Identification of 24bp indel(s) Polymorphism in the Promoter Region of prolactin Gene and its Association with Broodiness in Tellicherry Native Chicken

Natural brooding in poultry is characterized by sitting on their own eggs to incubate them to hatch out the chicks Basheer et al., (2015). Broodiness is a fundamental role in physiology and reproduction of domestic hens. This maternal behaviour is due to the interaction between the endocrinological system and the environment of bird (Sharp, 2009). Prolactin is a polypeptide hormone secreted from anterior lobe of pituitary which plays a crucial on broodiness and egg production (Cui et al., 2006). Prolactin gene is located on the chromosome number 2 of chicken, it regulates the broody behaviour in most of domestic hens Alipanah et al., (2011). The gene is composed of five exons and four introns. The five exons are 28bp, 182bp, 108bp, 180bp and 192bp long respectively, while, the four introns are 1520bp, 408bp, 1348bp and 1909bp long respectively Au et al., (2002). The plasma concentration of prolactin hormone reaches its peak during onset of incubation behaviour. Since, Luteinizing hormone (LH) has negative feedback mechanism on prolactin, the broody behaviour is associated with increased prolactin, decreased level of LH which may lead to regression of ovary and oviduct and subsequent cessation of egg production (Ramanov, 2001). During onset of broodiness, birds are observed with persistent nesting, turning and rolling of eggs, clutching and nest defense. These behaviours are more pronounced in birds reared under deep litter system than cage system Basheer et al., (2015). White Leghorn (WLH) chicken breed was found to be a non-broody bird which is because of a 24bp insertion polymorphism in the promoter region of prolactin gene. (Jiang et al., 2005). Practically in WLH breed, broodiness has been decreased by intensive artificial selection against increased egg production, almost to the vanishing point (Ramanov, 2001). Therefore, it produces more than 300 eggs per year. Begli et al., (2010) reported that polymorphism of prolactin gene, a 24bp indel (insertion or deletion) at the promoter region was showing association with egg production in native fowl of Yazd province. The main objective of the present study was to investigate the association of 24bp indel(s) polymorphism of prolactin gene with broodiness in Tellicherry native chicken.

Experimental birds
 
A total of 200 birds of Tellichery native chicken were randomly selected from All India Research Co-ordinated Project (AICRP) Farm on Poultry Improvement, Mannuthy, Thrissur, Kerala.
 
Collection of blood samples
 
From each bird, 0.5-1 ml of blood was collected from the wing vein using 2.5 ml disposable syringe in a EDTA vial under aseptic condition. The samples were brought to the laboratory at 4°C in ice pack.
 
Isolation of genomic DNA
 
Isolation of Genomic DNA was done from the whole blood according to the standard procedure using ODP304 Origin Genomic DNA isolation kit. The yield and quality of the DNA obtained was checked by 0.8% agarose gel electrophoresis as well as by Nano-drop spectrophotometer. The DNA samples showing the OD260/OD280 value between 1.7 and 1.9 was used for further investigation.
 
PCR assay
 
 Polymerase chain reaction was done using specific set of forward (F-5' TTTAATATTGGTGGGTGAAGAGACA3') and reverse primer (R-5' ATGCCACTGATCCTCGAAAACTC3') to amplify the 130/154bp fragment of prolactin gene containing 24bp (insertion-deletion) indel(s) polymorphism at the promoter region. Each diluted primer (10 pM/µl) was added to the template DNA [working solutions prepared from stock solution by diluting with sterile distilled water (Millipore) to get a final concentration of 100 ng/µl] and 2X PCR Smart Mix (origin) in a PCR tube and made up to the final volume of 20 µl using ultra filtered Millipore water. PCR was done in Bio-Rad thermal cycler and standardization was done for each reaction by mild adjustment of concentration of ingredients and annealing temperature with the following profile: initial denaturation of 5 min at 94°C; 35 cycles of 94°C for 30 s, annealing at 58°C for 30 s and 72°C for 30 s with a final elongation of 5 min at 72°C. PCR amplicon was subjected to 2% agarose gel.
 
