Indian Journal of Animal Research

  • Chief EditorK.M.L. Pathak

  • Print ISSN 0367-6722

  • Online ISSN 0976-0555

  • NAAS Rating 6.50

  • SJR 0.263

  • Impact Factor 0.4 (2024)

Frequency :
Monthly (January, February, March, April, May, June, July, August, September, October, November and December)
Indexing Services :
Science Citation Index Expanded, BIOSIS Preview, ISI Citation Index, Biological Abstracts, Scopus, AGRICOLA, Google Scholar, CrossRef, CAB Abstracting Journals, Chemical Abstracts, Indian Science Abstracts, EBSCO Indexing Services, Index Copernicus
Submit

Research Article

Indian Journal of Animal Research, volume 55 issue 1 (january 2021) : 6-10

Mitochondrial D-loop Genetic Diversity Studies of Rhinoceros unicornis in Assam, India

Puranjit Das1,*, Rita Choudhury1
1Department of Zoology, Bhattadev University, Bajali, Pathsala-781 325, Assam, India.
Cite article:- Das Puranjit, Choudhury Rita (2020). Mitochondrial D-loop Genetic Diversity Studies of Rhinoceros unicornis in Assam, India . Indian Journal of Animal Research. 55(1): 6-10. doi: 10.18805/ijar.B-3926.

ABSTRACT

In Assam wild populations of great Indian rhinoceros are found in three protected areas namely Kaziranga National Park, Orang National Park and Pobitora Wildlife Sanctuary. But it remains an area of investigation whether these three populations are homogeneous or not. To resolve this matter present genetic study was performed on mitochondrial DNA control region by using non invasive dung samples collected from the three natural habitats. The study showed a high level of genetic diversity of rhinoceros population in three habitats of Assam with 24 haplotypes from 196 samples and 21 variable sites in 413bp long nucleotide sequences was recorded. The Fst value also showed differences between the groups; and significant values obtained between Kaziranga and Pobitora with Orang groups. AMOVA analyses revealed the total genetic diversity is 91.62% and diversity between populations is only 8.38%. Thus the higher genetic variability found in Indian rhinoceros populations is important for future survivability, management and translocation to new habitat.

INTRODUCTION

Rhinoceros unicornis Linnaeus, 1758 is the largest Perissodactyl characterized by a single large horn found in India and Nepal. In India the largest and growing population is found in the Kaziranga National Park of Assam (Laurie et al., 1983) and the other two habitats are Orang National Park and Pobitora Wildlife Sanctuary. In past (c. 1400 AD), the Indian rhinoceros was found in the flood plains of Brahmaputra river and Gangetic plain, Indus River Valley and  Myanmar with more than 450,000 individuals (Blanford, 1891; Laurie, 1978; Dinerstein and Price, 1991). But during early part of 19th century (1908 AD) the rhinoceros population was decreased significantly due to killing, poaching and habitat loss and population become fragmented (Laurie et al., 1983). Now the natural populations of the Indian rhinoceros are only available in the states of Assam, Uttar Pradesh and West Bengal in India and the Terai of Nepal (Foose and van Strien, 1997). In Assam, all three rhinoceros populations are thought to be expanded from survived remaining population after 1908 AD without any fitness problems. To know more about genetic diversity at molecular level of the species which is related to fitness and survivability in a changing environments (Freeman and Herron, 1998) the rhinoceros populations from the three habitats were evaluated for genetic diversity based on the D-loop segment of mitochondrial DNA as marker because of its higher mutation rate correlated with evolutionary events (Avise, 1994; Kim et al., 2002).

MATERIALS AND METHODS

In the present study 352 fresh dung samples of rhinos were collected from three wild habitats namely Kaziranga National Park, Orang National Park (ONP) and Pobitora Wildlife Sanctuary (PWLS) out of which only 196 samples gave positive amplification. To obtain genomic DNA, the outermost layer of the dung samples were collected, as this layer contain the cell of intestinal mucosa. Approximately 10g of fresh dung were placed in 50ml polypropylene tube containing 95% ethanol (Merck) and labeled properly and kept at -20°C until DNA isolation.
        
