Redescription and New Host Record of Heteraxinoides atlanticus (Monogenea: Heteraxinidae) from the Gills of Nemipterus japonicus (Bloch) and Its Systematics

The organisms belonging to class Monogenea are structurally diversified, cosmopolitan and mainly affecting the fishes. Several species of monogenean parasites have been listed and documented but knowledge about the Indian marine parasites is very limited and require thorough expedition (Pandey and Agrawal, 2008). While questing the fishes of Indian Western coast of the Arabian Sea region, a parasitic species Heteraxinoides atlanticus Gayevskaya et Kovaleva (1979) was observed on the gills of Nemipterus japonicus (Bloch, 1791) and is redescribed, as the original description by Gayevskaya and Kovaleva (1979) was based upon limited material. The present study provides the new geographical locality for the parasite in Arabian Sea waters. For the better knowledge of evolutionary relationship in Heteraxinidae, partial 18S and 28S rDNA sequence of H. atlanticus were compared with other heteraxinids. Apart from this, another species H. karachiensis Hadi and Bilqees (2014), reported from the gills of Scomberomorus guttatus (Bloch and Schneider, 1801) from off West Wharf Karachi coast, Pakistan, has been compared with H. atlanticus and its taxonomic position is also discussed.

Collection of host and parasite
 
A total of 234 freshly dead specimens of Nemipterus japonicus Bloch, 1791 were procured at Versova dock landing centre (19°7'60"N 72°47'60"E) in Mumbai, Maharashtra, India during March-April, 2015 from local fishermen using trawlers and dol nets (Fig 1). The fish was identified on the basis of database by Froese and Pauly (2015) and identification sheets by Fischer and Bianchi (1984). The gills were excised and placed at 60C in refrigerator (overnight) for the release of parasites from gills (Mizelle, 1936). The parasites were observed using dissecting microscope (Motic, ST-30 series) and compound microscope (Motic, B1-220A). A total of 35 parasites were collected from the gills. For molecular work, the parasites were stored in absolute alcohol. The temporary mounts were prepared in glycerine and permanent mounts were prepared by staining with Gomori’s trichome stain (Gomori, 1950) followed by mounting in Canada balsam or DPX resin.
 

       
The study was carried out during the period of March 2015 - January 2017, at Fisheries Resources Harvest and Post-harvest Division of Central Institute of Fisheries Education (ICAR-CIFE), Mumbai and Department of Zoology, University of Lucknow, Lucknow.
 
Morphological methods
 
The specimens were measured with the aid of Olympus (BX51) phase contrast microscope (Japan). The measurements were presented in micrometers as mean and followed by range in parentheses. The images were captured by cool snap HQ (Olympus) digital camera and Image Pro-express 6.0 software. The drawings were made with the help of drawing tube attached to the phase contrast microscope. The terminology of Tripathi (1957) was adopted for description of the parasite. Four voucher specimen slides were deposited to the Parasites and Vectors Section of The Natural History Museum, London with accession number for paratypes - NHMUK 2016.1.13.1-4. Voucher specimens of H. atlanticus and H. karachiensis were not available for the study. 
 
