Chemotherapeutic Effects of Docetaxel and Gene Expression of Epidermal Growth Factor Receptor During Regression of Mammary Tumours in Canines

Mammary neoplasia is one of the most prevalent canine tumours and malignancy happens in about half of them. Carcinomas are characterized by invasion and metastasis. Mammary carcinomas metastasize most often through the lymphatic system and metastatic lesions are usually seen in the regional lymph nodes. Canine mammary tumours are diagnosed clinically by appearance, location of growth, palpation of out-growth, fine needle aspiration cytology, ultrasonography and radiographs to screen possible metastasis and histopathological studies of biopsy samples (Yoshimura et al., 2011). 
       
A number of chemotherapeutic drugs have been used for the treatment of mammary tumours. One of the most effective anticancer agent is the taxanes viz. paclitaxel and docetaxel. Docetaxel is a microtubular-stabilizing taxane lately approved for use in the clinic for the therapy of lung, breast and prostate carcinoma. Chemotherapy in female dogs with invasive mammary tumours and high risk of recurrence or metastasis is indicated for adjuvant therapies (Benavente et al., 2016).
       
There are numerous markers for the assessment of tumourigenesis in canine mammary tumours and one of them is epidermal growth factor receptor (EGFR). Epidermal growth factor receptor has been reported to be over-expressive in many epithelial tumours. Concentration of EGFR was elevated in animals with benign and malignant tumours (IMC and non-IMC) relative to those with ordinary mammary tissues (Queiroga et al., 2017). In this study chemotherapy with docetaxel with or without surgery has been used for the treatment of mammary tumour in dogs.

The present clinical study was conducted in 16 dogs affected with mammary gland tumours presented to TVCC, Pantnagar. Treatment protocol under this study was approved by the Institutional Animal Ethical Committee vide no. IAEC/CVASc/VSR/360 dated 21/12/ 2018.
 
Pre-operative/ treatment protocol
 
The animals were randomly allotted to two groups (I and II) of eight, each clinically diagnosed with mammary cancer and kept in indoor ward for intensive care. The animals of group I were subjected to chemotherapy with docetaxel @ 30 mg/m² weekly intravenously in normal saline for 5consecutive weeks. All the animals were premedicated with chlorpheniramine maleate @ 0.5 mg/kg body weight and pantoprazole @ 1 mg /kg body weight, IV. While the animals of group II were subjected to surgical excision of mammary tumours followed by chemotherapy after 14^th post-operative days with docetaxel as in group I.
 
Observations
 
The therapeutic efficacy of the treatment was assessed by determining the clinical (physical appearance and gross regression), haematological (haemoglobin, total erythrocyte count, total leucocyte count, differential leucocyte count and total platelet count), biochemical (aspartate amino transferase, alanine amino transferase, serum creatinine and serum urea nitrogen), radiological, ultrasonography, histopathological evaluation and gene expression profiling of EGFR using Real-time PCR.
 
Hematological analysis
 
The concentration of haemoglobin (gm/dl), total erythrocyte count (× 10⁶/cu mm), total leucocyte count (× 10³/cu mm), differential leucocyte count (in percentage), total platelet count (× 10⁵ per cu mm) of blood was estimated using fully automatic blood analyser.
 
Biochemical analysis
 
Various serum biochemical parameters viz. aspartate amino transferase (IU/L), alanine amino transferase (IU/L), creatinine (mg/dl) and urea nitrogen (mg/dl) were measured using kits by Erba Diagnostics Mannheim Ltd, Baddi, Distt Solan (H.P), India.
 
Ultrasonography
 
B-mode ultrasonography using a 7.5 MHz linear-array tranducer twas done to assess tumours for: shape (irregular or regular), limit (ill-defined or defined), margins (irregular or regular), echo texture (homogenous or heterogenous), echogenicity (hyperechoic or hypoechoic or isoechoic), distal acoustic shadowing or enhancement, presence of hyperechoic halo and surrounding tissue alterations.
 
Radiological studies
 
To study lesions of distant metastasis thoracic radiographs of all animals were taken with three views: two lateral views (right lateral, left lateral) and one ventrodorsal view. Exposure factors of 50-70 kV and 3.2-5.0 mAs for the lateral view and 45-65 kV and 3.2-5.0 mAs for the ventrodorsal view with focus film distance (FFD) of 90 cm was used.
 
Histopathological examination
 
Collected tumour samples were fixed in 10% neutral buffered formalin. After routine paraffin embedding sections of 4-5 micron (μ) thickness were cut and prepared slides were stained with Harris haematoxylin and eosin (H&E) as per the method described by Luna (1992).
 