Agarose gel electrophoresis
 
The genomic DNA and PCR products were checked in agarose gels of 0.8 percent and 2%, respectively prepared using 1X TBE buffer. Agarose was weighed and mixed with required volume of 1XTBE buffer and boiled in a microwave oven till the solution became clear. After cooling to 60°C (bearable warmth), ethidium bromide (0.5 µg/ml) was added and mixed well. It was then poured into casting tray which was already set with comb in place.  After solidification, the comb and sealing were removed and the tray was immersed in a buffer tank containing 1X TBE buffer. DNA and PCR products were mixed with loading dye (6X) and loaded in wells. The PCR products were loaded along with a molecular weight marker (50bp) for relative sizing. Electrophoresis was carried out at 5V/cm until the bromophenol blue dye migrated more than two by third length of the gel and was photographed in a Gel Doc System (Bio-Rad, USA). The amplicons of promoter region of prolactin gene 130/154bp were sequenced using respective forward and reverse primers in an automated sequencer using Sanger’s dideoxy chain termination method at Agri Genome Labs Pvt. Ltd., Cochin. On the basis of polymorphic patterns, birds were categorized to three different genotypes and allelic and genotypic frequency was calculated accordingly.  Broodiness of the birds were observed for two months period and the number of days was calculated. Also, the egg production of each bird was recorded for further analysis.
 
Statistical analysis
 
The interrelation between a 24bp indel(s) polymorphism in the promoter region of prolactin gene and broodiness was analysed by one way ANOVA by using the software SPSS (Version 21.0).

The isolated samples of Genomic DNA was represented in the Fig 1. The average concentration of isolated DNA samples were observed to be 234.33 ng/µl and the optical density (OD) ratio was between 1.7 and 1.9 at 260/280 nm which indicates the DNA was good in concentration and quality. Polymorphism at the promoter region of prolactin gene was observed with three different size of fragments namely 154, 130/154 and 130bp representing the II, ID and DD genotypes, respectively (Fig 2). These results were accordance with studies carried out by Cui et al., (2006), Liang et al., (2006), Bagheri et al., (2013) and Rashidi et al., (2012). According to the polymorphic patterns, a total number of 200 birds were grouped to three and designated with different genotypes II, ID and DD, respectively. Out of 200 birds of Tellicherry native chicken 130 birds were observed with II genotype, 19 birds were observed with ID genotype and 51 birds were produced DD genotype.
 

 

 
Genotype and allele frequency           
 
The genotypic frequency of II, ID and DD of 24bp indel polymorphism were 0.650, 0.095 and 0.255, respectively in Tellicherry native chicken. These results were contrary to findings of Jiang et al., (2005) and Liang et al., (2006) in Blue-shell native chicken (0.060, 0.340 and 0.600) and Yuehuang native chicken (0.090, 0.470 and 0.440), correspondingly of China. Similar genotype frequency value (0.25) of DD was reported by Brijendra et al., (2018) in Aseel bird. On the one hand, this variation in genotypic frequency of II, ID and DD in native chicken of Kerala compared to other native chickens may be due to the unknown inclusion of exotic germplasm in the backyard of Kerala. On the other hand, difference in breeds of chicken may also one of the reason for this genotypic variance. The allelic frequency of I and D of -358 site (24bp indel) was 0.6975 and 0.3025, respectively. Similar finding was stated by Bagheri et al., (2013) as 0.65 and 0.35, respectively in Fars native chicken of Iran. In comparison, similar results were reported by Rashidi et al., (2012), Lotfi et al., (2013), Bagheri et al., (2013), (Lumatauw and Mu’in, 2016), Yadav et al., (2018) and Ahmadi et al., (2019) in Mazandaran province indigenous chicken, Japanese Quail, Iran native chicken, Papua local chicken, Kadaknath hens and Naked neck chicken, respectively. On the basis of above obtained results, the frequency of I allele is comparatively higher in all chicken breeds.
 