Molecular methods
 
The total DNA was extracted from the alcohol preserved specimens using Qiagen DNeasy tissue kit (Qiagen, Germany) according to manufacturer’s protocol. The primers were commercially synthesized for all the genes in this study. The 18S rDNA gene was amplified according to Plaisance et al., (2005), using the forward primer - Worm A (5' ACGAATGGCTCATTAAATCAG 3') and reverse primer - Worm B (5' CTTGTTACGACTTTTACTTCC 3'). The 28S rDNA gene was amplified according to Plaisance et al., (2005), using the forward primer - Ancy 55 (5' GAGATTAG CCCATCACCGAAG 3') and reverse primer - LSU1200R (5’ GCATAGTTCACCATCTTTCGG 3'). The mitochondrial cytochrome oxidase I (mtCOI) gene was amplified according to Littlewood et al., (1997), using the forward primer - Asmit1 (5' TTTTTTGGGCATCCTGAGGT TTAT 3') and reverse primer - (5' TAAAGAAAGAACATAAT GAAAATG 3').  The PCR conditions for 18S and 28S rDNA genes were initial denaturation at 94^oC for 3 min, 35 cycles (30 sec at 94^oC, 30 sec at 52^oC, 2 min at 72^oC), after that final extension at 72^oC for 10 min and followed by cooling at 4^oC. The PCR conditions for mtCOI gene were initial denaturation at 95^oC for 5 min, 35 cycles (1 min at 94^oC, 1 min at 50^oC, 1 min at 72^oC), final extension at 72^oC for 6 min followed by cooling at 4^oC.
       
Amplification of 18S rDNA, 28S rDNA and mtCOI gene regions were conducted in a final reaction volume of 30 µl containing 1x PCR [(2 mM Tris-HCl (pH 8.4), 50 mM KCl)] buffer (Invitrogen, USA), 1.5 mM MgCl₂ (Invitrogen), 200 µM of dNTP mix (Promega, USA), 0.4 µM of each forward and reverse primer, 1U/µl Taq DNA polymerase (Invitrogen), 8 µl of DNA and 14.86 µl of Milli Q water were added in a microfuge tube and processed through PCR machine (Eppendorf Mastercycler, Germany). After amplification, PCR products were examined on 1% agarose gel electrophoresis and stained with ethidium bromide and visualized on gel documentation system (Vilber Lourmat, France). PCR products were purified and sequenced commercially by Xcelris Labs Limited, Ahmadabad, India using Big Dye Terminater version 3.1 Cycle sequencing Kit (Applied Biosystems, USA). Three new sequences of the H. atlanticus were submitted to GenBank database with accession number (KU245365 for 18S rDNA, KU245366 for 28S rDNA and KU358936 for mt COI gene) and only the sequences of 18S and 28S rDNA genes were utilized in this study. The other sequences utilized for phylogenetic analyses were retrieved from GenBank database (Table 2).
 

 
Analyses of DNA sequences
 
BLASTn (https://blast.ncbi.nlm.nih.gov/Blast.cgi) searches at NCBI were performed for partial sequences of 28S and 18S rDNA to reveal the degree of resemblance between species. The multiple sequence alignment of large and small ribosomal subunit of H. atlanticus (present study) along with other related species were executed with Clustal Omega version 1.2.1 (Sievers et al., 2011) using default option. Phylogenetic analysis was conducted using MEGA version 6.06 software (Tamura et al., 2013). Each data set was analyzed through maximum parsimony (MP) method. In the analysis, the codon positions (1^st, 2^nd and 3^rd) were also included and all positions containing gaps and missing data were eliminated. Bootstrap values were calculated on the basis of 1000 replicates for 28S and 18S rDNA molecular data sets. The MP trees were obtained using the Subtree-Pruning-Regrafting (SPR) algorithm with search level 5 in which the initial trees were obtained by the random addition of sequences (10 replicates) for both 28S and 18S ribosomal subunits.

Morphological findings
 
Class Monogenea Carus, 1863
Subclass Polyopisthocotylea Odhner, 1912
Order Mazocraeidea Bychowsky, 1957
Suborder Microcotylinea Lebedev, 1972
Family Heteraxinidae Price, 1962
Subfamily Heteraxininae Unnithan, 1957
Genus Heteraxinoides Yamaguti, 1963
Heteraxinoides atlanticus Gayevskaya et Kovaleva (1979)
 
Type host: Trachurus capensis (Castelnau, 1861) (Carangidae), common name - Cape horse mackerel.
 
Type locality: Shelf waters of Western Sahara, Guinea Bisau, Angola and Namibia.
 
Additional host: Nemipterus japonicus (Bloch, 1791), (Nemipteridae), common name - Japanese threadfin bream.
 