Genomic DNA extraction was carried out from the alcohol preserved dung samples by QIAmp DNA stool mini kit (QIAGEN Inc.) with slight alternations in the prescribed protocol. During the DNA extraction from dung, in addition to faecal matter approximately 100 µl alcohol was also taken from the bottom of the sample vial. The DNA was evaluated for its quality via agarose gel electrophoresis, and quantity was measured using a Nano Drop spectrophotometer.
 
Primers
 
To amplify 420 bp (expected) long D-loop control region located in tRNA-Pro and D-loop of mitochondrial genome, a set of region specific generic primers RH-D-F1 and RH-D-R1 (Fernando et al., 2006) were selected. The sequences of the primers are RH-D-F1CATCAACACCCAAAGCTGAAA and RH-D-R1ATGGGCCCGGAGCGAGAACGA.

PCR amplification
 
PCR amplification was performed in 25µl reaction mix  using 2µl genomic DNA (10-30ng), 2µl 100μg/ μL BSA, 2.5 µl 1.5X taq buffer A, 0.5 µl (1.5mM) MgCl2, 2.5 µl (0.25mM) dNTP separate (SIGMA),  each primer forward and reverse of 0.5 µl (10 µM), 0.1 µl AmpliTaq Gold DNA polymerase and 14.4 µl water. Amplification of specific product was carried out in Master cycler employing initial denaturation at 95°C for 4 min followed by 50 cycles of denaturation at 94°C for 1 min, annealing at 68°C for 1 min and primer extension at 72°C for 1.5 min. On completion of the cycles, the reaction mixture was incubated further at 72°C for 5 min and 4°C forever. The amplified PCR products (approximately 1.5 µl) were checked for appropriate size with 2% agarose gel (Fig 1) with suitable molecular marker. After electrophoresis, the PCR products were cleaned up by adding 3µl of Exo-SAP mixture (Shrimp Alkaline Phosphatase) per 20µl reaction. For purification of a few samples gel extraction method was also followed. The purified products were then sequenced in both forward and reverse direction in ABI automated sequencer (Applied Biosystems).
 

Fig 1: PCR products of 420bp size A to C with 100 bp ladder.


 
Data analysis
 
Amplified 413bp of D loop fragment of R. unicornis were aligned using CLUSTALW program (Thompson et al., 1994), inbuilt in the genetic analysis package MEGA 7.0 (Kumar et al., 2016). Sequences were then checked with Finch TV1.4 (Geospiza. com) and then visually refined. A total of 24 haplotypes were obtained from 196 D-loop sequences. The haplotype sequenced data were then analyzed with the help of BLAST for homology search. In addition to the samples collected in this study, two GenBank data (Acc. No.X97336.1 and NC 001779.1) were used to compare and draw phylogenetic tree. Identical haplotypes, polymorphic sites, haplotype diversity and variance of haplotype diversity within the population were detected in DnaSP 5.0 (Rozas et al., 2003). Nucleotide composition of all haplotype sequences, type of substitutions, haplotype distance matrix, pairwise Fst Matrix (Weir and Cockerham, 1984) and pairwise differences (Nei’s standard genetic distances) of three Indian rhino population and for all samples of R. unicornis were determined by Arlequin 3.0 (Excoffier et al., 2005). Hierarchical genetic structure was inferred using analysis of molecular variance (AMOVA) for all haplotype data were also calculated in Arlequin 3.0. Different phylogenetic trees were constructed for all haplotypes with the Diceros bicornis sequence (Acc. No. L22010) as an out group based on the p-distance and Kimura’s 2 parameter model using MEGA 7.0. Bootstrap analysis (1000 data sets) was used to assess confidence in the branching order into the dendrogram. Genetic distances among different haplotypes were also calculated by Kimura 2 parameter method using MEGA7.0. A parsimony network linking all haplotypes was developed using NETWORK 4.6.1.1 (Bandelt et al., 1999) for a visualization of the relationship among the haplotypes separately.