Association of 24bp insertion-deletion (indel) polymorphism with broodiness in Tellicherry native chicken
 
In Tellicherry native chicken, the mean broody days were, 6.42±8.08, 5.04±9.09 and 6.29±9.77 for the genotypes II, ID and DD, respectively. There was no significant difference among the genotypes of promoter region of prolactin gene (24bp indel site). Similarly, Jiang et al., (2005) conducted a study on association of polymorphisms for prolactin and prolactin receptor genes with broody traits in Blue shell chicken of China and found no significant change among the genotypes of 24bp indel polymorphism. Liang et al., (2006) also performed a research study on polymorphisms of 52 flanking region of prolactin gene in Yuehuang native chicken of China and reported that genotypes (II, ID and DD) of 24bp indel site did not show significant difference with broody trait. Backyard farming system is usually practiced by Indian farmers to rear native chicken having low egg and meat production potential. In general, most of the indigenous (Native) chicken produces 60 to 70 eggs per year as an average. Low productivity of backyard farming is mainly attributed to the poor production potential of existing indigenous germ plasm Haunshi et al., (2009). Hence, to increase the productivity, some of the indigenous breeds are reared under cage system in an organized farm. For example, Tellicherry native chickens are maintained at All India Co-ordinated Research Project (AICRP) farm on Poultry improvement at Mannuthy, Thrissur, Kerala. This breed is mainly reared for egg and it produces 168 eggs up to 72 weeks of age which is comparatively higher than backyard native chickens. Broodiness and egg production are negatively correlated quantitative traits in poultry. It has been found that broodiness is less pronounced in native chickens reared under caged floor system which may improve the egg production (intensity of laying) to some extent. In our study also, Tellicherry chickens are observed with decreased number of broody days and increased in egg number.
        
Genotypically a 24bp insertion at the promoter region of prolactin gene is the mainly responsible for non-broody behaviour in White Leghorn chicken breed. Since, the insertion of a 24bp nucleotide sequence in the promoter region of prolactin gene, a possible ecotropic viral integration site-1 encoded factor (Evi-1) binding site is located in the 52  flanking region of the chicken prolactin gene Cui et al., (2005). Evi-1 was shown to be involved as a repressor in transcription of many genes (Vinatzer et al., 2001 and Izutsu et al., 2002). It has been reported that Evi-1 represses the expression of prolactin gene in White Leghorn chickens by binding the Evi-1 binding site and further prevents broodiness that can improve egg production to some extent Jiang et al., (2005). Hence, the White Leghorn chicken is producing more than 300 eggs per year. In this study, frequency I (insertion) allele was found to be higher in Tellicherry chicken population. These findings are in accordance with Bagheri et al., (2013). Furthermore, they observed that chickens with II and ID genotypes had significantly (P>0.01) greater egg production (egg number) and laying rate than DD genotype. On the basis of above research findings, it was known that presence of I (insertion) allele in chicken has positive effect on egg production. In comparison, presence of D (deletion) allele tends to give negative effect on egg production in chicken. Thus, Tellicherry chicken showed comparatively higher egg production than other backyard native chickens. These results suggest that the broody trait on Tellicherry chicken population could be eliminated through increasing the frequency of I allele in the population upon controlled mating.

Our experiment results revealed the presence of 24bp (insertion-deletion) indel polymorphism in the promoter region of prolactin gene in Tellicherry native chicken population and the frequency of I allele was found to be high. It indicates that the broody trait on Tellicherry chicken population could be eliminated by increasing the frequency of I allele through controlled mating. Also, the present study showed the presence of an association between a 24bp insertion polymorphism with egg production. Hence, this 24bp indel polymorphism of prolactin gene could be used as a potential molecular marker for selection and breeding in native chicken. Future studies could investigate this association with production traits in other indigenous chicken breeds.

The present research was funded by Kerala State Plan Project. I would like to express my deep gratitude to the professors, staffs of Department of Poultry Science and Department of Animal Breeding and Genetics. Also to the Dean, College of Veterinary and Animal Sciences, Mannuthy, Thrissur, Kerala for providing the necessary infrastructure required for investigation of the current research.