Cloning and Expression of Twin-Arginine Translocation D Family Deoxyribonuclease of Clostridium Chauvoei

Black Quarter, an acute, highly fatal disease of ruminants, is caused by Clostridium chauvoei. It has been reported in various species of animals and two human cases have also been reported (Nagano et al., 2008). Infected animal dies within 12 to 36 hrs after the appearance of the symptoms (Hatheway 1990). Spores remain viable in the soil for years together and hence act as the major source of infection (Sathish and Swaminathan 2008). The spores enter the animal’s body and their germination induced by amino acids often coupled with potassium and sodium ions occurs upon muscle injury (Durre 2014).
        
It has been proposed that C. chauvoei produces various toxins, viz. alpha, beta, gamma and delta toxins (Moussa 1958). Further studies on C. chauvoei virulence factors confirmed sialidase and flagellin also as the contributors to the pathogenicity (Tamura et al., 1995). However, among these proposed toxins, the genes for nanA sialidase, hyaluronidase, cctA and flagellin only have been characterized (Tamura et al., 1984; Tamura et al., 1995; Kojima et al., 2000; Vilei et al., 2011; Frey et al., 2012; Dangi et al., 2017; Dangi et al., 2018), and the role of other toxins including beta toxin (deoxyribonuclease) and the existence of genes encoding these toxins is not known.
        
Deoxyribonucleases can degrade highly polymerized deoxyribonucleic acid. Production of deoxyribonuclease indicates the virulence mechanism in many bacteria including Clostridium (Koneman 1997). Earlier studies have proposed that C. chauvoei produces deoxyribonuclease (Carloni et al., 2005). Studies have also reported beta toxin as a heat-stable toxin, activated or inhibited by metal ions and chelating agents (Princewill and Oakley 1976; Hatheway 1990). They are responsible for nuclear breakdown of muscle cells and involved in the process of gangrenous myositis (Songer 1998; Cortiñas et al., 1999). However, no study has yet attributed specific gene responsible for deoxyribonuclase activity. Twin-arginine translocation family deoxyribonuclease (TatD) reported to be a cytoplasmic magnesium dependent deoxyribonuclease expressed by various bacterial species (Chen et al., 2014). TatD is detected almost exclusively in the cytoplasmic protein fraction suggesting that it is normally located in the cytoplasm (Wexler et al., 2000). In the present study, we expressed and characterized the gene for TatD family deoxyribonuclease (tatD) of C. chauvoei.

Bacterial strains and plasmids
 
E. cloni 10G competent cells and pRham-N-His SUMO Kan vector were procured from Lucigen Corporation, USA. E. cloni 10G cells were cultured in Luria Bertani broth or agar under aerobic conditions at 37°C. Clostridium chauvoei ATCC 10092 strain (ATCC, USA) was cultured in ATCC 2107  modified reinforced clostridial (MRC) medium (1% Tryptose, 1% Beef extract, 0.3% Yeast extract, 0.5% Dextrose, 0.5% NaCl, 0.1% Soluble Starch, 0.05% L-cystineHCl and 0.03% Sodium acetate, pH 7.2) at 37°C for 48 h under anaerobic conditions. The genomic DNA was isolated from the culture using Genomic DNA isolation kit (Thermo Scientific, USA) as per the manufacturer’s protocol and used for species confirmation by PCR targeting the 16S-23S rDNA spacer region and cctA gene as reported earlier (Sasaki et al., 2000; Dangi et al., 2017; Kumar et al., 2018).
 