RESULTS AND DISCUSSION

The Nucleotide positions of the sequenced segment of DNA were assigned according to the complete rhinoceros mtDNA reference sequence (15412-15824 nts) GenBank Accession No. X97336. 21 variable sites were found in total 24 haplotypes obtained from 196 D-loop sequences from three different rhino habitats. The same haplotype obtained from different habitat given same ID code placing the first letter of the habitat (H1 from Kaziranga as KH1). Out of 21 polymorphic sites, 8 are singleton variable sites and remaining 13 are parsimony informative sites. In the rhino group of Kaziranga National Park (KNP) 22 different haplotypes were obtained, 9 haplotypes were detected in Pobitora WLS (PWLS) and 7 haplotypes were found in Orang National Park (RONP). In Fig 2 the distribution and frequencies of different haplotypes of R. unicornis in three protected areas of Assam are presented. The mean haplotype diversity of the three rhino groups is (Hd) 0.97571±0.011. The 21 Polymorphic sites within 24 haplotypes of R. unicornis obtained from three areas of Assam and two GenBank sequences was given in Fig 3 with reference to that sequence acc, no. X97336. The variable positions of nucleotides are found commonly in particular locus. Highest genetic diversity (0.99567) was observed among the rhinos of Kaziranga National Park. No statistical significance for Fu’s Fs or Tajima’s D values was observed for whole population or population for each habitat (P > 0.10). The average nucleotide composition of all haplotype sequences were  34.18%A, 29.34%T, 12.76% G and 23.72% C and the average nucleotide content of A + T (63.52%) was obviously higher than that of G + C (36.48%). The nucleotide compositions of D-loop sequence from three rhino groups are nearly similar. The phylogenetic tree (Fig 4) revealed a low differentiation between the different haplotypes of R. unicornis of three different habitats. Bootstrap analysis showed bootstrap values lower than 70, except in the few haplotypes such as H21, H22 and H23.
 

Fig 2: D-loop haplotypes of R. unicornis in three habitats.


 

Fig 3: Polymorphic sites within 24 D-loop haplotypes of R. unicornis with two GenBank sequences


 

Fig 4: The Neighbour-joining tree of R. unicornis haplotypes with two GenBank sequences


        
The Medium-joining network (Haplotype network) of all mtDNA haplotypes of R. unicornis (Fig 5) indicated that there could have more D-loop haplotypes in the wild populations. The network analysis (conducted with NETWORK 4.6.1.1) depicted that H9 as a historical haplotype. The other haplotypes have link with H9, on the other hand H1 is another stock in whom a large number of haplotypes have connections.
 

Fig 5: Medium-joining networks (Haplotype network) of mtDNA haplotypes.


        
The Standardized variance in allele frequencies (Fst) calculated by Arlequin based on Kimura 2 parameters for three groups of rhinos suggested that Kaziranga rhinoceros are more homogenous to Orang rhino group. Whereas according to Kimura 2 parameter model, there is a difference between Kaziranga and Orang rhino groups (Fst = 0.0393) and Pobitora and Orang (Fst=0.0220) which signifies little difference (Fst value 0.0 to 0.05; Wright, 1965). When analysis was done by taking Kaziranga and Pobitora as one group and Orang as other group, the Fst based on F-Statistics was found 0.09259 which is significant.
        
Three different AMOVA analyses were done to explain genetic variation (within and among the groups) among rhinos revealed that 91.62% of the total genetic diversity existed within populations and only 8.38% accounted for between populations. The average number of nucleotide differences between Kaziranga and Orang rhino group is 4.481 and the same differences between Kaziranga and Pobitora rhino group is 4.020. The average number of nucleotide substitution per site between populations (Dxy) of Kaziranga and Orang rhino group is 0.01085 while this value is 0.00973 between Kaziranga and Pobitora rhino group.
    
The present study recorded 24 haplotypes from 196 D loop sequences of rhinoceros where as earlier studies (Das and Goswami, 2012a) reported only 3 haplotypes (Hap03, Hap04 and Hap05) from 14 samples in KNP might be due to small sample size. Significant haplotype diversity (0.99567) is found in the present study indicated a rich genetic diversity of rhinoceros population suggesting multiple ancestral lineages. Haplotype 9 (hap 09) was found to be more prominent and abundant in three rhino habitats.
        
