Indian Journal of Animal Research

  • Chief EditorK.M.L. Pathak

  • Print ISSN 0367-6722

  • Online ISSN 0976-0555

  • NAAS Rating 6.50

  • SJR 0.263

  • Impact Factor 0.4 (2024)

Frequency :
Monthly (January, February, March, April, May, June, July, August, September, October, November and December)
Indexing Services :
Science Citation Index Expanded, BIOSIS Preview, ISI Citation Index, Biological Abstracts, Scopus, AGRICOLA, Google Scholar, CrossRef, CAB Abstracting Journals, Chemical Abstracts, Indian Science Abstracts, EBSCO Indexing Services, Index Copernicus
Submit

Research Article

Indian Journal of Animal Research, volume 55 issue 3 (march 2021) : 261-265

Genetic Variability in Exon 3 Region of POU1F1 Gene and its Effect on Body Weight and Milk Yield in Malabari Goats

Changchup Dorjay1, Bindya Liz Abraham1,*
1Department of Animal Genetics and Breeding, College of Veterinary and Animal Sciences, Mannuthy, Thrissur-680 651, Kerala, India.
Cite article:- Dorjay Changchup, Abraham Liz Bindya (2020). Genetic Variability in Exon 3 Region of POU1F1 Gene and its Effect on Body Weight and Milk Yield in Malabari Goats . Indian Journal of Animal Research. 55(3): 261-265. doi: 10.18805/ijar.B-3949.

ABSTRACT

Background: POU1F1 is known as a major candidate gene coding for pituitary-specific transcription factor-1 regulating the production of anterior pituitary hormones like GH, TSH, LH, FSH and prolactin in small ruminants. However, little is known about the genetic variability of caprine POU1F1 gene in Indian breeds. Hence, the present study aimed at the identification of single nucleotide polymorphisms in the exon 3 region of POU1F1 and their association with body weight and milk production in Malabari goats. 
Methods: The present study was conducted during 2016-2018 on 100 Malabari goats at the University Goat and Sheep Farm, Mannuthy. Genomic DNA was extracted using standard phenol-chloroform method. The POU1F1 exon 3 locus was PCR amplified using appropriate primers. The 234 bp PCR product was subjected to single-strand conformation polymorphism (SSCP) analysis on 12% PAGE gel and silver-stained. The different SSCP patterns were sequenced and homologous sequences identified using Blast algorithms. Allelic-genotypic frequencies and the observed-expected heterozygosity at the locus were estimated. Data on body weights at birth, three, six, nine months of age and parity-wise lactation milk yield were used to find the association of POU1F1 exon 3 variants with body weights and milk yield using one-way ANOVA in General Linear Models for fixed effects. 
 
Result: PCR-SSCP revealed GG, GA genotypes with frequencies of 0.44 and 0.56 and G and A alleles with frequencies of 0.72 and 0.28. The observed and expected heterozygosity for the locus were 0.5657 and 0.4077 respectively. Sequencing of the PCR products revealed a synonymous single nucleotide polymorphism (g. 42C>T). GG homozygotes had higher body weight while GA heterozygotes had higher milk yield (p<0.05). It was concluded that the polymorphic exon 3 locus significantly contributed to variation in pre-pubertal body weight and milk yield and hence may be employed in the marker-assisted selection programmes for Malabari goats. 

INTRODUCTION

POU1F1 gene is known as a major candidate gene employed in the marker-assisted selection programmes in goats (Alakilli et al., 2012). The gene is located on chromosome 1q21-22 with16078 base pairs consisting of six exons and five introns. It is mainly expressed in the anterior pituitary and codes for a transcription factor called pituitary-specific transcription factor-1 (POU1F1). The main function of POU1F1 transcription factor is the regulation and expression of genes coding for anterior pituitary hormones like GH, TSH, LH, FSH, prolactin and POU1F1 itself (Daga et al., 2013). Accordingly, mutations on POU1F1 gene result in the deficiency of these hormones (Cohen et al., 1997). Similar to the genetic polymorphisms in many important caprine candidate genes (Sankhyan et al., 2019; Dige et al., 2020), the single nucleotide polymorphisms in the exons and flanking regions of POU1F1 are also found to be associated with birth weight, body weights, biometrical traits, milk and wool traits in sheep and goats and hence serve as molecular markers (Lan et al., 2007a; Bai et al., 2016; Zhou et al., 2016). Despite all these bioactivities and functions, POU1F1 is one such gene least studied in the Indian goat populations except in Barbari goats (Sharma et al., 2013). Hence, the present study is focussing on the genetic variants of POU1F1 gene in dual purpose highly prolific Malabari goats of Kerala through the identification of single nucleotide polymorphisms (SNP) in the 234bp exon 3 locus and their possible association with body weight and milk yield in these goats.