Response of the therapeutic modality
 
Therapeutic efficacy of treatment was evaluated clinically according to the criteria advised by WHO viz. (1) complete response (CR), disappearance of the known disease; (2) partial response (PR), 50% or more decrease in the entire tumour burden (3) no change, less than 50% decrease or less than 25% increase in the entire tumour burden and (4) progressive disease, greater than or equal to 25% increase in the entire tumour burden or appearance of new lesions. Further, patients with complete response and partial response were defined as responders and patients with no change and progressive disease were defined as non-responders.
 
Expression of epidermal growth factor receptor (EGFR)
 
RNA isolation, quantification and cDNA synthesis was performed by isolating biopsy samples from the canine mammary tumours on day 0 and day 28. Samples were aseptically collected in chilled PBS having antibiotic and stored at -20°C. The target gene i.e. EGFR was selected after BLAST analysis {Gene Bank Database of the National Center for Biotechnology Information (NCBI)}. A reference gene, i.e., GAPDH, was used as an internal control (Housekeeping gene) and all the data were normalized with this gene. Commercial molecular biology kits used in this study were HiPurA^TM Total RNA Miniprep Purification Kit (HIMEDIA), HiScript One Step RT-PCR kit (Semi-Q PCR Based) and Hi-SYBr Master Mix (with Taq Polymerase). Nucleotide sequences of the primers was EGFR Fw 5'GAATTGAGAGAAGCCACGTC3', Rw5'CATGAGCT GCGTGATGAG3'; GAPDH Fw 5' GGAGAAAGCTGCCA AAT ATG3', Rw5'CAGGAAATGAGCTTGACAAAGTGG3'. Real time quantitative polymerase chain reaction was carried out in triplicate reactions having 10 µL Hi-SYBr Master Mix (with Taq Polymerase), 1 µL cDNA, 1 µL of each gene specific forward and reverse primers (10 µM) and molecular biology grade water for PCR upto 20 µL. Appropriate volumes of master mix were dispensed into the wells of the PCR plate. The cDNA was added to individual PCR tubes containing the master mix. Amplifications were done in a Real-Time PCR System (Applied Biosystems) with the following parameters: denaturation at 94°C for 30 sec, annealing at 57°C for 30 sec and elongation/extension at 68°C for 60 sec; 40 cycles. The threshold cycle or Ct value i.e. the number of cycles to reach threshold of detection, was determined for every reaction and the target mRNAs level were quantified relatively to the level of the housekeeping gene GAPDH using 2^ΔΔCT method.
       
The statistical analysis of the collected data was done using two-way analysis of variance as per the method described by Snedecor and Cochran (1994).

In the present study maximum number of canine mammary tumour cases encountered were in the age group of 8-12 years (7), followed by 6-8 years (4), 4-6 years (2), 2-4 years (2) and one in the age group of 12-14 years which is in accordance with the observations of Gupta and Tiwari, (2008) who also reported that the age of dogs suffering from mammary gland tumours ranged from 2-16 years. All of the sixteen cases were unspayed females. Breed wisedistribution of mammary tumour comprised of five non-descript (31%), four German shepherd (25%), two Labradors (13%), one spitz (6%) and one Siberian husky (6%). Mammary tumours occurred as multiple nodules in five patients (31.25%), solitary growth in ten patients (68.25%) and chain in one case (6.25%).

Rectal temperature, respiratory and heart rates showed non- significant changes in both the groups at various time interval. Mean ± SE values of various haematobiochemical parameters are given in Table 1. Significant (P<0.05) decrease in haemoglobin level was observed in group II on day 14 as compared to group I which can be attributed to the administration of docetaxel. Total leucocyte count increased significantly (P<0.05) in group II as compared to group I on day 21 and 28 which is in accordance with the findings of Khan et al., (2017) in a similar type of study. Total erythrocyte count showed non-significant changes in both the groups. Differential leucocyte count showed significant (P>0.05) decrease in neutrophil count in group II as compared to group I on day 14 as also reported by Puisset et al., (2007). Decrease in neutrophil count was reported in patients undergoing surgical intervention followed by chemotherapy (Khan et al., 2017). Lymphocyte and monocyte count increased significantly (P>0.05) in group II as compared to group I from day 14 to day 28, as also marked by Khan et al., (2017). A non-significant change in eosinophil and platelet count observed in this study confirms the findings of Simon et al., (2006).
 
 

Alanine aminotransferase and aspartate aminotransferase are affected by integrity of cell membrane and are elevated as result of severe damage of liver cells. Alanine aminotransferase is liver specific in canines and is present in large quantities in cytoplasm of hepatocytes (Brar et al., 2000). There was significant (P<0.01) increase in levels of serum alanine aminotransferase in group II as compared to group I on day 14, days 21 and day 28. Its value tends to increase significantly (P<0.05) within group I and II also. These findings are in agreement with the observations of Verma et al., (2014). Levels of aspartate aminotransferase increased in group II as compared to group I significantly (P<0.05) on day 14 and day 28 with mean values of 43.06±8.15 and 45.63±7.91 respectively. Similar observations have been reported by Khan et al., (2017) in cases of mammary tumours in dogs. Elevation in group II may be as a result of muscle damage which might have occurred during surgery. There was a significant (P<0.01) increase in levels of creatinine in patients of group II as compared to patients of group I on days 21 and 28. Verma et al., (2014) also reported elevation in creatinine levels as a result of administration of cytotoxic drug. Serum ureanitrogen showed non-significant and significant increase (P>0.05) in its value in the animals of groups I and II, respectively from day 0 to day 28. Its level was significantly higher in the animals of group II at 14^th and 28^th day as compared to the animals of group I at respective time intervals. Similar findings were observed by Verma et al., (2014) after the administration of cytotoxic drug.