PCR amplification of tatD gene of C. chauvoei
 
PCR amplification of the tatD gene was carried out in a 25 μl reaction mixture consisting of 2.5 µl of 10X Taq Buffer, 0.5 µl MgSO₄ (25mM), 0.5 µl dNTPs (10mM), 0.5 µl of 10 pmoles/µl each of the primers (For- 5’-CGCGAACAGA TTCGA GGTGAAGGAAAATATTTAATTTTT-3’ and Rev- 5’-GTGGC GGCCGCTCTATTATATTCTA TTTTCAAGCAAGTC-3’), 0.25 µl Pfu polymerase: Taq Polymerase (1:15). To this, about 1.5 µl of genomic DNA was added and the PCR was performed in a thermocycler (Agilent Technologies, USA) with initial denaturation temperature of 94°C for 5 min followed by 34 cycles of denaturation of 94°C for 1 min, annealing temperature of 51°C for 1 min and extension of 72°C for 1min. Final extension was carried out at 72°C for 10 min. PCR product was analysed by agarose gel electrophoresis and gel extraction was carried out according to the manufacturer’s protocol using the Mini Elute Gel extraction kit (Thermo Scientific, USA).
 
Cloning and sequencing of the tatD gene
 
Purified tatD PCR product was cloned into pRham-N-His SUMO Kan expression vector and transformation was performed according to the manufacturer’s protocol (Lucigen, USA). Briefly, 25 ng of the vector DNA was added to the 100 ng of the purified PCR product, mixed gently and then the mixture was added to 40 μl of E. cloni 10G competent cells. The transformed product was plated onto LB agar plates containing 30 μg/ml Kanamycin and incubated at 37°C overnight. The recombinant clones obtained were screened and confirmed by colony PCR using the gene specific primers.
        
Recombinant plasmids were extracted from the positive clones and were sequenced at a custom DNA sequencing facility (Eurofins). Sequences were analysed using BLAST programme of NCBI (https://www.ncbi.nlm.nih.gov/) against the nucleotide database. A phylogenetic analysis of the nucleotide and protein sequences of the gene was also done using the MegaX software (Tamura et al., 2013).
 
Expression and protein purification of TatD deoxyribonuclease gene
 
The recombinant clones were subcultured and the protein expression was obtained by induction with 0.2% L-Rhamnose. The induction was done when the OD₆₀₀ of the culture reached 0.4-0.6. The protein expression was confirmed by SDS-PAGE and Western Blot analysis. The recombinant TatD deoxyribonuclease expressed protein was produced in bulk in 500 ml of LB broth. Further, the polyhistidine (6X His) tagged fusion protein was purified under denaturing conditions in urea using Ni-NTA affinity chromatography. The purified protein was pooled in a dialysis membrane (Qiagen, Germany) and dialyzed against decreasing concentrations of urea (7 M to 0.5 M) and one litre phosphate buffered saline to remove urea. The protein concentration was determined by Bradford assay (Ramagli and Rodriguez 1985).
 
Western Blot for the detection of the His-tagged recombinant TatD deoxyribonuclease protein
 
The reactivity of the recombinant protein with the antiserum raised against the recombinant TatD protein was checked by Western blot analysis (Towbin et al., 1979). Protein was transferred to nitrocellulose membrane, blocked and then 1:200 dilution of primary antibody (Goat anti-chicken IgY) in blocking buffer (5% skimmed milk powder in PBS) was added and incubated at 37°C for 2 hrs. After washing 3 times with PBST (500 μl Tween-20 in 1000 ml PBS), 1:10,000 dilutions of secondary antibody (anti-chicken HRPO conjugate; Sigma, USA) in blocking buffer was added and kept at 37°C for 2 hrs. The blotted nitrocellulose membrane was developed using DAB solution.

The beta toxin (deoxyribonuclease), among the proposed toxins of C. chauvoei, is postulated to be one of the major toxin responsible for the degradation of host DNA. Though previous reports showed deoxyribonuclease activity of the pathogen, no specific deoxyribonuclease protein has been identified yet. Complete genome sequence of C. chauvoei for a Switzerland (JF4335), German (12S0467) and ATCC 10092 (DSM 7528) strains are currently available (Falquet et al., 2013; Thomas et al., 2017). These studies have mostly targeted the genome composition, potential virulence factors, CRISPR elements, prophage composition and genetic divergence of the species (Frey and Falquet 2015; Thomas et al., 2017). As a preliminary step in identification of deoxyribonuclase protein, in the present study, we expressed and characterized TatD deoxyribonuclease of C. chauvoei.
        