MATERIALS AND METHODS

The present study was conducted on Malabari goats (n=100) maintained at the University Goat and Sheep Farm, College of Veterinary and Animal Sciences, Mannuthy, Thrissur, Kerala during the period, 2016-2018. Jugular blood samples, five ml each were collected in EDTA vacutainers, rapidly transported to the laboratory at low temperature and stored at-20°C. 
 
DNA was extracted from whole blood using the standard phenol-chloroform method (Sambrook and Russell, 2001) and frozen at -20°C until use. Purity of DNA was detected by 2% agarose gel electrophoresis. Genomic DNA was used for the amplification of 234 bp fragment (exon 3) of POU1F1 gene using primers designed by the Primer 3 software (V.0.4.0) (http://bioinfo.ut.ee/primer30.4/).
The PCR primers for POU1F1 exon 3(234 bp) were synthesized as follows (Sigma-Aldrich, USA):
 
    POU1F1-F: 5’GGGAGCTTAACCCCTTGTCAGT 3’ (22)
    POU1F1-R: 5’CACCTACCTAGCTTAATTCTTCTCT 3’ (25)
 
 
The PCR was conducted in a 20µL reaction mixture containing 50-100 ng of DNA, 2mM of MgCl2, 0.4µl of dNTPs, 1µl of 10 pmol of each primer and 0.2 µl of Taq DNA polymerase. The PCR protocol involved an initial denaturation at 95°C for 3 minutes followed by denaturation at 95°C for 30s, annealing at 62°C for 30s, extension at 72°C for 30 s for 35 cycles and final extension at 72°C for 5 min (Bio-Rad Thermal cycler, USA). Electrophoresis of PCR products were performed in 2% agarose gel in parallel with 100 bp DNA marker (Fermentas) in 1x TBE buffer at a constant voltage of 80 V for 45 min. After ethidium bromide coloration, products were visualized by ultraviolet transillumination (Bio-Rad, USA).
 
The PCR product was subjected to single-strand conformation polymorphism (SSCP) analysis. Aliquots of  10 µL of PCR products were mixed with a 20 µL of denaturing solution (containing 9.5 ml of deionised formamide, 0.4 ml of 0.5MEDTA, 2.5 mg of xylene-cyanol and 2.5 mg bromophenol blue) centrifuged, denatured by heating at 95°C for 10 min and immediately chilled on ice. SSCP analysis was done using vertical electrophoresis (Hoefer, USA). Denatured amplicons were loaded on 12% PAGE gel in 1x TBE buffer at a constant voltage of 130 V for 18 h. The gel was stained by a silver staining method (Sanguinetti and Simpson, 1994). 
 
The PCR products from different SSCP patterns were sequenced using a commercial service (SciGenom Labs Pvt. Ltd. Cochin) in forward and reverse directions. Nucleotide sequence alignments and comparisons were carried out using reference sequence NC_030808.1 (Sequence ID: NM_001 285673.1) in GenBank using BLASTn (http://www.ncbi.nlm. nih.gov/blast) and EMBOSSmerger (http://emboss. bioinformatics.nl /cgi-bin/emboss/merger). The NCBI (National Centre for Biotechnology Information) Blast algorithm was used to search the NCBI GenBank database (http:/www.ncbi.nlm.nih.gov/) for homologous sequences.
 
The allelic and genotypic frequencies were calculated by the standard procedure (Falconer and Mackay, 1996). The observed (H0) and expected (He) heterozygosity at the locus and chi-square test for Hardy-Weinberg equilibrium were estimated using PopGene 3.1 software.
       
The phenotypic data on early body weights at birth (BW0), three (BW3), six (BW6), nine (BW9) months of age and lactation milk yield in different parities were collected from the farm records. Male kids were not available for study beyond three months of age. The effect of non-genetic factors on the traits was studied by least squares analysis for non-orthogonal data using the fixed model (Harvey, 1990).
 