Additional locality: Versova dock landing centre, Mumbai, Indian western coast, India, 19^o7'60"N 72^o47'60"E.
 
Site of infection: Gills.
 
Infection details: 15 parasites collected from 10 infected fishes, examined fishes - 100, infection prevalence - 10%, mean intensity - 1.5, mean abundance - 0.15 (Hadi and Bilqees, 2014); a total of 35 parasites collected from 15 infected fishes, examined fishes - 234, infection prevalence - 6.41%, mean intensity - 2.33, mean abundance - 0.15 (present study).
 
Specimens examined: Paratype: four adult specimens (accession number - NHMUK 2016.1.13.1-4). Collected by A.K. Verma, 2015 from additional locality.
 
Description
 
The redescription is based on 16 flattened specimens, of which 11 were measured. Body elongated, dorso-ventrally flattened, anteriorly tapered; haptor relatively broad and pointed at right and left sides (Fig 2 and 3). Body length (including haptor) was 3151 (2840-3462), width 677 (609-745), haptor length was 337 (325-349) and width 1160 (1117-1203), maximum body width was at the posterior end of haptor. Haptor was asymmetrical with 25-30 and 2-5 clamps on long and short rows, respectively. Short row clamps were smaller than long row clamps in size. Long row clamp length was 92 (89-99) and width 56 (53-61), short row clamp length was 56 (50-64) and width 43 (40-44). Clamps were of typical microcotylid type. Terminal lappet or anchors were absent. Mouth was sub-terminal 142 (135-149) with two rounded, aseptate and unarmed oral suckers of length 110 (106-113) and width 78 (62-90). Pharynx was pyriform and 83 (82-84) long by 53 (48-56) wide. Oesophagus was short, tubular 95 (82-134) long and branched above the level of genital atrium. Intestinal caeca began at the level of genital atrium and reached to haptor, posteriorly not confluent, left branch slightly longer than right and terminating at or near level of anterior haptor clamp of short row, left branch length 2975 (2897-3120), right branch length 2685 (2540-2854) and width 244 (137-358). Genital atrium muscular, 84 (82-86) long by 63 (57-67) wide; three prominent rows of atrial spines, first outermost row of largest spines 3-5, length 30 (26-33), second row of medium spines 18-22 length 11 (10-12), third innermost row of small spines 6-7 length 8 (7-9). The largest spines of atrium might be the armature of cirrus.
 

 

       
Ovary in the middle region of body, pre-testicular, length 494 (478-513) and width 65 (27-102). Oviduct arose from right ovarian branch united with genitointestinal canal and ootype. Uterus extended anteriorly and medially led to genital atrium 629 (598-661) long by 48 (32-64) wide. Two vitelline ducts, 230 (173-289) long, united posteriorly to form common vitelline duct, 513 (467-558) long and collectively formed Y-shaped structure. Vitellarium follicular, located around intestinal caeca, from intestinal bifurcation to haptor.
       
Testes post-ovarian, intercaecal, were limited to posterior region of body, irregularly shaped, 19-23 in number; single testis length was 77 (68-84) and width 51 (38-62). Vas deferens as straight tube, originated from middle of body from testes and opened into genital atrium, length 618 (598-633) width 21 (17-25). Egg spindle shaped, operculated anteriorly with two very long polar filaments, filament near atrium was much longer and highly coiled. Egg length was 221 (193-251) and width 80 (71-94), without filaments dimensions. The length of apical filaments was difficult to measure due to excessive coiling; posterior filament 395 (363-427) long.
                                                                                
