of the GHRHA allele was very low in the population of Sahiwal cattle under study, which could be a possible genetic marker for higher milk fat content. It has been suggested that polymorphism could be used in selection for higher fat percentage; however, due to the low frequency of the AA genotypes and the polygenic regulation of milk synthesis, it should be verified and validated on a larger population of Sahiwal cattle.
ACKNOWLEDGEMENT
The authors are thankful to Director ICAR-National Dairy Research Institute, Karnal and Head, AGB Division ICAR-NDRI for providing necessary facilities and support for the successful completion of the project.
CONFLICT OF INTEREST
No conflict of interest exists.
REFERENCES
- Afshar, M.A., Khosravi, M., Chamani, M. (2014). Genetic polymorphism and allelic frequency of GHRH gene locus in Iranian Sarabi breed of cattle. Journal of Agricultural and Biological Sciences. 9: 356-359.
- Baile, C.A., Buonomo, F.C. (1987). Growth hormone releasing factor effects on pituitary function, growth and lactation. Journal of Dairy Science. 70: 467-473.
- Barendse, W., Armitage, S.M., Kossarek, L.M. (1994). A linkage map of the bovine genome. Nature Genetics. 6: 227-235.
- Beuzen, N., Stear, M., Chang, K. (2000). Molecular markers and their use in animal breeding. The Veterinary Journal. 160: 42-52.
- Beswick, N.S., Kennelly, J.J. (1998). The influence of bovine growth hormone and growth hormone releasing factor on acetyl-CoA carboxylase and fatty acid synthase in primiparous Holstein cows. Comparative Biochemistry and Physiology PartC: Pharmacology, Toxicology and Endocrinology. 120: 241-249.
- Billestrup, N., Swanson, L.W., Vale, W. (1986). Growth hormone-releasing factor stimulates proliferation of somatotrophs In vitro. Proceedings of National Academy of Science, U.S.A. 83: 6854-6857.
- Dybus, A., Grzestak, W. (2006). GHRH/HaeIIIgene polymorphism and its associations with milk production traits in Polish Black-and-white cattle. Archiv Fur Tierzucht. 49: 434-438.
- Dybus, A., Kmiec, M., Sobek, Z., Pietrzyk, W., Wisniewski, B. (2003). Associations between polymorphisms of growth hormone releasing hormone (GHRH) and pituitary transcription factor 1 (PIT1) genes and production traits in Limousine cattle. Archiv Fur Tierzucht Dummerstorf. 46: 527-534.
- Falconer, D.S., Mackay, T.F.C. (1996). Introduction to Quantitative Genetics. Longman Group Limited.
- Harvey, W.R. (1990). Guide for LSMLMW, PC-1 Version, mixed model least squares and maximum likelihood computer programme. Mimeograph Ohio State Univ., U.S.A.
- Klauzinska, M., Zurkowski, M., Siadkowska, E., Szymanowska, M., Grochowska, R., Zwierzchowki, L., Klewiec, J. (2004). Analysis of genetic structure in Polish Red and Polish Black-and-White cattle using twelve marker loci potentially related to milk or meat production traits. Animal Science Papers and Reports. 22: 153-171.
- Kmiec, M., Kowalewska-Luczak, I., Kulig, H., Terman, A., Wierzbicki, H., Lepczynski, A. (2007). Association between GHRH/HaeIII restriction polymorphism and milk production traits in a herd of dairy cattle. Journal of Animal and Veterinary Advances. 6: 1298-1303.
- Meyer, K. (2007). WOMBAT- A tool for mixed model analyses in quantitative genetics by REML. Journal of Zhejiang University Sciences. 8: 815-821.
- Moody, D.E., Pomp, D., Barendse, W. (1995). Restriction fragment length polymorphism in amplification products of the bovine growth hormone releasing hormone gene. Journal of Animal Science. 73: 3789.
- Rini, A.O., Sumantria, C., Anggraeni, A. (2013). GHRH/HaeIII gene polymorphism in dairy and beef cattle at national livestock breeding centers. Media Peternakan. 36: 185-191.
- Sambrook, J., Russell, W.D. (2001). Molecular cloning. A laboratory manual. 3rd edn. Vol.1 Cold spring harbor laboratory press, cold spring, N.Y. pp. 6.4-6.12.
- Szatkowska, I., Dybus, A., Grzesiak, W., Jedrzejczak, M., Muszynska, M. (2009). Association between the growth hormone releasing hormone (GHRH) gene polymorphism and milk production traits of dairy cattle. Journal of Applied Animal Research. 36: 119-123.
- Szewczuk, M., Zych, S., Chaberski, R. (2008). Effect of growth hormone-releasing hormone gene polymorphism (GHRH/HaeIII) on milk performance in polish holstein-friesian cows. Acta Universitatis Agriculturae Et Silviculturae Mendelianae Brunensis. 4: 177-182.
- Tuggle, C.K., Trenkle, A. (1995). Control of growth hormone synthesis. Domestic Animal Endocrinology. 13: 1-33.
- Zhou,P., Kazmer, G.W. and Yang, X. (2000). Bos Taurus growth hormone releasing hormone gene, complete cds. Gen Bank, AF 242855.
- Zych, S., Szewczuk, M., Czerniawska-Piatkowska, E. (2007). Bos taurus somatoliberin (GHRH) gene, exon 2, intron 2, exon 3 and partial cds. Gen Bank. EF210074.
Disclaimer :
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.
Copyright :
This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
In this Article
APC
APC cover the cost of turning a manuscript into a published manuscript through peer-review process, editorial work as well as the cost of hosting, distributing, indexing and promoting the manuscript.
Publish With US
Submit your manuscript through user friendly platform and acquire the maximum impact for your research by publishing with ARCC Journals.
Become a Reviewer/Member
Join our esteemed reviewers panel and become an editorial board member with international experts in the domain of numerous specializations.
Open Access
Filling the gap between research and communication ARCC provide Open Access of all journals which empower research community in all the ways which is accessible to all.
Products and Services
We provide prime quality of services to assist you select right product of your requirement.
Support and Policies
Finest policies are designed to ensure world class support to our authors, members and readers. Our efficient team provides best possible support for you.
Follow us
Published In
Indian Journal of Animal Research