Hap01 was found to be the second most available haplotype. The variations of the D-loop sequences are very less which was found from polymorphic site analysis indicating rapid evolving nature of D-loop and its high mutation rate (Saccone et al., 1991). Such variation of allele is caused due to genetic drift, selection, gene flow and local adaptation imposed by environment and humans (Hartl and Clark, 1997). The genetic diversity is probably related to adaptation to changing environmental conditions (Hirayama et al., 2010). The genetic diversity has been always found to have positive implications to a population. The phylogenetic analyses based on different criterion showed that though the rhino population has genetic diversity but their differentiations do not reach to a level to categorize as a sub population. They cannot be considered as separate clade until more analysis on different nuclear DNA is done. The presence of same haplotypes in the three habitats might be due to gene flow between the groups and movement across habitats as the species is highly mobile and good swimmers. The patterns of demography and hierarchical genetic structure of species with limited geographic range are important elements in determining the population structure, in the development of an effective and sustainable management plan (McCracken et al., 2001). The genetic diversity database of rhinoceros population will help in various conservation efforts such as translocation of individuals and population viability assessments (Florescu et al., 2003; Harley et al., 2005). Large sample size in Kaziranga national park has possibility to obtain more D-loop haplotypes. The genetic diversity in rhinos found in this study did not correspond to reports of Zschokke and Baur (2002); who reported monomorphic pattern. However, recent studies by Zschokke et al., (2011) on captive rhino population from different zoos have demonstrated that R. unicornis population is genetically diverged. In another explanation it can be inferred that as there were a large number (24) of D-loop sequence haplotypes for the mtDNA was found in the rhino population in Assam there may be recent population expansion. One possible explanation  for the high  diversity of R. unicornis found in Assam particularly the KNP have harbor the remaining population in the late 19th and early 20th century that had to moved into the Park from nearby forest areas after losing habitat in the historic range of Brahmaputra River basins.
        
Appropriate information on the genetic diversity of wild animals is now essential for wildlife conservation and management and initiatives (Soltis and Gitzendanner, 1999). The greater the genetic diversity within a population, the better it is for the survival of the species (Kierstein et al., 2004). Protection of suitable rhino habitat seems to be important aspect of rhino conservation (Das and Goswami, 2012b).
               
The high level of genetic variation found in Indian rhinoceros populations has ample scope for evolution to occur and helps in the management and translocation of the rhino population to new habitat. The ongoing translocation programme of rhino from Kaziranga and Pobitora and reintroduction it to the former habitat in Manas National Park of Assam should also follow the genetic guideline for better success in the project.

REFERENCES


  1. Avis, J. C. (1994). Molecular markers, Natural history and evolution. Chapman and Hall. New York, London. pp 511.

  2. Bandelt, H.J., Forster, P., Rohl, A. (1999). Median-joining networks for inferring intraspecific phylogenies. Mol. Bio. Evol. 16 (1):37-48.

  3. Blanford, W.T. (1891). The Fauna of British India, including Ceylon and Burma. Mammalia. Taylor and Francis, London.

  4. Das, P. and Goswami, U. C. (2012a). Certain aspects of biology, threats and conservation policies of Rhinoceros unicornis In: Diversity and Physiological Processes, [Eds. Desai, P V and R. Roy], Goa University. 1-16.

  5. Das, P. and Goswami, U. C. (2012b). Status, distribution and threats on five extant species of Rhinoceros. Proceedings of Zool. Soc. India. 11 (2):73-79.

  6. Dinerstein, E. and Price, L. (1991). Demography and habitat use by greater one horned rhinoceros in Nepal. Journal of Wildlife Management. 55: 401-411. 

  7. Excoffier, L., Laval, G., Schneider, S. (2005). Arlequin ver3.0: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online. 1:47–50

  8. Fernando, P., Polet, G., Foead, N., Ng, L.S., Pastorini, J., Melnick, D.J. (2006). Genetic diversity, phylogeny and conservation of the Javan rhinoceros (Rhinoceros sondaicus). Conservation Genetics. 7: 439-448.