ANOVA was used to analyze the association of POU1F1exon 3 variants with body weights and lactation milk yield at various stages and their effects were examined using the following General Linear Models for fixed effects using SPSS (V.21). Comparison of means was done using Duncan Multiple Range Test (Kramer, 1957). The model used for body weights was: Yijkl = µ + Si + Tj + Gk + eijkl where Yijkl is the observed body weight; µ is the overall mean; Si is the fixed effect due to sex of the kid (i = male, female); Tj is the fixed effect due to type of birth (j = single, twins, triplets); Gk is the fixed effect due to POU1F1exon 3 genotype ( k = GG, GA); and eijkl is the random error. The model used for lactation milk yield was: Yijk = µ + Pi + Gj + eijk where Yijk is the observed milk yield; µ is the overall mean; Pi is the fixed effect due to parity of the doe (i = 1, 2, 3); Gj is the fixed effect due to POU1F1 exon 3 genotypes (j = GG, GA) and eijk is the random error. Least squares means and their standard errors were computed for all the genotype effects.

RESULTS AND DISCUSSION

The PCR-SSCP analysis of the 234 base pair fragment of exon 3 of POU1F1 revealed two distinct banding patterns in Malabari indicating the population to be polymorphic for the locus (Fig 1 and Fig 2). The finding is in agreement with many of the earlier reports in different goat breeds (Lan et al., 2007b; Lan et al., 2009; Alakkilli et al., 2012) and contrary to its monomorphic status in Ettawah goats (Dagong et al., 2016).
 

Fig 1: PCR amplification of 234 bp fragment of POU1F1 exon 3.


 

Fig 2: SSCP pattern of 234 bp fragment of POU1F1 exon 3 with GG and GA genotypes.


 
Two genotypes, GG and GA were identified in the breed, with alleles G and A in different proportions. The observed polymorphic types of POU1F1exon 3 were in agreement with the reports in Sarda goats (Daga et al., 2013).Genotype AA was not found in the population and this could possibly be due to genetic drift operating in small populations (Dagong et al., 2016). The rarity of AA genotype for POU1F1 locus has also been reported in Indian Barbari goats (Sharma et al., 2013).
 
Estimation of population indices for POU1F1 234 bp (exon 3) polymorphic locus
 
The genotypic and allelic frequencies for the locus with their various population indices are presented in Table 1. The frequencies of GG and GA genotypes were 0.44 and 0.56. The frequencies of G and A alleles were 0.72 and 0.28 respectively. In overall, G alleles and GA genotypes were predominant in Malabari goat population for the POU1F1exon 3 locus. The observed and expected heterozygosity estimated for the locus were 0.5657 and 0.4077 respectively. The observed heterozygosity was higher than the expected heterozygosity indicating a low level of inbreeding in the population.
 

Table 1: Genotype and allele frequencies and population indices of the SNPs of 234 bp fragment of caprine POU1F1 gene based on SSCP pattern in Malabari goats.


 
Chi-square analysis revealed that Malabari population departed from Hardy-Weinberg equilibrium for the exon 3 locus of POU1F1 gene (p<0.01). The presence of non-random matings like inbreeding, population stratification, migration and genetic drift operating in small isolated populations are known to be the reasons for the deviation from Hardy-Weinberg equilibrium. Selective forces operating at different loci, small sample size, the presence of null alleles and prediction of fewer heterozygotes than actually observed also prompt a population to deviate from Hardy Weinberg equilibrium with regard to its polymorphic loci (Phyu et al., 2017). Since the observed heterozygosity was more than expected heterozyosity in the population under study, it can be inferred that the selection pressure on the locus could have been the probable cause of the deviation from HW equilibrium when compared to the possibility of a non-random mating like inbreeding.
 
Single Nucleotide Polymorphism in POU1F1 234 bp (exon 3) locus
 
Sequencing of the PCR product from each genotype (Fig 3) revealed a single nucleotide polymorphism (G®A on the reverse strand) at 42 position of the 234 bp fragment (256th position of ORF). It was identified to be a C®T transition, similar to an earlier report in Sarda goats of Italy (Daga et al., 2013).The SNP identified (g. 42C/T) was found to be synonymous (sSNP) with a codon change of CTG to TTG coding for leucine without any amino acid change. The SNP was not found to cause any change in the sequence of amino acids and hence it was inferred that the specific POU1F1 domain for exon 3 locus was not modified by this nucleotide transition (Daga et al., 2013).
 