First, we confirmed the species identity of C. chauvoei by16S-23S rDNA spacer region and cctA gene specific PCR, which revealed 522 bp and 983 bp target specific amplicons, respectively (Fig 1).
 

        
Next, the amplification of the tatD gene using the designed gene specific primers was obtained at the expected size of 780 bp (Fig 2). The purified PCR product was cloned into pRham-N-His SUMO Kan vector and transformed into E. cloni 10G competent cells. Four colonies were obtained, which were then confirmed by colony PCR. All of them gave amplification at the desired size of 780 bp with the gene specific primers.
 

        
Later on, plasmid was isolated from the tatD clones and sequenced. The sequence was submitted to NCBI nucleotide sequence database and was assigned with accession number - MF177720. The tatD sequence was aligned with sequences from other closely related Clostridia and phylogenetic tree was constructed. The phylogenetic analysis of tatD sequences indicated the close relationship of C. chauvoei strains to the C. isatidis, an indigo reducing anaerobe, followed by C. saccharobutylicum, C. botulinum and C. taeniosporum (Fig 3).
 

        
Further, the positive recombinant clones of E. cloni 10G cells were induced for protein expression and the clones showed the expression of protein at the expected size of 42.3 kDa, as analyzed by SDS-PAGE (Fig 4A). The TatD deoxyribonuclease protein was purified by Ni-NTA affinity chromatography and the eluted fraction of the protein was assessed by SDS-PAGEanalysis (Fig 4B). On Western Blotting, using anti-His antibodies, a specific band at 42.3 kDa size was obtained both in the expressed and the purified protein samples (Fig 4C).
 

        
The deoxyribonuclease activity of the organism is already evident (Chaudhuri and Singh 1992). TatD deoxyribonuclease is reported to be a cytoplasmic protein in bacteria having a magnesium-dependent deoxyribonuclease activity. The DNase enzyme is responsible for the hydrolytic cleavage of phosphodiester bonds in the DNA backbone, thereby causing the degradation of the DNA. The production of extracellular nuclease which degrades the DNA in Clostridium sp. has been observed (Timmis and Winkler 1973).
        
DNase production by C. septicum was detected previously and the molecular weight of the DNase of C. septicum was found out to be 45kDa. On comparing the DNase activity with the DNAse activity of other Clostridial species C.septicuminthe culture supernatant was observed to be having the strongest DNase activity (Swiatek et al., 1987). In case of C. acetobutylicum, it was observed that the maximum DNase activity was obtained in the cell-wall compartmentalised fraction which indicates that this protein in present outside the cytoplasmic membrane. This was detected by the examinig the DNA hydrolysis around the cells (Burchhardt and Dürre 1990). The presence of extracellular DNase in C. botulinum posed a problem in its DNA isolation by causing the degradation of the DNA (Hielm et al., 1998). A recent study reported TatD-like DNase (PfTatD) as a novel virulence factor of Plasmodium spp. The study also proved that PfTatD exhibits typical deoxyribonuclease activity, and its expression is higher in virulent parasites than in avirulent parasites. The mice immunized with recombinant TatD exhibit increased immunity against lethal challenge (Chang et al., 2016).

To summarize, in the present study, the tatD gene was successfully cloned into pRham-N-His SUMO Kan expression vector and sequence of tatD was analyzed. Phylogenetic analysis of tatD gene showed that C. chauvoei strains were closely related to C. isatidis, C. saccharobutylicum, C. botulinum and C. taeniosporum. Upon induction of positive recombinant clones, the expression of TatD deoxyribonuclease was obtained at size of 42.3 kDa which was confirmed by SDS-PAGE and Western Blot analysis.