  9. Florescu, A., Davila, J., Scott, C., Fernando, P., Kellner, K., Morales, J., Melnick, D., Boag, P., Van Coeverden De Groot, P. (2003). Polymorphic microsatellites in white rhinoceros. Mol. Ecol. Notes. 3: 344-345.

  10. Foose, T.J. and van Strien, N. (1997). Asian rhinos: Status survey and conservation action plan. IUCN, Gland and Cambridge.

  11. Freeman, S. and Herron, J. C. (1998). Evolutionary analysis. Upper Saddle River, Prentice-Hall. New Jersey.

  12. Harley, E., Baumgarten, I., Cunningham, J., O’ryan, C. (2005). Genetic variation and population structure in remnant populations of black rhinoceros, Diceros bicornis, in Africa. Mol. Ecol. 14: 2981-2990.

  13. Hartl, D. L. and Clark, A. G. (1997). Principles of Population Genetics, 3rd ed. Sinauer Associates. Saunderland, Massachusetts. pp 542.

  14. Hirayama, M., Mukai, T., Miya, M. et al. (2010) Intraspecific variation in the mitochondrial genome among local populations of Medaka Oryzias latipes. Gene. 457: 13-24.

  15. Kierstein, G., Vallinoto, M., Silva, A., Schneider, M. P., Iannuzzi, L., Brenig, B. (2004). Analysis of mitochondrial D-loop region casts new light on domestic water buffalo (Bubalus bubalis) phylogeny. Mol. Phylogenet. Evol. 30:308-324.

  16. Kim, K.I., Lee, J.H., Li, K., Zhang, Y.P., Lee, S.S., Gongora, J., Moran, C. (2002). Phylogenetic relationships of Asian and European pig breeds determined by mitochondrial DNA D-loop sequence polymorphism. Anim. Genet. 33: 19-25. 

  17. Kumar, S., Stecher, G., Tamura, K. (2016). MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33: 870-1874.

  18. Laurie, W. A. (1978). The ecology and the behaviour of the Great one horned rhinoceros (Rhinoceros unicornis). Ph D. dissertation, University of Cambridge, Cambridge, pp 450.

  19. Laurie, W.A., Lang, E.M., Groves, C.P. (1983). Rhinoceros unicornis. Mammalian Species. 211: 1-6. 

  20. McCracken, K.G., Johnson W. P., Sheldon F. H. (2001). Molecular population genetics, phylogeography and conservation biology of the mottled duck (Anasfulvigula). Conserv Genet. 2:87-102.

  21. Rozas, J., Sanchez-DelBarrio, J.C., Messeguer, X., Rozas, R. (2003). DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics. 19: 2496-2497.

  22. Saccone, C., Pesole, G., Sbisa, E. (1991). The main regulatory region of mammalian mitochondrial DNA: structure- function model and evolutionary pattern. J Mol Evol. 33:83-91.

  23. Soltis, P.S. and Gitzendanner, M.A. (1999). Molecular systematics and the conservation of rare species. Conservation Biology. 13:471-483.

  24. Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994). CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment through Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice. Nucleic Acids Research. 22: 4673-4680.

  25. Weir, B. S. and Cockerham, C. C. (1984). Estimating F-statistics for the analysis of population structure. Evolution. 38: 1358-1370.

  26. Wright, S. (1965). The interpretation of population structure by F-    statistics with special regard to systems of mating. Evolution. 19(3):395-420.

  27. Zschokke, S. and Baur, B. (2002). Inbreeding, outbreeding, infant growth and size dimorphism in captive Indian rhinoceros (Rhinoceros unicornis). Canadian Journal of Zoology. 80: 2014-2023.

  28. Zschokke, S., Armbruster, F. J., Sylvain, U., Bruno, B. (2011). Genetic differences between the two remaining wild populations of the endangered Indian rhinoceros (Rhinoceros unicornis). Biological Conservation. 144: 2702-2709.
Reviewed By

Download Article
In this Article
    Contact us
    Follow us

    Editorial Board

    View all (0)