In ultrasonography posterior enhancement was observed in most of the cases of malignant tumours due to the presence of necrotic and cystic areas, which was in accordance with findings of Nyman et al., (2006). Shadowing was usually associated with malignancy however no such differences were observed among benign and malignant tumours in the present study which confirms the findings of Soler et al., (2016). Lateral and ventrodorsal radiographs of thorax revealed metastasis in 11 cases which manifested the presence of well circumscribbed, round cotton ball or puffcorn like apperance and consolidation and opacification of lungs (Fig 1) and presence of subtle mutiple nodules. The observation made in the present study confirms the finding of Brodey et al., (1983) who have reported that malignant tumours had metastatic lesions in lungs and lymph nodes.
 

       
Histopathological studies showed anaplastic changes in cells with pleomorphism i.e. variation in cellular and nuclear morphology, presences of mitotic figures, increased nuclear cytoplasmic ratio, angiogenesis, proliferation of fibrous connective tissue with prominent infiltration of various cells like lymphocytes, plasma cells and few macrophages. The biopsy samples of tissues were suggestive of benign and malignant conditions like adenoma, melanoma, fibroma along with fibroadenoma, ductal hyperplasia along with lobular hyperplasia (Fig 2a), squamous cell carcinoma (Fig 2b), infiltrating lobular carcinoma (Fig 2c) and mixed tumours. Similar observations have been reported by Verma et al., (2014). Histopathological findings revealed 31.25% (5 cases) and 68.75% (11 cases) cases of benign and malignant tumours, respectively.
 
 
       
Patients of group I subjected to administration of docetaxel alone revealed complete response (CR) in two out of eight cases (25%), which regressed completely after fifth dose and partial response (PR) in three out of eight cases (37.5%) with 60% reduction in tumour size. Non- significant change in entire tumour burden was observed in one case (12.5%) out of eight after completion of fifth dose of docetaxel. Progressive disease was observed in two out of eight cases (25%) depicting 30% increase in entire tumour volume. Thus, clinical response rate was 62.5% and 37.5% in case of responders and non-responders, respectively.  In patients of group II, complete response with no reoccurrence was observed in five out of eight cases (62.5%) and three cases showed reoccurrence over a period of six months.
       
The EGFR belongs to the ErbB family of receptor tyrosine kinases (Motalleb et al., 2014). The receptor is involved in signal transduction under normal physiological conditions and deregulated signalling in cancer growth and metastasis (Valabrega et al., 2007). However, overactivation of EGFR via the overexpression promotes cellular growth and epithelial-mesenchymal transition (EMT) which may act as crucial factor for tumourigenesis and metastasis. Gene expression profiling and immunohistochemical studies have indicated that 50-70% of basal breast tumours exhibit EGFR expression. The ratio of optical density at 260 and 280 nm for assessing purity of RNA sample was found to be in the range 1.90-1.98 for all the samples. The cDNA transcript integrity was confirmed by running analytical denaturing agarose gel (1.5%). The bands of cDNA were obtained mid-way between 100 to 200 bp which confirmed the presence of EGFR in the samples. The isolated cDNA transcript was then proceeded for the real time PCR reaction. The Ct values were evaluated from the linear amplification plot obtained after completion of PCR reaction (Fig 3). All the Ct values of different samples of different group were noted down with the help of the plot. Comparative CtDDCT method was used for the analysis of PCR data. The Ct values obtained for the target genes are given in the Table 2. Values obtained on the 0 day were taken as control in both the groups i.e. values obtained on day 0 group I and II was compared with values obtained on day 28 of group I and II and the fold change in the expression was assessed. After calculating the value of 2^ΔΔCT 0.933822 and 0.879343 change in expression was noticed in group I and II, respectively which revealed down-regulation of EGFR gene in group II.
 

 

 
On the basis of above mentioned findings, it was revealed that docetaxel regressed the canine mammary tumour masses to some extent; however, docetaxel as a single agent was moderately effective when it was used in appropriate doses. Moreover, combination of surgical resection and chemotherapy with docetaxel had better therapeutic efficacy, response rate, survival rates and more down-regulation of EGFR gene involved in tumour invasion and metastasis.