Fig 3: Sequence map of GG genotype and GA genotype (on complimentary strand)


 
Effect of non-genetic factors on body weights and lactation milk yield
 
The effect of several non-genetic factors like sex of the kid and type of birth on body weights were analysed (Table 2). The effects of sex and type of birth were significant on early body weights upto three months of age (p ≤0.05). Males were heavier than females from birth to three months of age indicating the presence of sexual dimorphism for the early body weights. Multiple-born (twins and triplets) kids exhibited significantly higher body weight than single born ones at birth and three months (p ≤0.05). The finding points out that the early growth of multiple-born kids were not hampered by selection for higher prolificacy and hence optimum management conditions were provided for the pregnant does of the farm. Type of birth did not significantly influence the body weight at later stages of six and nine months of age. Parity of the doe had significant influence on the lactation milk yield (p ≤0.05).The lactation milk yield was the lowest (31.79 ±0.34) in first kidding and it gradually increased in second parity (59.24±0.50) with the maximum yield in the third parity (72.75±0.34).
 

Table 2: Effect of sex and type of birth on body weight at different stages in Malabari goats.


 
Association of POU1F1 234 bp (exon 3) genotypes with body weights upto nine months of age
 
The two genotypic variants of POU1F1 234 bp locus (exon 3) viz., GG and GA differed significantly (p ≤0.05) for body weights at birth, three, six, nine months of age in Malabari goats (Table 3). GG homozygotes were heavier than GA heterozygotes at all stages of growth. The result is in accordance with the reports in Sarda and Chinese goats (Lan et al., 2007a; Lan et al., 2007b). The native goats of Kerala attain sexual maturity between seven and nine months of age and the does are generally put to breeding at the age of 9-10 months. During the period from six to nine months of age regarded as the stage of onset of puberty, the POU1F1gene expression is likely to be at the peak and the production of anterior pituitary hormones like GH, FSH, LH and TSH would reach an optimum level under the transcriptional regulation of POU1F1to attain puberty and  breedable status. The significant association of POU1F1 polymorphisms at exon 3 with the body weights at these stages of onset of puberty hence supports the view that POU1F1exon 3 locus exerts a marked influence on growth traits like body weight for attaining sexual maturity.
 

Table 3: Least square means with standard error of body weight at different stages and parity wise lactation milk yield for POU1F1 234 bp (exon 3) genotypes.


 
Association of POU1F1 234 bp (exon 3) genotypes with lactation milk yield
 
The two variants of POU1F1 234 bp locus (exon 3) viz., GG and GA genotypes differed significantly (p ≤0.05) for lactation milk yield in Malabari (Table 3). The POU1F1 GA variants had higher milk yield than the GG variants and the superiority of GA heterozygotes was more evident from second kidding onwards. The improved milk yield following second kidding could well be attributed to the stabilization of POU1F1 gene expression for prolactin secretion in lactating does. Similar association of POU1F1exon 3 variants with milk yield has been reported in Sarda goats (Lan et al., 2007b) and Guanzhong goats (Zhou et al., 2016).

CONCLUSION

The caprine POU1F1exon 3 locus in Malabari goats was found to be polymorphic with two genotypes, GG and GA. A synonymous exonic SNP (g.42C/T) was identified (G/A in complementary strand) with codon changes. The nucleotide transition was observed to have brought about no change in the specific domain of the protein molecule of Pituitary specific transcription factor-1. The caprine POU1F1exon 3 polymorphic locus significantly (p<0.05) contributed to variation in body weight at all stages from birth up to the onset of puberty at nine months of age. GG homozygotes were heavier than GA heterozygotes. The polymorphic locus also contributed to variation in lactation milk yield (p<0.05).GA genotypes were superior in yield than GG homozygotes and this was more evident from second kidding onwards. It appeared that the secretion of hormones like prolactin and other anterior pituitary hormones in lactating does was stabilized through POU1F1-mediated transcriptional regulation of the genes during the second parity, resulting in a quantum leap in milk yield in second kidding when compared to the first. In other words, the associations of POU1F1 polymorphisms in exon 3 locus with body weight and milk yield indicated the role of caprine POU1F1 gene in the activation of genes coding for hormones of growth and lactation. Hence, the study points out the role of POU1F1 as a good candidate gene for the early selection of goats and suggests the possibility of using POU1F1 polymorphisms in the marker-assisted selection for the genetic improvement of growth and production traits in native goats of Kerala.

REFERENCES


  1. Alakilli, S.Y., Mahrous, K.F., Salem, L.M. and Ahmed, E.S. (2012). Genetic Polymorphism of five genes associated with growth traits in goat. African Journal of Biotechnology. 11: 14738-14748.