Molecular findings
 
BLASTn search for H. atlanticus revealed the similarity of 92.62% with Monaxine formionis followed by 92.33% and 91.93% with Probursata brasiliensis and Zeuxapta seriolae, respectively for 18S rDNA. In case of 28S rRNA, BLASTn search revealed the similarity of 91.47% with Zeuxapta seriolae isolate E607 followed by 90.75, 90.44 and 89.93% with Zeuxapta seriolae, Zeuxapta seriolae isolate Z5 and Cemocotylelloides carangis isolate CIFE-CC01, respectively. For mt COI gene, BLASTn search was not possible due to unavailability of sequences of heteraxinids. The alignment results showed ambiguous DNA region, insertions and deletions, were thoroughly analyzed. For 18S rDNA, out of 535 sites, 211 revealed alignments, 324 exhibited mismatch and 120 pointed insertion/deletions. In case of 28S rDNA, out of 600 sites 470 expressed alignment, 24 showed insertion/deletion and 130 indicated mismatch or variation. The evolutionary tree obtained with MP method exposed similar topology with different bootstrap values for large and small ribosomal subunits. The tree analyses of both the 18S and 28S rDNA sequences of H. atlanticus and other members of Heteraxinidae formed the separate clade with reference to outgroup of Diclidophoridae members as shown in Fig 4 and 5. 
 

 

       
Yamaguti (1963) erected Heteraxinoides to house the members with asymmetrical opisthohaptor, armed genital atrium and without vagina. The typical character of Heteraxinoides - genital atrium is covered inside with graded atrial spines. The type species is H. triangularis Goto, 1894, syn. Axine triangularis Goto, 1894, Heteraxine triangularis (Goto, 1894) Yamaguti, 1938. Yamaguti (1963) placed Heteraxinoides in Axinidae: Heteraxininae and his views were supported by Dillon and Hargis (1965). Price (1962) established new family Heteraxinidae to include Heteraxinoides and his placement was validated by Kritsky et al., (1978), Mamaev (1990) and Payne (1990). Till date, eighteen species of Heteraxinoides have been reported from all over the world from the gills of members of nine families of marine acanthopterygii fishes.
       
Gayevskaya and Kovaleva (1979) established the new species Heteraxinoides atlanticus, reported from various species of horse mackerel of the genus Trachurus - T. capensis, T. trachurus, T. picturatus and T. trecae. The differential diagnosis was based on the number of clamps, number of hooks of the genital atrium and their size and the number of testes among other species of the genus Heteraxinoides.
       
The present redescription of H. atlanticus is showing minor variations from the earlier description by Gayevskaya and Kovaleva (1979) and description of H. karachiensis by Hadi and Bilqees (2014) (Table 1). Atrial spine number and their size and egg dimension was not reported in H. karachiensis, but the number of testes (35) was on higher side as compared to present and previous description of H. atlanticus. Despite of few morphometric differences, the detailed anatomy of specimens of the present study is in accordance with description by Gayevskaya and Kovaleva (1979) and Hadi and Bilqees (2014).
 

In conclusion, H. atlanticus was previously reported mainly from the Atlantic waters, but in the present study, it was first time reported from the new locality of Arabian waters, India and additional host Nemipterus japonicus. Morphological and molecular analyses of H. atlanticus clearly revealed the considerable homology with other family members and its position in Heteraxinidae. The description of H. karachiensis by Hadi and Bilqees (2014) is very analogous to H. atlanticus by Gayevskaya and Kovaleva (1979) and present study, hence H. karachiensis must be synonymised as H. atlanticus and placed into Heteraxinidae Price (1962) instead of Axinidae Unnithan (1957).

The authors are thankful to Central Institute of Fisheries Education (ICAR-CIFE), Mumbai especially the scientists, Dr. G. Tripathi, Dr. S.K. Chakraborty, Dr. A.K. Jaiswar and Dr. K. Paniprasad for providing lab facilities during sample collection. Cooperation of Mr. Mukesh (ICAR-CIFE) during collection of hosts is considerable. The authors are also grateful to Prof. Nirupama Agrawal, Department of Zoology, University of Lucknow, Lucknow for providing laboratory facility and help in the preparation of manuscript. The second author renders special thanks to UGC-BSR-JRF providing financial assistance.