  2. Bai, J.Y., Wang, X., Yang, Y.B., Zhang, X.H., Pang, Y.Z. and Li, H.W. (2016). Study on the polymorphism of POU1F1 gene in sheep. Revista Brasileira de Zootecnia. Brazilian Journal of Animal Science. 45: 604-607.

  3. Cohen, L.E., Wondisford, F.E., Radovick, S. (1997). Role of PIT-1 in the gene expression of growth hormone, prolactin and thyrotropin. Endocrinology and Metabolism Clinics of North America. 25: 523-540.

  4. Daga, C., Paludo, M., Luridiana, S., Mura, M.C., Bodano, S., Pazzola, M., Dettori, M.L., Vacca, G.M. and Carcangiu, V. (2013). Identification of novel SNPs in the Sarda breed goat POU1F1 gene and their association with milk productive performance. Molecular Biology Reports. 40(4): 2829-2835.

  5. Dige, M.S., Kaushik, R., Kushwah, B., Singh, M.K., Bhusan, S. and Rout, P.K. (2020). Study on genetic polymorphism of IGF-1 gene in Barbari and Jamunapari goat. Indian Journal of Animal Research. DOI: 10.18805/ijar.B-3893.

  6. Dagong, M.I.A., Rahim, L., Bugiwati, S.R.A. and Prahesti, K.I. (2016). Genetic polymorphisms of pituitary-specific transcription factor-1 (PIT-1) gene from Indonesian local goat population reared in South Sulawesi Province. Advances in Environmental Biology. 10:121-125.

  7. Falconer, D.S. and Mackay, T.F.C. (1996). Introduction to Quantitative genetics. (4th Ed.). Longmans Green, Essex, 464p.

  8. Harvey, W.R. (1990). User’s guide for LSMLMW and MIXMDL, PC-2 mixed model least squares and maximum likelihood computer programme, USA ARS.

  9. Kramer, C.Y. (1957). Extension of multiple range tests to group corrected adjusted means. Biometrics. 13: 13-18.

  10. Lan, X., Pan, C., Chen, H., Lei, C., Hua, L. and Yang, X. (2007a). DdeI polymorphism in coding region of goat POU1F1 gene and its association with production traits. Asian-    Australasian Journal of Animal Science. 20: 1342-1348.

  11. Lan, X., Pan, C., Chen, H., Lei, C., Hua, L. and Yang, X. (2007b). An Alu PCR-RFLP detecting a silent allele at the goat POU1F1 locus and its association with production traits. Small Ruminant Research. 73: 8-12.

  12. Lan, X.Y., Shu, J., Chen, H., Pan, C., Lei, C., and Wang, X. (2009). A Pst-1 Polymorphism at 3’UTR of goat POU1F1 gene and its effect on Cashmere production. Molecular Biology Reports. 36: 1371-1374.

  13. Phyu, P.P., Pichler, R., Soe, O., Aung, P.P., Than, M., Shamsuddhin, M., Diallo, A. and Periasamy, K. (2017). Genetic diversity, population structure and phylogeography of Myanmar goats. Small Ruminant Research. 148: 33-42.

  14. Sambrook, J. and Russell, D.W. (2001). Molecular cloning: A laboratory manual. (3rd Ed.). Cold Spring Harbor Laboratory Press, New York. 1886 p.

  15. Sanguinetti, C.J., Dias, E.N. and Simpson, A.J. (1994). Rapid silver staining and recovery of PCR products separated on polyacrylamide gels. BioTechniques. 17(5): 914-921.

  16. Sankhyan, V., Thakur, Y.P. and Dogra, P.K. (2019). Genetic polymorphism in IGF-1 gene in four sheep and goat breeds and its association with biometrical traits in migratory Gaddi goat breed of western Himalayan state of Himachal Pradesh, India. Indian Journal of Animal Research. DOI: 10.18805/ijar.B-3795.

  17. Sharma, S.M., Tiwari, M., Sharma, S., Singh, S.P., Sharma, A. and Pandey, V. (2013). The study of Pit-1/ POU1F1 gene polymorphism in Indian Barbari goat using PCR-RFLP methods. Indian Veterinary Journal. 90: 15-16.

  18. Zhou, F., Yang, Q., Lei, C., Chen, H. and Lan, X. (2016). Relationship between genetic variants of POU1F1, PROP1, IGFBP3 genes and milk performance in Guanzhong dairy goats. Small Ruminant Research. 140: 40-45.
Reviewed By

Download Article
In this Article
    Contact us
    Follow us

    Editorial Board

    View all (0)